Equus_caballus Locus Mono:32:SNORA74
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:32:SNORA74
Equus_caballus
Mono:32:SNORA74
14
SNORA74
1001..1202
2202
TGCTGCTTCTGTGAAAAGTGACATCCTCATTTCCTTGGGGAACTGGTGAGGATGTTAGA
AGGCGGGGGAGTTATTTATCAAAGCTAGTTTTGTTCTATCAATTGGCTTTCCCTTGAAAG
GATTCTCTTAGCTAAACGTTGAGTGCTTTGTGTAGAATACCTCACATGTTCATTGTGACC
AGCCTTTTACGAGTGGGATCTTAAGACTAGTGATATCTAGGGGCCTTGGGAGGTGGTTAG
CATTAATGGTAACCATAGGCAGGAAAAAGGCAAACAATGGGAATAAAATAATTCCTGAGG
ATATAAAAAATATGGTAAATCATAAATGGCAGACAGCATTCTGTTTCCATCTCTGCAGAA
AAGCAGCTGTTTTAGTCTGGGGTGTTGAACATTGAAATCTCTTTCTTTTTAGAATGACTT
GAAAGTAGGGCATCTTTGGCCCTCCTGAAGAGAGGAAATTAAAGGCGGACAGTCTGTGTA
TGGAGTTTTCAGGTAAATGTCCCTATTCCAACATTGACTACCTCCTGTGTGCCAGGCCTG
TTTGCTAGTTGGTGTCCGTCAGGAAACAATTGGAAGGCAAAATCATGTATGTTTGCCCCC
AACAAATTCAGCCTCTAGTCAGTGAAAGTGGGATTTTGGTGGTAATGGTCTGAAGGCCTG
TAGAATCTTTGAGGTTATCTGTGTCGATTCACTTGAGGAATTTATGGGGAGATTGTAAAT
TTCATGAGGGAAAGGGGAGTGTACCTTGCCTTGTTTATTGCTAGATCCCAAGCACAGTGC
CCAGTACATGGCAGGAGCTCCCTGAATGTTGGACAAAATGACTGAAGGCATGGGGAAGGG
GTTCTTGTTTACTATTTGTTTAAAGGATTTGGCAGCAGAGTCTGCAATCAGTGCTTCTAG
GCCCCTATTTTGCAGTCAACCTTCAATTCATGGGTATGCCTATATCCACATCTTCTACGT
GGGGTGCCTGGGTATCTGAAACAAAGCTGTTTCAGGAATCATCCAGCGGTTGTCAGCTAT
CCAGGCTAGTGCGATGCCTTGGATGGTGTTACACTGGTGGAAGAGTAAACGCTGCCTTAT
GCTGAGGTATGGCTCCAAGCACTGTTTTGGTGTTGTGGCTGAGTACCTTTGGGCAGTGTT
TTGCACCTCTGAGAGTGGAGTAACTCCTCCTGTGGAGTTGGTCCTAGTCTGGGTGCAAAC
AATTTATTTCTGTTAGAAAAGGACCCTGTCTTAAGGACAGCCTATCATTCTTTTCTTCTT
TGGATCCTAGATACCTTCACCTAAGTGAGAAACCTGCTTTCATCAGGACCTCAGATGTCT
GACAGCCCTGTGTGACACCAAGAGAAGTAGTGTATGTAGTTCTTTTGTCATGTAGGTTGT
AATTAACTTGCATCAGATGGGTGGTGTGAAATAATAGAAAATATCTGTTGGTCTTTGCTC
CCATTCCTGGCACAGAGCTCCTGAAAAACCCTTGTGATATCGTAAAGTGATAATAGCAGT
AGGAGCATCTTTTGTTCTAGATTTGGTCTTTGGCTCTGGTTCCTGACACTGAGCTCCTAA
ATCCCTTGGAATTTCCTGGGTGATAGGAATGTCTTTTGTTCTAATGAGTTTGTTCACCAG
AAAGACCAAGCAATGATTAATTAGAAGGTTGGAATTTTCAGTTTCACTCTCCATTCTTAA
GAAAGGAGAGGGGGCTGGAAATGGAGTTACTAATTTCTCGTGTCTATGTGCTGAAGCCTC
CATAAAGATCCCAGTAGCATGGGGTTCAGAGAGCTTCTGGGTTGGTGAACGTTTGGTGGC
ACTGGAAGAGTGGTGCACCCAGAGAGGGCATGGAAGCTTGGCACCCCTTCCCACATTCCT
TGCCCCATCCATCTCTTCTATCTGGATATTCGTCTGTATCCTTTATGGTATTCTTTTACA
ATAAACTGGTAAACAGTAAGTAAACTGTTTTCCTGAATTCTGTGAGCCACTGTAGCAAAT
TAATTGAACTCGAGAAGGGCATTGTGGGAATGTCAGATTTATATAGCTGATTGGTCAGAA
ACACAGGTAACAACCTGGACTTATGATTGGCATCTGAAGTGGGGGAGGGGCAGTCTTGTG
GGACTATGCCCTTAGCCTGTGGTATCTCCAGGTGTAGGTAGTGTCAGAATTGAGTTAAAT
TGTAGGACACCCACCTGGTGACACACATTTGCTTGATGTGGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved