Equus_caballus Locus Mono:70:SNORD50
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:70:SNORD50
Equus_caballus
Mono:70:SNORD50
1
SNORD50
1001..1070
2070
AGAAAGCCCAGTGCTAAGGGACAAATACCAAACACAAGTTGCAACTTAGTGATTCACAG
GGAAAGAGATTGAAAGTGAGCAGGACCAGAAGTGGCAACCTGAGAGAAGCATTACTTCTG
GAGGAAAATCAGATACATTAAAAAAAGCCAGCAACCCCTTAAAGATACGGCAGTAAATGA
AATGAAAAGAAGAAGGGAAAATTAAGGATCTTAGGGAAACAAGACATGCCAAACCCTCCC
CTCATCTCACCACTACCACCACCATCATCTACATAAGAAATTACATGTAAAAGGGCAGAA
CTGACAGAAGACAGCAGTTCTGAACCCTGTCCATGAAATAAAAAATAGAAAAAAGCAATA
TCCATACAAAACTATTACCAAAAGAAAAAGCAAATAAGAGCCAAAACCCAATCACGACGC
TGGAGAAAACTGTAGCACAATGCTTTAAAACTGGATTACATCACCTCAAACAAGCATTTG
GGGATATGAAAACCCTTAATCAGATTAAAACACCTTTAATCAGAAATACTAAAACTAAGA
ATAGAAATGGACAAAAAAACAATAATAAATGAGAATTGATTAAACTCAGGACAAAAAAGA
GAAGAAAGTGAGAAAATCATATCAGAAAAGAATTCTAAATTATAAAGTATCTGAGGTAAG
ACAAATGAAAAATTAATAGCATCGAAACAAATCAGGAAAACAATGAAGAGAATTAAAATG
AAATGAAGTAAAGAAATACAGAATCAGAGAAAAAGTAGTTGAAACAGAAGACAGGCATAA
GAGAGCCAAGGTAAGTATAACTGGAATTACTGAAGAAGAAATTCAAAACAATAGAAAAGA
GCTAATATTTAAAACTGTAATCTAAGAAAACTTCCTGGAAATAAAAGAAGACCTGAATCT
GCACATTGAAAGTGTCCATGAGTGAGAAAACACTCACCCAGTATGATCAACTCCAAAGTA
TAACCTACTAAAACTGTTAGACTTTAAAGATAAAAGTCCTTACACCAGGATGATCCTATC
CCAAAACTGAATTTCTGTTGAAAAAACTTATACGGATCTGGCTTCTGAGACAGACCATTA
TAAGGACAATAGTATTTAAATAAGTTCTTCTGAAGTTGATAGTCTTATAAATCTCAAATG
TTTTTCCTTTTCTAGGGCTAGTGTCATGAAATTTACTTGTCCTATGAAAAACTGGTGATC
AGGAAAAGTTCTTCATTTTACAGACATGAAAAGAAAACATACAAATCAAGATGGATTATA
TTGATTTTTTAATTTTTAAAATAAATTTTGAGCCAACATCAAATCTAGATTAACGGATCC
ATAAGATTCAAGCCCTTTCTATTCAATCATATAACACTGTCCAAGAGAGTCACTGTCCAA
GAGAGTCACACTGTTAACCAGTAGGTTACTTCCTAGATCTATTTCTACTTTGTAAGTACA
GGAATACATGTGATACTAAGCATTTTCAATAAAAAGTTTTTTTTCAGTTAACCAGCCTGG
TAATCAAATTTTTCTAAATGAATATTTTACCTTTGGTCACCTGTTTGAATTTAAAATGCA
TAATTGTAATTAAAGCTGAGTGAAAGTTTAAAAATAAAAAAAGATAAAAGTCCTGAGAGC
CTTCAGGCAAAAAGATAAAATAATGTTAACAGCAAGAAAATCAGACTTCTCAATAACAAC
ATATAGAAAAGACAACAGTAGAGCAGCATTTTTAAAGAAAGAAAATGTAAACTAAGGATA
TTATCTCCAGCCAAGCTATAAAAATGCAATTTTGAACATGTCAGAACTTAGGGAACACTG
TATACATGTGCCCTTCCTGAGGAATTTACTTGAGCAAAGATCAGTAAACTTTCTGTATAA
GGGACAGTAAATATTTTAGGCTTCGTAAGTCATACAATCTCTACTGAATTACTCAAATCT
ACTATTGTAGTACAGAAGCAGCCATAAACAATAAATAAATGAATGAGCATGGCTATGTTC
TAACAAAACTTTATTTATGGTCACTGAAATTTTAGTTTCATATAATTTCCATGTATCATA
AAAGATTTTTCTTGTCTTTTTCCTGAACCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved