Equus_caballus Locus Mono:96:SNORD23
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:96:SNORD23
Equus_caballus
Mono:96:SNORD23
Un0303
SNORD23
1001..1109
2109
CCCTGACTCCCCCTGGCCCGCAGGAGTCGGCCTTCCAGGAGCTGTGCCAGGGGCTGCTG
GAGGAGTCGGATGGGGAGGAGGAGCCGGGCGAAGGCCAGGAGGAGGGAGCGGGGGCCGGA
GGAGCCGAGCCAGGAGGAGCCGAGGCCTCGCCTGTCCCCAGCCGCCCAGCCGCCTCGGAG
AAGAAGACGGAGCAGCAGCGGCGGCGGGAGAAGGCTGCACGGACCCTGGTGAGCACCGCG
GGGTCTGGTGTGCTCTGCCGGCCCCCGCAGCCTGATTTCTCGTGCCGTTTGGGGTTCTTG
CAGCTGCCTCGTCAGCCGACACCTGTTCCCTGAGCTCTGGGCTCCGAGGACGTGTCAGGG
AACCTGCTAAATCAAGTCTCCGCTGCCCCGTGTTTGGGGGGGTGGGTGAGGGGAGTGGTG
GGGGCGGGGGGTGGATGGACCTCAGCCCCCGGAGGTGTGGGTGGGGAAGGTCATTTCCGA
GAACAGCTGTGCAGATGCTTCAGCAGTCGGCGGGTTGTGACCTGGGATCTGGTGGCCGGG
AAGGGTCTCCAGGTGGAGGTGGCTGTGGAGGGGCCCCTGGGGCTGGCCCCTGACCCCACC
TGTCTCCCAGCGGGTGCAGCAAGCCGCGGTACGGGCTGCCCGGCTGCGACACCAGGAGCT
CTTCAGGCTGCGTGGGATCAAGGTGCAGGTGGCGCGGCGGCTGGCCGAGCTGGCGCGGCG
GCGGGAGCAGCGGAGGGCCCGGCGGCTGGCTGAGGCGGACCGGCCCCGCAGGCTGGGGCG
GCTCAAGTGAGGCGTGGGCCGGGGCTCCGGGCAGGCTGGGTGGGCCCACTCCCCGTCCCG
GTGCTCCCCACCTTTGCTGACCCTGGCCCGCCTGGCCCCGTGTCTCCAGGTACCAGGCCC
CCGACATCGACGTGCAGCTCAGCTCGGAGCTGTCAGGGTCGCTCAGGACCCTGAAGGTAC
TCTTCCATTTGGGGCGCTGGGTGCTGTCGGGGAGACCCCCGTGCTCGAGGATGACACTCA
TCCTTGCTCCCCGTGCCCCCAGGGGCTGTGGGCGACATCGTGGCTGCCCCGGGCTGGGCC
AGTTGGGCTGATGCCCGGGGACTGAGGGCACGGGGGTCCCCAGAGGTGGGGCCGGGTGAC
AGTTTGAGCCTGTGGCTCTCAGAAGGCCTGTCCTCCCAGCTAGGTTCCGTTGTAGTCCCT
GGGGTCTCCCTGAAGCTCAGAGTGGACTCTCTCCCTCTCTTGCTCAGTCAGACCTGCCAT
GGCTCCCCAGTGCCCCAGGAGGAAGCCCTGCTTCTGACCCAGCCCGGGCCCTGTGTGCTC
TGGTTTCCTGTGCGTCATCAGTGGGCCGACCGATTGCCCTTCCTCCTCTGACCCCTGGCC
TTTGCCCCCGCCACTCCCACTGCCTAGTTGGCCTTTTCCACTTGTTCACCAGCCTTCCTC
TTGATTGTTCCAAATCCAGGTCAGGGGCAGCTTGTGGGTCAGTGCCCATCACCCCATGAG
CTCAGGGCCAGGCCGAGCCTTGGCTGCCCACCGGGTTTCTGCACGGCCTCCGCTGAGGCC
TCCCCGTCTCTCTGTCCCACAGCCCGAGGGCAACATTCTCCGTGACCGGTTCAAGAGCTT
CCAGAAGAGGAACATGATCGAGCCTCGGGAGCGAGCCAAGTGAGGGCCGGGCTGCCGGGG
GTGGGGGTCGGGGGAGCCAGCGCCCTCCCTGCGCCTGGCGTCCTGCTCACCCGCCGCGCT
CTCTTCCTGCTCCAGGTTCAAGCGCAAGTACAAGGTGAAGCTCGTGGAGAAGCGGGCCTT
CCGCGAGATCCAGTGAGTGGCGCTCCCCTTCTTCTCCGTGGTGGTGGCCGCCGGGGCCTG
GGGTCCATCCCCAACCTGGTAACTGGCCAGTGGTTGAGTGACGCGCCCCTGGCCAGGCCC
GGGAGACAGTCAGCTCACCAGCAGCACCTGCGCCCAGAGTGGAAACGGAAGGGCCGGAAC
CAGAGGGCGGGGTCCAGCGGGCGAGGACGCGGGGCTCCCTCCACCCTCGTGCGTTCTCAG
CCCCTTCTTCTCTGTCCCCAGGTTATAACCGCTGTGCCATGCTGGAGCCCGCACCCCTCA
ATAAAGCCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved