Equus_caballus Locus Poly:3:SNORA17
snOPY snoRNA Orthological Gene Database
Equus_caballus Poly:3:SNORA17
Equus_caballus
Poly:3:SNORA17
25
SNORA17, SNORA43
1001..1131, 2386..2519
3519
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGG
TTCCGGGCCCGGACCCTCCGGGTCGAGGACCGTACGCGACTCCCTCCGACAGCTTCTCCG
GCTCCTGGACGCTCCGGGGCGCTTCCTGGGCTGTCTGGTGAGTTCCCACCGTGCGGGGCG
GGCGAAGCGGGGCCTCGGGGGGCCGGGGCGGGGAGCGGGCTAGTGGGCCGGGCCGAGGGC
GCCCTCCGACCCGCGCTACCTGAGCTGTCCCAAGCCCCGCGGCTGCAGGCGGGGTGGCGG
GGTGGCCGCAGGCGGTGGCGGATGCGGCGGGGCGCGGTGGCGACCCTGTAGCGCCGGCTG
CCTCCTCTAACTGAGGCTGCGAGAGTCACTTATGCTCCTGCTTTCCTTTTTATTCTAAGA
AACGGGCTGACTGCCACTGCTTATTGCCCGTTGTCTACAGTTAGGCCGTTTCTGAACGAC
AGGGAGCGGGAATGCTCCCGCTTGGTGAGGTGGCCTCCTGCTGGGACGGGTGACTGCTCA
CAGTCCGGGTCCCTTGGTCACCTGATGTCTGCAGTGGGCTACAGCGGCTGGTACTTTATT
GTATTTCATACGCTGCCGCTATATTGTCACCTGCTTTTCCCAGGCACCCCCGGTTAAGCA
GGCAGTACACGGGGAGAGTAACTGGGTTTGGAGTTTCCTAGAAACATGTAGGCCTGGTGC
AGGGTCTCCCAGGAGACCAAATGGGCAAAACACAGTCCGGGTGAAGTGCCTCCATGTGGT
CGCGTCAGACTCTTGTCATGTGGGTTTTTTTCCTCTAGGGAGCTTGCCTGCTGGAAACGA
AGGGCCTGGAAGGACATGCTGGGGTCCCGGACGAGTAGACACATTTGTGCTGCAACAGGT
TCGCCCCTGAAGCATAACTTTTTGCAAATTCAACCCGTTTGCCATGACATCCTATGGTCG
GGGAATAAGAAATTGAACTATTTATTTGACCTCCCGTATACACTGCCCCTAGAGGCGTTA
CAGATGTGGCTGCGGTGTCACATTTGTGTCATTGGGTGGCAGAGAGAAGAGAGGCTTGTC
TACGCTCAGTGTTCTGGCCTGTGGACGCCTGGATGATGAATAGTCTGACACTTGACAGTG
TGCTGGGCTGTTGGTGTCGTTCACTGGCAACCTGAAGCCTGTGGTGTAGAAGCTCTGATT
CTCCCTGGGTCTCACGTGGCCTCAGATCACGAGGTTATCATGCGCTTGACAGCGGGAGGG
AGGGGTGGGCCACTGGCACACGATGAGTGGGAAATGCGGTTGGGGTTCACTGAGGCCGAC
TTGCTGGAGAGCTTCACATTGAGTGAGAAAAAATGGTGGCACCAGAATTTTCCTCTGAGG
GGCTGAGCTGAATAATGCCACCTGACGGTCTGAAATAATTCACGTTATCTTAGGGGGGTT
AGAATTATACAAAGCACTCATAGGTAGCTACTCTGCGGCTTAAAAACAAGTGTTCTGGGC
GGGTGCAGCTGGAAACTCTAGAAATAAAGTTGCAGGATTTAAACTTGACAGACAGTTCTG
CAGGCCAGCTGTGCCAGCTTCCTCCAGCACGCAAGAGTTTTCAAAACTCCAGAGCATTGT
TTCCTGTGTCACCTTGTCCCGTCTTGTTTGGTGGACTTCGGGTCCCTTGGTCAGTAGCTT
CTCAGGAGGACCCTCCTGGCTGCGCTGTGCCGCCACGTTCACCAGACACCAACCTGCCAG
GTGCTGGCCCGAGGCAGCTTCAGTCCTTCGATCCTCACTTCGGGCTGGCCATGGAGGGTC
TGAAAAGTGATGGTGGCATCATGAGTTCTGAGTACTGCCGGTGGGAGAATAAAGTAGGAT
GCTTGGTGGCTAATTTGTGCTACACACCTTGTCGAGGGCGGGCAGGTGTTTCAGAATTAT
CTAGGAGGAGTAGAGAAGATTTGTTGGTATCTGGTTAATAGTAACAAGGGCAGCCAGCAT
CTATTACACAGTCATACGTTGCTTAATGCAAGGGGGACATGCTCTGAGAAATGTGTTGTT
AGGCGGTCAGGCGTTTTTGTGAACGTCGTTGAGTGTACTTAACCTAGATGGTATAGCCTG
CTGCCCACCTGGGCTGTACGGTACCAACAGTCTGCGACCACTGTTGTCCATTGACCAACA
TGTTATTGTGCACCACCTGACTACTTGATTCTGGGCCAAGTGTATTTGTTATTTGTTATT
ACGGGGAAAAAGGTGACAGCCTGGGAACATCAGCTCCAGGGGTGAACGTTGGCTGGAATG
AATGACCTTCACGATCCAGACGAAGGTAAGAGGAGAGGCAAAGGCCAGCTCCATCACGTG
AGGCGGAGCCTGGCTGCCTGTGGAGGGTAGGGGTGACTGCCCTGCAGATGCTGGACCTGC
CAGCACCACAGACGCAGCTGCTCTGCTGCACCTGTGACGTCAGGGCAAAGAGCAAGTGGC
TATTTCTACGCTCAGTGCTCAGAACAGTGAGCACTAAGAATGGTTTGTAGCCTGACATTT
CCTAGATCTGCCGCCAGGCGGCGTTTGTTCCCGAGTAGCCTACGGTCAGACCTTCGTCCA
GGCTTGCAGCTGGGAACCCGAGCAAGACACGAACCACTGAGTTTGCATTTCTTCCTCTAT
GAAATGAGGCTTGTTCAGAGGATTGGTTGAGATGTGTGTATGTAAGCATGTGGCAAGCTT
TTGACACAGTGGGATTGACCAGGAGGGTCTCTTTCCAGGAAGTGATAATCCTGTAGGTCT
GTCTGGAAGGGACTTCTTAGAAGTCTGTGGGCAGATGTGACGTGCCTCCCTGGCTAGAAC
GTGGAGCTGGTGTGAACCGCCTGTGTCCTCTCTGGCATCATTGCTTTTGAGACAGGCATG
GCGCTAGCAGGAGCAGGAGGTGGTTTGGCCAGTGTGGGAACTGGAAGGAAGGCCAGAGGT
TTGCTCCTGCGTTTGTCCTGTTGAGATGAGTCGGGGCCCCTCTGTGGGCCGACGGTTGTT
CTGGAAACGATCGTCCAGACCGGCATGCTGGGGCATGGGGTAGCAGGTGTAACTATGGCT
GCCCGAGAGCTCGACGCCATCACCACCAGACCAGATCTAGAGCCATCTGCTCGGCCAGAG
AACTCACTGATTTTAAATTCAAAACATAGTGAGACACTTTGCTTTTATTTCCTGAAACAT
TTACGTTTGAGGATCGACGAAAAGCTGTAGATTAGTGGTTCTCAACCAGGGGCAGTTTGT
GCGGCCTCCCTTCCTCCCCGGGGGCTGCGCAGCAATGCCTGCAGATGGAAAACAGGTGGG
CACGAGGGCTGTTGCACCTCCTCAGTGCACGGGGCAGCCCCACCGCAGGACTGCAGGGCC
CTGAGTGTTGGCACTGCTGAGGGTGATAAACCCCGCTGGGGAATCCCATTAGTTTCGGGA
TCTCCAGGTTGGGTTCCCTGAAGCCTGTTCGGGGGATCCATGTTAAAGGTAAGACGCCTG
GTCCAGCGCACTGTTCTCTCCTTTTCAGATCCCGAGCCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved