Equus_caballus Locus Poly:10:SNORD81
snOPY snoRNA Orthological Gene Database
Equus_caballus Poly:10:SNORD81
Equus_caballus
Poly:10:SNORD81
5
SNORD74, SNORD75, SNORD24, SNORD77, SNORD44, SNORD78, SNORD79, snosnR60_Z15, SNORD47, SNORD81
1001..1080, 1494..1555, 1715..1796, 2078..2145, 2451..2511, 2774..2838, 3219..3293, 3458..3539, 4124..4201, 4352..4428
5428
GGTCCAGGCGGGAGGCGTAGGCGGGCGGGGAGCTGCCCAGAGGTGGGTGTGTGTGTCTG
GGTGTGTCCGGGCTGCCGTGGGGGAGGGGGCCGCCCATCCCGGGGTCCTGAGGGAGGGGC
CCGGCGAGGGGGCGGGTCCGGCAGCTGAGCCCGGCCCGGGGCCAAGGGGGTGGAAGGTCT
CCGGGTGCCTTGAGGAGGGCTGAAGGGAAGTGTGCTGGGCGCCCCAGGAGCAGGCTGCGG
CGGAGACCCGGCAAGGCGGTCCCGTGTGCAGGGCAGCGGGACCAGCGTGCGGGGCCCGAG
CCCAGTCAAGGAGCAGCACCTACCTCCGGGGGTGGAAATGGGCCGGAATGGGCCGGAACT
CCGTCCCCGGAAGTGAACCCCCCACTCCCTCCCCCGGAGCGGGCGACGTGCCGGAAGGAA
ATCACTCACCCTTACACCGCTCCCCCTCCCTCTTCCCCCCCTCCCCCCTCCCCCAGCGCT
TTCCGTCTCTCGCGCCCCCTCCCCTCTCCTCTCTTCCTTCTTGGTAGGAGGGCGGGAGCC
CTGCGTCACGCTGGCGCCGTGTCCCCGCCCACAATGGCGAGGTGGGGCGGGGCCCAGGGG
GGCGGGCTTAGAAGACGGGAAGGGGTGTGGCTGGGGGAGGGGGCGGAGACAGAGGGAGGA
GCGGGGAGGAGCTGAAGCAGACGCTAGCGGGGAGAGTGCGTCATGACGTCATGGAAAAGA
GTCTTTATATACAGGTGCCTGGACGCCATCTCGGTCTTTCGAGGCTGGGAGTGAGTGGCT
GGTATGTTTGTGTTTTTGCAGTTGCTGAATGGGTTCTTGGTTCTAGGCCTCCAGGCCTTG
GCTGTCAAAGGCACCTTCAAGTGGCTGGCATTCCTAGTCCAGTTGCAAGCCTTTGCAGGA
CTCACAGACGACGATGGTGGAAGATTGCGCGTCGGGTGGTGGCGCGACCTAAATTACTGC
AGTGGTGGTTAGGGCTGAACTGCGGGAATATCTCGGCTCGCGTGTCCTGCCTCTGATGAA
GCCTGTGTTGGTAGGGACATCTGAGACTGTTGATGAATGCCAACGGTTCTGATGGCGGTG
CATGCTGAGAAACCCGAGCGGGCCTTTGTTAATAATTTCGGCCGCTTGCTCTCAGGAAGG
CGGGTGGTTGGAGTAGACCACGTGGTTCTCTAAATGGCTGCATTCCGCAGTGCACCATGG
TTGCCGTCCACGGTTCTTAAACTTATCTTTTTGCATTGCTCTTTTATAATATAAGTGCAC
CCTTTACAGTCATGAAATCATGGGTGGTATAAACGCTCTGCAGACATGATACAAAAAAGA
CAATGGTTAAGCTTAATTTAGAACAAAATGAATTAAAAAAATCTCTAATTTTTAATCTAG
GAATGGTGCGAGGCACGAATACAATGTGGCTTTTGATGGCACCAGATGGACAGGTAAGAA
ATTGATAAATACAGTGGGAAGAATGAAATCTGCTTAGAGGTGGTCTTTATGTTAAGCCTG
TGATGGTTTAAGAGTAGTGGACAGAAAGGATTTCTGAAAAGCTGTATTCTGAGGCTTAAA
TACTTAAGACATTAATGTTTAACTTGGCTAACAGCATGTTTGATTGGATATGCTTTGCCT
GTTTTGTAGGTCTTTGCCAGAGGGCTGAGAACAGCTGCTGGGGTAAGTTACTGGAATTCC
TCACAAAGGGAAGTAGGTCGAAAATGCGCTGAATGTGCCACAATGATGACATTTTATTTG
CTACTCTTGACTGTAAGAATGACGAGAATTATTACCACCGTTATCCTAACTGAGGCACAC
AGAATGGTGATTTGGAGAACATCGAGATTGCACGTGAGTTTACATGAAGCTATTTCTTCG
CAGGTCCTAAAGGGCAAGCTTCACACACTAGCTGTGGGCAAACAGGTGAGAAGCCTTTTT
ATAGCCCACATTTACCCAGTACTTTTCAGTTAATTTTTTCAGAGGTTACAAATGGCCAAA
TAAGTGTTGATTGCATTAGGGTTTTCCTCCCCTTTTCAAATGTGAACTTCTGCACTCCAC
ATTTTATATTTAATGCTGAGGGAAACCTGGAGAAACAGATACTATGATGGTTGCATAGTT
CAGCAGATTGAATCATGAAGAGAGAAACCATTTGTCTGATGTATCTGGGATCTTTAGTAA
AACTGGTTTGCTGTTAATATAACCACAAAGAAGTACTACTAATCGAGCTGCTCTTCTTTC
TAGACATTAAACAGAATTAGCTGGAAGTTGAAGTGGTAAGTAAAACTATAATCAAACTAA
ACATCGGTAACTGGGCAAAGTGACAGAAATGGCTTTTTAGGGATGCCTTCTAATGCACAG
GAAGCACTCATACTAGGAAGTGCTTGAACAGTGTGCTTAAATGCATTAAATAAATGCCAG
GTCCTTGTCCTGTTATTGGTATTAACGTGCTATCATAGTTTGTAAAAGCAGCCTGTATGA
TGATAAGCGAATACTGACTGAACATGAAGGTCTTAATTAGCTCTACCTGATTTCAGGCAC
TTTTCAGATTTGTGGGGAGAAAATTTATCTTTGGCTATTATAAAACCACTCTTATTTCTT
AGGTGGACTTGAGCTTTGACATGTCTGGATTGCGAGTTTGGTTTTTTTGGTAAGTGTTAA
TGGTAAAAACATTTCAGTAGGCTTAAGTGTTACTGAGAATGCTGATATGGTAGAATGCTT
AGCTACCAAGCTACTAATTATGACTTACCTCCTATGTTGGTGAATGCATGTTGAGCATGC
TCTGAACGGGGTTTTTGTAATGATGTTGATCAAATGTCTGACCTGAAATGAGCATGTAGA
CAAATTTAACACTGAAGAACCCTGTGAGAAATAATTGAGGGAAATTTAATGATATTTAGC
ATTTTAATGAAAGATCTCGTTTCCCTTCTAGCTACTGGGTACTACACAAGTTTTTATTCG
CGGATGGCTTGCTTAGGGTAAGACATCAAAACACTTCTTTGTCTCCTGGTACTCAGGTTC
ATTGTTTCTGAAATGTGCTGGTCTTAGTAATTGTTGGCTATCTTAGTGTTTCTGTGTTGC
AAAGCCAGTGGACAGTTTTGACAAGTAAAAGGCTTTAGTAGTCAGCTATGATGACGTACA
TCTAAAGCGTTACTCTCTTTTTTTAGGTGCAGATGTTGGTCACCTTTTATGTAAAGGTAT
GTATTTTATTAATCTTACATAGTTACTAAGTAAGGTGCTGTTAGTGATGATTTTTGAAAA
TAACAGATGGGAATCTCTCTGAAAAACAATGAAGATTAATTTTTAAAAACTGAAACAGTA
CCTGGAAAATTATATAACTGCCCCTATGACTACCTATGACTAAATTTGACTAAATTTCTG
TAGGTGTGAAGAGTTGGGTCGTCTGCAAGGCCTGGAACAGGAGTTTTAAGCACAGGTACT
GTTAGTCAAGTTTGGGTTTTACGTGGAGTGGTTTAAAGCCGATACAATGATGATAACATA
GTTCAGCAGACTCACGGTGATGAGCAATATTAAGTCTTTCGCTCCTATCTGATGTATCTG
GCTGCAACAATCTTATAATACCCTTGAAAAAGGAAGTTAGCTATTTATTGTCCCATGGAA
AATGGTCAGGAGTTTGGATAACTAATGGCTCATATACAAACGTTCTGTACTCTCTTAATT
TCAGGGTTAAGAATTCAAGATTTGGAGAAGTACAGGTTTTAATATATTTTAATTAACAAA
CATTTAGAGAAGTGTAGATGCTCAGCAAACCTGAGCCAGAAAGTAGAGTCCCATATACCC
CTCTGTCAACATCCACCACCAGAGTGGGACTTGTGTTCCAATACGATGAACCTGCATTGA
CATGTCATTATCACCCAAAGTCTATAGTTTTTGTTAGGGTTCACTCCTGGGTTGTGCATT
CTCTGGGTTTGGGCAAATGTATAATGACATACATGCACTGTTGTAGTACTGTACAGAATA
GATTCAGGGCCCTGAATGTTAGTTTCAAAAACTTAATGGGGGGAGTTAAGTAGGCAGTTT
TTAAATGAATGGCTTTTTTTGTCTTCTAATAGGCAGACCTTCTGTTACTCTGAAGATTTC
AAGGTAAATCAGTCTTTGGTGTTGCATATGATATGTTAGAATGTAACCAGTGATGTGATG
ATTCTGCCAAATGAAATAGAATGATATCACTTATAAAACCGTTCCATTTTGATTCTGAGG
TTACTAACAAGCATCACTGAAGTTTTTTGTTTGTTTCTTTTTTACCATGATTAACATGTC
ATCTTTACTAATTTTAGGGCATTTATGACAGCAGTTATGCAGCTTACCAGTTGAAAGGTG
AGACTTAAAAATACAGTGCTGTTGTCTTATTCCAGAATACATGATGATCTCACCCCAACT
TGAACTCTCTCACTGATTACTTGATGATGAGATAAGATCTGATATTCATATACTCCAAAT
ACCATTAGAATTGAAATATGGAAATATGAGTAAAATGGCTTCTTTGTTTTTGCAGACAGC
TGGATGGATGCTTGTGTGATAGAAGATTAAAAGCAACTTTCAGTTTTAATAAATTTTTAT
ACAAAATATCTGATCAAGTGTGCTTATTTCACTTCAGTAGGATAAAGGAAGGGAAATAGG
ACACCTTGGTGATTAAGGCCCTCTGGCGTTCGTTTAACAACACATTTTCATATGTATTTT
ACAGGATGTCTTAGGATTGAAAGTGCAATTTGTGCTGAGAAATAAACTATAGCATTTATA
TTTAAAATGCTGTGCTTCTGTTGGAAACAGTGACATGATCTGAAGGATGAGCTATATTTT
GCAGAAATTGTCTAGGGCTTGAATGTGAAATCACTTGGTCAATTTTTGCCCGAATTTTTT
TTTTTTTTGGGTGAAGATTGGCACCTGGGCTAACAACTGTTGCCCATTTTTTTCCCCAGC
TTTATCTCCCCAACCCCCCCCCCCCCCCCATACATAAGTGTATACACTAGGTGTGGCTCC
CTCTAGGTGTGGGATGTGGGGATGCTGCCTCAGTGTGGGCTGAGGAGCGGTGCCATGTCC
ACGCCCAGGATCTGAACCCTGGGCTGCTGCAGCGGAGTGCACGAACTTAACCACTTGGCC
ACGGAGCTGCCCCCACCAGAAATTCTTTATCTGAAAATCACCCTTAAAAGCCAGAGTACT
AGCTTGAGGCTGGAAAAGCAAAATTTGAGCTTAAGCAATTTTTGCTATGGAAGAAAGTGC
CCAAAGAATGAGAATGTTAACACAGGAACCTCACCGGTGCTCTTACTGACCCAAATGGGC
AATTGAACCATCAAAATACATGCCTTTATACAGACGAAATTGCAAAGAAAAATGAGCTCT
TAGAGTGGCAGTAGGAATGCTGGAATTTGAAAATCTACATTTGCAATAAGTAGCATGGTG
ATGGGTCTGGCAAGTTGTTGATAGATACC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved