Equus_caballus Locus Mono:7:SNORD17
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:7:SNORD17
Equus_caballus
Mono:7:SNORD17
22
SNORD17
1001..1237
2237
ACTCGGTGGAGAAATTGGGTCCTTGGCTTGACACTCCCCCTTTTGTTTCTTTTTGCAAA
TTTGATGTAACTTTTTCAGGCGCTGCTATGTGGTCTGGAGAGAAAAGTATAATTTTCTCT
GAAATAGCTGCTTATGGTAATCTGTGGTATGCATCTTCTGTCTGAAGAGTTTACAGTTTA
CGTGTTTAGGCAGACCCTTAAGCCTTCATTCCCATCAGTGTAAATGGTGAGGAGTACAAA
TGCAGCTATCACCAGCTTTACAGCTTTCTCTCGGTCTTTCATGAAGAGCAGTACAAAGCT
GGAACATTGTCCTAGTGGCTGTCAGATATCCGAGTGATAAAATGAGGTAGTGGAATATTT
ACATCTGAATGATCTGGGAAATGTATAGTACCTCCCACTCAAAGTGGAAGAAATCCCACC
ACGAAGCAGGCATCCTTTTCTCTTTCATGCCAATTGTGTCTCAAACACATGACACAGGCT
TAAGCTCAGACAGCTCTATCCATCCTGCTGAGTCATCTTTGTTGGTAGTGAAGGTAAATT
GTTTTTTATTCTCAAACCTGTTTCTATTTCATCTTGGGTAGATCATAAAGGTCAGGCAGT
GAATGTTCTTAAATAACCCTCATCAACAATGAGTAATGTGTGACGTGTCAAATTTGTAGC
AGAGTACTGTGAACTTAATACCCCAGGGAACTTTTGGGAGGGATGCTTGGTGGAAGTGGG
CAGTAAGTGAAGGACTTCAGCCTTGAATGTAAGAAATTAGTTTTTCATTTGTTGTAGCTG
CTTCCTCTAACAGTGACGTGTTGACTCCAGTAGAATTTCTGTGCTAGGAGATCTTACATC
CGAATAATTCAACTCTTGCTTTGTTAATTCATTTGAAGATAATCCAAGTATCTAGTAACT
AGATGGATTTTTTGCATTGAATGTTATTTAAACCAGGAATTTAGTTTAAACTTCTTTCTG
GTTCCGTGTTGGGATTTGACTAGTAATGGGCTTGCAGCCTTGTGAAATGATGATTCAGTT
TATCCATTCGCTGAGTGCGCTGCACTGATCTTCTTCCAAGCCTCGGTTCCTGTTCTAGGA
ACTCGGGGTTACGTAGCCTCCAAACACCCGGCAGTCTGTGGTGTTCTACTGTGGACAGCT
TGTGTGTTGGTGGACTACTGGTAAGAATGGTTGGTGTCAGCAGGGATGGGTCCCTTGGGG
TCTCATCTCACCAAGATGAGTGGTGGAAATCTGATCACTTGCTGCAGCTCTTTATCTAAT
TTTTCAAGCTTATGACTAACTTCCATAGCTGTTACCAATGTTAGTAGACTGAGATTTTCT
AGAAGTCTTTGGTTCTGTTGTCCTTGTGGACTAAGATATTTATTGGCAGGTATAAATTAT
AGGAAGGGGAGAACCGCGTCGGGGGAGTGGGGCAGGAGATGAGAACAAATACCTGTGAAA
TCAGAGCTCCTATATTGCTTATAGTCGATTCAGTTGTTTTGTACGCACCAGTGCCACTAT
GAAAAGCTGGGATAGAATATAGATAAACAGGTTTTAGTTACCTTCAGGATGGAAGAAAAC
TAACATTTCAAGTACAATAAAGGGATTTGGAGAAAGGATATGGTTTTAAAGTTTCTTGTA
GAGCACTTTCCTGTTGAGTTGAAACAGTAACAAAGTAATACATGTTGTTTCATAAGTATG
TATCCAGTGAGTCTTGTTTTTGGAAATTAATGCATACATAGAGTGTGTAGTGTAACATTT
TTGGATTTATTTCCTCATTAGTGAGTATTGGACTAGGCAAGGTATGCATACCTTTCTAGC
TGAGATATACCCTGTTTCTTGCTTCCTGTGACCAAAAGAAGGCAGGCTTCTTGCCTCTGT
TTTGGCTCCATGCTGCCAATTTACCATTCATGGATGACTTGTCATGTTGGCCCTCTTCCT
GGTGTAGGGGTCTTAGTTCTTTGGGCCGTGGGGTAAAGGATAACAAAACGAAATCCTTAG
AGAGGCGAGAGAAACAATTTGAAGGGAAGACACACTAATGCAGCTTGTGTGGCTAAGTGC
ATTTCTGCTTTGGGAAGGGACACTAGGAAGTAATTTAAATGTATACAAGTAGTCTTTATT
TTTTTTCCCTGTTTATAGTAGTTTCCTTGCAGCCGAGTTAAGTTGACAATGTGGGGACTG
GCATATTTGACTAGTTAATATTGTGTACAAAACTGGTTCGATTTAAATTGCTATTCAGCT
AGCTCCCATTCTGGCAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved