Equus_caballus Locus Poly:19:SNORD115
snOPY snoRNA Orthological Gene Database
Equus_caballus Poly:19:SNORD115
Equus_caballus
Poly:19:SNORD115
1
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1076, 1916..1996, 5304..5384, 7775..7855, 12035..12115, 15019..15099, 16448..16525
17525
TTTACTCATTTAGTCAACCTGAATATTGAGATGGGGTATTCTTATTGAATGACTGGTCT
ACTTGATGTGATCTTATGATAAAATCTTTGCTTATTACTTGAATCTGATTTGATTGATAG
CTAAGGAAATTTTGATTCATTGGTGTCCAGATCAATTAATGTTCAATACTCATCTGGGTC
TCTATACATGACTAGACCAATATCTCTATAACCTTAAATGGGATTCTAATAGTGTCAGGC
TGCTTTAGGGTCACTGAAGAACTTTCAATAAATGAAGGATCATGCCAACAAAGATGAAAA
TGTGAGATTCAGTAATTTTTTCTTCCTATTAAACCTAAAATTGATTATATAATGGGGAAA
TTCACATATATGAATTTCAGCTCCCAAATATCATATTAATGCATTATTTTCAGTATAATG
ATGTGTATGCTATGAAAAAATCAAAGCTTCCTATAAATGAATATTATTCTCAGTGGTCTG
ATAGTTGATTTGCAAATCCTAAGTTTTACATGGCTTCAAATGTGTCACTTTAGGAGAGTT
CATATTGCAATGGACCATGCCAAATGTTACTGGTATGGCATCCTTTGATATGTAGACAAA
GGATGATAAATGGGATGTTCTTGTGTTTGCCTAAAACCACGTGAGTGGTTCTCCAAAGAA
ACCTGTGTTCTGTGTCATTCTTGTGTAGGGTGATCAATAGTCTATATCCTCTATAATAGG
TCATTTTTTTGAGTACTGACCATATTGCTCCATTAAAGAAAGCACTCCAGAGACATATTC
CATAAGAGACAGTTCCATGTTTTGATACCTGTCCTACTCCTGTACACCTAGATGATGACT
ACAGAGGAAGAGCACAGTTTGGCCTGCAGCTTTGGGGAATTAATGTGACTCAGATGCCTA
GCACTAAATATGTTAAAGCTCTTGTCCAAATTAGTACCATAATTACCTAGAAAGCATATT
CAAGTCCAAATGTATATATGTGGGGGTTGCCATGGCTTGGGTCAAGGATGAAAACTTATT
GTCTTGAAGAGAGATGATAACCTGAAAATCATGATCAATAGGATTATGATGAAGATAGAC
CTAGGTGACAGTCTGGAGCGGTATGTTGGGAAATATTATTTCCTTTCTAGGCATTTTATT
TTGGACTTGAGACAAGGAAATCTTAAAAGAAACTCATGCGAGCAGTCCTGTCTTTGTGCT
CAAAATTAAAAAATGAATATTCATCCTATAAGCTTTGTTTAAGAGATTTATAATTCTTAA
CAGTAGGGCACATTCAGAGCTCAGTCCTTCACTGTTTTTCTCTCAATGTGTCTTTGAGTA
ACACATTCAACTAAGGCTTGTGACACTGCAATGATAATAGATATCTGGATTCCTTTGGTC
ACTGATACATTCCAAATAGACGATTAACTGTGGAAGATATACTCCTAAGGCAAATAGGTT
TACACAGAAGGTAACCTGCATAGGGATATGGAATTTTTTTCTGAATGAGTGACTGACCTA
TGTGATGTGATTTTATGACAGTCTTTCATTTGAATATTAAATTAATAATATTGAAGTTCA
GAAAAATGTTTGATATTCATTTATTTCTACATATATGATAAGATCAACATTTCTATAATT
TTAGAGGATTCTAACTGCTTTGGGCTACTTTGACATCAGTGAAGAATTTTTCCATATCTG
AAAGAACCTGCCATTGGAGAAGAGTTTTGAGGTTCAGTACTTGTACTGGTTACAGGATAA
AATTTGAAACTTAAAACTGAGTATATTCATGAAGAAACATATATCAGAATTCCAGGTCCC
ACTGTAGACCCATTATTTCATATAATAAAGGGTATGCTATGAATGACACTAGAACACCCA
ATTTACACATTGAATTTATTAGTGTTACCAAAACGGCAATATGCATGTCCTTTTGTGGAT
CAATGATGAGAACTCATATTGTCTTGAAGAGAGATGACGACCTAAAAATCTTGTTCAATC
GGATTACATGGAGGCCCAGTGAAGTTGAGAACTTGGGGGAAAGATGTTGGGGAGCCTTAT
TTCCCTTCGAAAGCAATGGAATCTCTAGAGGAAGTCTCGTGTGCTCTGCCCTGCCTATGG
GAGTCACATGACAAGACAAGAGTTTTCTTTCAGACTGCTTTGTGGGCCTGATTCCGCCCG
AAGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTACATAGTTTGACCCTTTCAAGACCAGAAGCCAGAGAGCTTATT
TCTCCTTGGTGGTCAGCCATACAGGATAGATCTCTGGAAATTGAGAGCTTTGGCAACTCA
TATTAACTTTTCATGAACTCATATTGCCTTTTTTAAAATTTAAGTAATATTTGAGTTTTA
TTCACTTACATATTGTGTTAACTTTGGGATATAACATTGTAAAATTTTATTGTGTTTATC
ATTATATTTTGATTTCTGTGTAGATTACATCATGTTCACCACCCAAAGACTAATTACAAT
CCATCACCACACACATGTGGCTAATACTCCCTTTCCCTCTTCTCCTTCTCCCATTCCCTT
CTGGTAAGCACCAATCCAATTTCTGTCTCTAGATGATTGATTTTTGTTGTTTTTACCTTC
TATTTATGAGTGCAATCATCCAGTGTTTGACTTTCTTTCTCTGACATTTTCCTTAGAGAC
TAAGACCCTCATGGTCCATCCACGTTGTCACAAATGGCCAGATTTCATCAATTCTTATGG
CTGAGTAGTATTCCATTGTTCATATTTTCCACATCTTCTTTATCCATTCATCCCTTGATG
AGCACCTAGGTTGCTTCCAAGTCTTGGCTCTTGTGAATAATGCTGCAATAAACATAGTAG
TGCATGTATCTTTTGGGATTGGTATTTTCGTGTTCTTTGGATAAACACCCAGCAGCAGAA
AAGCAGAATCTTGTGGTTGTTCTAGTCTTAAATTTTTGTGGAATCTGCATACTGTTTTCC
ATAGTGGCCGCTCCAGTTTGCTCTCCCACCAGCAGTGTATGAGAGTTCCTTTCTTTCCAC
ATACTCTCCAACTCTTTTTTTCCCTGCCTTATTAACTATAGCCATTCTGATGGAAGTGAC
ATGATATCTTGTAGATTTGATTTGCATTTCTCTGATGGTTAATAATGCTGAACATCTTTT
CATGTGCCTGTTGGCCATCTGTATGTATCTTCTTTGGAGAAATGTCTGTTCATATCTTAT
ACCCATTTTTTAATTGGGGTGTTAGTTTTTTTGTTGTTGAGATGTATGAGTTCTTTGTAT
GTTTTGAATATTAACCCCTTGTCATATATTTGGTTTGAAAATATCTTCTCCCAATTGTTA
CATTATCTTTTAGTTTTGCTGATGTGCAGACACTTTTTAGTTTGGTGTAATCCCATTTGT
TTATTTTTTCTACTGTTTCCTTTGCCCAGTCAGACATGGTACTTGAAAACATACTGCTAA
GACTGATATCATTGAGCATACTGCCTATGTTTTCTTCTAGAAGTTTCATGGTTTCAGGTC
TTACCTAAAAATCATGCTCAATACCATTGCACTGAGGTCCAATGCCATCGAGAATTTTGG
ACCCTAAAGTTGGGGATCACTTTTCCTTCTAGAGCTATGGGCTTGGGTCTTGAAGCAGCC
AGTCCCTTGCAAGAATCTAATATTGCTGTACCCTGTGTATAGGCTCCTCATGACCAAGAT
AATTTTTATCTTTTAGTCTTTATTTCACTGGATCCATTTTTGGGTCCGTCCCTTACCTCT
TTTTCTCTTAATGTGTCTTTCAGTGAAACATTTTGGCATGGGTTTCACCCTTGCCTGTAT
GATCAGACATATGTGGATGTCTTTAATTACAGTCATAAGATATAGAGAACATTGGACAAT
AGGGAAGGCCCACGTTAAAATAGTAAATAAGTTTGACTTCTTTTGAGAGCCTAAATACCA
ATAGATGGTTGATTTATCTTTTATGTCAGCACTATGGGATGCAATTTCTGGAAATTGAAA
GCTTTTCATTATACCCATAATGGATCAAAGTGTAAATGGAGGAAATGTCTTCTTTAATTG
CCTCCTGGTCAACATTCGCATTCATCCGTGTACCAGTTATGGCCAATAACTCTAATATGC
TGAAGGAATGAGAAATGCTTGTGTCTGCTTTGGGTATGGGGACAACTTTCTCTAGGGAAG
AATCATGCCGATGGCTTCAAGAAGGTGAGCTGCAGAAGTGAATCTCATTCATAGTCTTTG
TTGAAAGACATTGTTGAGTATTTAGATAGCTGAATGGCAGCTCCTGAAGATTTATAGGAC
TTCCCCATGTCATTTTAAGGAATTGCTGGCTCTTGCCGATGCCAGTTCTTTCTAGTTGGC
CCTTTGATCATTTAGCTTTGCCAAATCAGGCCACTTCATCCATTTTTGTGTTCTTCCTCT
GCAGGTGTAACTGCCTTGAATGATAGCTTTCTCAGGAAGAAAAACCACTTTTTACTGAAC
TTTATGTTGAGGACTTGAGAATAAATTTTTCCATAGTTTCATCCCCACAGTGTGACAATA
TTTTGTGAATTATATTTGTTGACATGCCCATGTTGATATTGCAATTTTTGTTGTTGTTTC
TGGGATGTTTTTGTACATAAATCGAAACTTTAAATTAATAGACAATGACTTTTTGTCCCC
AACTTGAACTATTTCACAAATTTGTGAATAGAGTCAAAGTCAGCACAATTTCAATTTTGC
TCATATCTGTCTTTTAAAAATGATTTTCATATGACTTCACAATTTCCAACTATCCATGTT
AACATCCCTATAGACCGGAATAAAGGTTTATTCAGGTCTACTAATATTGCTTGATATTTG
ATGCTGCTCGATGCACACTGAGTATTTTTCTTCATTAAGAAAACTGTGTGCTCTGCCATT
TTTGTTTCTGGTGAATATAAGGTGCACAGCCTTCATTATGGGCTCATTTTTGTTGAATCA
CCTTTATGATTCTTTGAGGAGTAGCATGTGTGAGGCACAAGCCCATGAGAAATGTAGTAG
TTCATTATGACAACTATCCTACCCTGTTTACTGGATAATGACTCCCAAAAAAAGCCCTAT
TTGGCCTGCTGAAATTGAGTCAATTTTTATCTGTCTGGTGTCCAGCATCTGGAACTCTTA
TCCAGATTACACCCTGTTTCCGTAATCTAATCTTGGTAATCATATTCAGGTCCAGGTGCA
TTGGTGAAGTGAGAGAGCCCTGGTGGATCAATGATGCAACCTAATATTGTTTTGAAGAGA
TATGATGATCTAAAAATTATGCTCGATAGGATTATGTTAAGACCCATTCTCAAGAACAAT
CCTATGAGAGGACACTGGGGATCCTACTTCCTTTGTAGAACAATGCTATTTTGGACTTGA
CACAACAAAGTTCTTAGGAGGATTTTTTGTCTATGAGCTTCTCTGTGAATGATGCATACT
CATACTTTATGCTTTGTATAGTGATCTATATATCGTAACAGTAGGGCTTTTCAGAAGTTA
TTCCTTAGGTCTTTTTATCTCATAGTCCCTTTCAGAGAGACTTTTGGCCAAGGATTACAC
CATTGCATTGATAATCAGAGATGAGTGAATTACTTTGATCTTAGACACATGTCAAATAGA
GTATTAGACTACTACTAATGAGTCCTGATCTAAGGCAATAGGTTTTTCTTATTTAGTGAC
CCTGAATATCAATATGGGGTTTACTTCTGTTAGAATGTCCATCCTATGGTATATGATCCT
ATAAAAACTGAAATCTTTCTGTTTTACCTGAGATTGTTCAGATTACAAACTGAGGAATTT
GTTTTTCCTAACTGGAACCCTGGCAACATTCTTCTCAATCTGTATACACATCAAAACCAA
TATTTTAATATACTTAGGTTACCAAAGCTGCTTTTCTTTACATTTGAGTCACAAAAGAAC
TTTCTATAACTGAATGATCATGCCAATGGAGTAGACATTGTGAGATTCAGGAATTTGCCT
GGTCCATGGGTCTTATTTTGAATAAATTGTTATGTTACTGGTTATCTGAATTGCACCATA
TCAATATAATGAATTGCATGTCCTTGGTGATAACAGTTTTTCCTGATTGGCTGTTTGCTC
TGTTTAGCTTCTCCAAATTGGGCCACTTGGCCCAATTTGGAGTTTTTCCTGTCCATGAGT
GATTGCCTTAATGGATGGCATCTTCATGAGGAAAAGGCCACTATTGACTGAAATTTCATT
GAAATGATGTTGAGAATTTTTATGAACCATCCTTTCATCTCCACTATGTGATAATTTCCT
TCCCAATGTACAGAAGTACACATTTTCATCCTGATTATGTACGCTTATATGGTATTTTGT
ATTGTTTTTGTGATGGTTTTTGAAGTTTTACTCTTGAGAATCCTGAAAACCAGCATGGAG
TTTACTTCTCAATGAGCAACCACACTACAGAATATGATCCTACAATGAAGTCACTTTGTT
TTGTCTGAAACCAAGGGTGAAAATTGAAGAAATTTTTCCCTAACTGGTTCAGGGAAACCT
TAGTCTATGTCTATATTCATGTCAAGGCTGTGTTTCTAATATATCATAGAAGATTATAAC
CTTTTGTGCTGCATTTGGGTCATCAAATAACTTTCTATAACTGAAGGACCACGTTAGTAT
AGTTGAGATAATGAGATTCAGTAATTTGCCCCGCCCAGGGGGTGAATGTTGATAACATTG
TTGAATAAACAGATAGCTGAATTGCACTTCCTGATATCATGTGGCTTCACTAATTCAATA
TAATGAAGTGTATAGTTTGGGTGATGCCAGTTATTCCTTACTGGCCATTTGATTTGTCTA
GATCACCAAATCAAACAACATTGGTTCCTTTATGAGTTCTTCTTTTCCATGAGTGATTGA
TGTAAAGGATGACATTCTTAATGAGGAGGTCAATTTTACTGTAATTTCATAAGAATGCTA
TTGATAATTTTTCTGATTCTTGGTTTCATCACCACCATTGATAATCTTAGCCCTGAGCAC
AAGAGTAGACATATTTATCCCAATTATAATATTTTCGTGTTGCTGTTTTTGTGATGACTG
TGGGACATGGATGAGAACTGTTAACATACAGACAATGACTTATCAGCCACAGCCTGAAAA
CTCTCATACATGGGTTGAGAGGTTGAATGAAAGCACAATTCCAATTATTCTATCATCTGT
TTTCTACAAAATAAATTTCACATGGCTTCATAGTGTCATTTTATCCAATTTGAAATGCGA
TGGACCATGTCAATGTTGCTAATATTGCTCCTTGATCAAATGTACCAGGAATGAGCAGTA
AGATACTCTGGTTTTAGCATGACGCCTCCTGGTTGGTTTTCCAAACTCAAGAAACTTATG
TACTTTGTCTACCTTTTGATTGGTGAATTAATGGCACACAGCCTCTGTAATGGATCATTT
TTGCAGGAATGATCATATGGGTCCATTAAGGAGAAGCATGCATGAACCACATGCCCAATG
GAAATGTAGTACTTTGTTTTGACACCTGTCATATTTGTGTTCACCCAGATAGTGACTCCA
GAGGAAGAATCCTGTTCAGCCTGCTGTCCCCAGGGCAATCAATATCCGCCAGGTGTCCAG
CATGCAATACAGCCAACTTTCATAATTTCCTGCATCCATCTTTGGTAAGCATAGTTAGGT
CCAAGTGTGTGTATGCTTGGGGAGTCACACGTGTTGCATCAATTATGAGACCTCATATTT
TAATGAAGAGCTCTGAATAACTAAATATCATGCTCAATGGGATTACATTGAGACCCACCC
TAGGTTTACAATCCTAGGACAGAGTTTTGAGGTTCCTTGTTTTTCTTTTACAGATGCATT
TTGTGTTGATCACTTTGTCATTTATAACTTTGTCTATGCATTTCAAATTGAACAATAACT
GTCAGCTTTTTCAATGGTCAATAAGTTCTAATAATTTGACACATTTGGGGCTCATCTCAG
CTCTTTTTCTCTCATTGTTTCTTTTAGTAAGGTGTGTGACAAGATATGCATAATAAAACT
GATGAGATGTGAATGTCAGTGTTAGTCACAAATATCTTCCAAGTAGACTTTTGGGCTTAT
GAATATTTGCCCTAAGGCAATTAGATTTACTCATTTGGGTAACCTGAATATCCATATGAG
GTTTTCTACTCAATGTGTGACTGAACTACTTGATTTGATCCCATGACAAAATCTTTAATT
TTTACCTGAATTTAGTGTTATTGACAGTGAAGAAATTTTTTTTCTTTGGTATTCAGTCCA
ATGCGTGATATTTATTTGGATATGTAAGTAGATAGACCAATTTTCCTTTATTGTCACTAA
AGGAATCTAATGATGTTAGGCTGCTTTGAGGTCACTGAGATAAATTCCATCACTGAAGGA
CCCTCACAGTGGAGAAGATAATGTTAGATTCAGAATTTTCTTTTTCCACAAATGTTAAAA
TTGAATCCATTGATGAGAAAACTATCTGAATTTCACTCCCATGTATCTTGAGAGTTCTTT
ATTTTCAGTATAATAAAAGCACAGTCTATGAATGATGCCATTTACTGATTGGCCAATAAC
TACCTTCACCAAATCAGGCAACATGTGTCCTGTTATGAATTCTTCTCATGAGTGACCAAT
ACAGTTGATGTCATCCTCATTTTAAAAACATCACCTTTTACTGTGATTTCTTTAAATAAT
TTTGAGACATTTTCAGAGTGATAATTCTTGTCTCTATGGTATGTTATTCTTTAGTATAAA
TATAAGAGTAGATATATTCACCCCTCTTATTATATTTTCATTTTGGTCTTGTTTTTTCAT
ATGTGTGGGGCACTGATGAGAACTCAGAACATATATACAGTGTCACATCAGGCGTATGCT
TGAAATCCCTATACATGGGTTGTCCAATACACATGAGAATGAATACACTTGGACTTCTGT
CTTCCAGTATGATGTGGAAAGTACTTGGAAATTGTCACCCTCATTGACACAATGAAGAAA
AATATGAATAGATTGAAAATCACCAGTTCCTCTGGAATTCATTAGACAGTTGAAGACACA
GGAAAGTCACTACCACAAAAATTACAAGGATTGTCTGTCAGATAGAGAGAATCACAACTT
ACTCCAACATTAGCCCAGGAGCAAAACCTCCACTGGAACTAGTATCAAGGTGGGAAAATT
TACAGTGTAACTGACAATCACAATTGCTGGAGGCTCATTGTGAACAAGTTTAAGAGTTAA
AAACTCCTGTGGGGACCTCTCTTAGTGGAAGCCCCATGCCTGTGTAAGTTTTATCTCCAG
AAAACCTACCAGGTTCTCACAGTGAATACTGCAGAAAAATCCCCTACTGCTTCTGTCAGA
TGAAGGACCAAGGTAGACATTTTGAAACATGTCCAGAGCATTCTCTTTTTCTTTTTTTTC
TTAAAGATGATTGGCACCTGAGTTAACAACTATTGCCAATCTTTTTTTCTCTGCTTTTTT
AATCCCCCAATCCCACCAGTACATAGTTGTATATTTTAGTTGCGGGTCATTCTAGTTGTG
GCACGTGGGACACCACCTCAAGGTGGCCTGATAAGTGTTGCCATGTCCACGCCCAGGATC
TGAACTGGTGAAACCCCAGGCTGCTGAAGCGGAGCACGTGAACTTAACCACTTGGCCATG
GGGCCGTCCTCTTTTCTCTTTTTCTTAATAAGGCCTGACTTCAAAGGAAACTATTTAACC
AGAGCCTAACTTGTGTTTTACCAGAACAAATTAACCTGAGAGAAATAAATGCCCAACTTC
AGCCTGCTATAAGCCTGCTCCATAAGGAAAAGAAAATGCCCAATCCAGTCCACGCTAGTC
TTCAACGTAGGAGAAGGGAAATACCCAACTCCAGCACTGCTCCTGCCTTTCTGTCTTACT
GAGGAGGCCAGGGGAGGAATTCTGAGACCCTCTATAAGGTCACAGCCTACTAGCACAATC
TCATTAACAGATTAATGTCTAATCATAGGACTATAGAATGCTTCCCCTCTCCTCATACCT
TACCACAACAGCAATAGGACTCCTTTATAACAACAGGACAGTATAATGGAAATAATGCAC
ACCCCAGGCCTTAAGAAATCTCAGAAGGTCTTCCATGAGCTGGATTTTGGTGTGAGCCTC
GCTATTATTTTTATGTGAGACCCAGCAACTAGAATGTGTTTGCACAGTTTGTATGAGAAG
AGCAAGACAATGACTTCTGGTTTCGATATCCTTCTTGACAAATCTCAACATTGTGTTGGC
TTTCTTTCAGCTATAGATAATGGCCTTGTCTTTAGGAAACAATCGGAAAAAACTCTTAGT
TTCTGTTTTTAAGGCTGCAAAATTCCAATAAAAGTTAAAGAAGTACTGCCTGACTCTAAA
AAGTCACAATAAATAATTTCCCACCTCTCTATATGTGTAGTGAGCTTAGTTTTTTGATTA
TAAAAAGCAATAAGTTCACTGCATAACTCTGGAAAATGAGAAAAAATACAAAGAAAACAA
AACATTCATATTGTCTGTGTGTATCCGTATGTAGATATTTTAACATAATGGTGTCCATAT
CTAACTGTATCTAACTTACTTTTTAAATATATTAATAAGATATGAACATTTTTCTCCTGC
CATTTATGTTGATCCTCATGTACAGAATTGTTTCTAGTAGATGGAATTCTATCATATGAG
TGTATCATGATTTATTAAACTTTTACTTTACTGTTGAAAAGAAAAAGAAGTCTCTAGGGA
AACCCAAAGACAAAAAAGAAGACAGGAACAGAGATACCAGATGAAATTTTAGCTGTGACA
CTTACAGCTACAGTAAAGTAAATACAGTCTAACCTCTAGCCAAATAAACATAAAAAACCT
CACAATAAAGGCCTATTCACCTCAGTTCCTTTTACCCAATATATCATGCCTGGTCTTCAG
CAAAAAATTATAAGGCGTACTTAAAAGACAAAAAATACAACTTGACGCAACAGATAAAGC
ATCAGAATCAGATTTATATACGGCAGAGTTAATAGCATTATCAGACCAGGAACTTAAAGC
AACTATGATTAACATGTTGATGGCTCTAATGGAAAAGTGGGTGACATGAAAGAACAGATG
AGTAATGTAAACAGCTATATTATCCTAGAAAGTGAAAGAGAAATACTTTCTCAGACAAGC
AAAAATTGAGACAGTTTGTTACCAATAGTCCAGCCTTACAGTAAATATAAAAGGAAATTA
TTCAAAAAGAGGGAAAATGATATCAGTCAGACAATCAAATCTACATAAAGAAAGAAAAGC
TTTGGCTAAGGAATAAATGAAGGTAAAATAGAATATATTGTTTTTATTATTCTGAATTGA
TCTGACAAATAACAGTTTGTTCAAAATAATAACAACAACAATGTGCTTTGTGATTGTAGC
TAATGAATAGTGAAATAAATGACAGCAATATTATAAGGCTTGATGTCTTATTTCCAGAAG
CTGAATTATACATGACTTCAGAGGTTTTATTTTATGAGAATTAATAGGCAAGGGATCATG
GTGATTGTTATGGATATGGTTTTCTTGATTATATAGACAAGGGATAATCAATGTGATAAT
CTCATTTCTGCATGACGCCACCTGACTGGTTCTCCAAAGTCAAGAAACCTGTATATTTTT
TCCTCCTTGTGTTGGTGAATCAATGGTCTACAGCCTATATAATAAATTATGTCACTTTTG
GAGTCCTGACTATTAAGGAAAATCATGCTTGAGCAAAATAACCATGAAAAGTGTAGTTTT
TCTTTTTGACACCTGTCCTACTCCTGTCCACATAGATAATAACAGAAGAAGAACACCATC
TGGTCTGCTGCACTTGGGGCAATTTATACCAACCAGGTGTCCAGTATTGAATGTGCAAGA
ACTATAATTCACCTTAGAACAGTGGTCCCATTAATCCACCTCTGGTAAGCATATTCAACT
CCAAGAGTCTGTATGAATGGGGAATGCCATGGATTAGATCAATCATGAGAATTTATATTG
CCTTGAACAGAGATGATGACATAAAAATTGTGCTCAATAGGATTATGTGGAGGCCCATAA
TAGGTGACAAACCTAGAACTAGAAGTCTGGAATCCTTATTTCCTTCTAGGTGAATAATTT
TGTGGCTTGAGACAATGACACCATTGTGGGAAACTTGCTTGGCCCAACCCTATCTGTATG
CTTCTAGGTGAACAACAAATTATGATACTTTAAGCATTGTTTTAGTTATTTATTATTTCT
GATAGCATGGAATATTTGCAATTCATTCCTTGAATCTTTTTCTCTCACTGTGTGTTTCAG
TAAGACATGCTTCAAGAGATGTACCATTCCTTTAATAAAAGTGGAGTGGATGCCTTGGTT
ACAGATACATTCAAAACAGACATTGGACTAGTGATGATTCACCCTTATGCCTATTAGGTT
TACTCAGAATATCAATATGGGTTTTCTTCTCAATGAGGGACCAATCTACTTGATGCGATG
CCATGAAAAAATATTTGCTTTCTATCTGAATTTGATATGATTGAAAGTTGAGGAAATTTT
TTTTCACTTTTTGCTTCATAGTATCCAGTCTGATGTGTAATAGTCATTTGAATATTTTTG
CACAACTGGTCTGATCTTTCTATAATATTATTAAGCAGTTGTAATGGTACTGGCAGTTTT
TGACTCACTGGTGAACTTTTCATGACTAAAGGATCATGCCAGTGGAGACAGAAATGTGAC
ATTCAGTGGCCAATAAGTACATTCAAAGATATTCAACATCATTAGCCATCAGGGAAATAC
AAATCAAAACCACAATGAGATCCCACTTCACACCCACCAGGATGGTTATAATAAAAATGA
TGATGAGTACTGGTAGAGATGTGGAGAAATTGGAACACTCATGCATTGCTGGTGGAAATA
TAAATTGGTGTGGCCACTTTGGAAAGCAGTCTAGCAGTTCAAGAGGTTTACATAGTTACC
ATATGATCTGGCAATTCTACTCCCAGCTGTATACCCAAGAGAAATGAGAACATGTATCCA
CACAAAAACTTGTATTCATAGCTGCATCGTTCCTAACAGCCAAGAAGTAGAAACAACCCA
AATGTTCATCAACTGATGATTGGATAAATAAAATGTGCTATAACCACACAATGGAATATG
ATTCAGCAATAAAAAAGAATGAATTACCAACACACGCCACAACATGGATGAAACTTGAAA
ACATTAAGCAAAGTGAAAGAAGCTTGTCACAAAAGACTACATATTATGTGATTCCATTTA
GAAGAAAAGCCCAGAATAAGCAAATCCACAGAGACAGAAAGTAAATGAGTGGCTTTCTAG
GGCTGGGGAGATTGGGGGGAATCAGGAAGCGACTGTTAATGGGTACAGGGCTTCTTTTTG
GGGGTGATGAAATGTTCTAAAATTGATTGTGGTCTTGGTTACACAACTCAGTGAGTATAC
TAAACACCCTTGATTCTACGCTTTAAATGGGTTAATTGTATGGTCTATGAATCAGAGCTC
AACAAGGCTGGTTTGAAGAGAAATAGATGATGAAAAACTGTAACTTACTGATCCTGCCTT
TATTTAAAGTTTTTTTTTTTAAGGATTTTATTTTTTTCCTTTTTCTCCCCAAAGCCCCCC
AGTACATAGTTGTATATTCTCTGTTGTGGGTCCGTCTAGTTGTGGCATGTGGGATGCTGC
CTCAGCGTGGTTTGATGAGCAGTGCCATGTCCCTGCCCAGGATTCGAACCAATGAAACAC
TGGGCCGCCTGCAGCAGAGCACACGAACTTAACCACTCGGCCACGGGGCCAGCCCCCTTT
ATTTAAAGTTTTGACATTTTCTTCATCATAGATTTTTTTACATTATTTTTGCTTCAAAAA
AATATATTGCATTAATATATTAAAAAAAAGAAATGTGACATTCAGTAATCTGCTTTGCTC
ATTGACTTGAATAAATTGATAAGCAAACTGATATCTGAATTATAAATCCCAAATTTCATG
TGGCTACATTATTTTCAATATAATGAAAATGTATGCTATGAATACTGCCAATTGTTCCTG
ATAGGGCTTTTGAGATGAATAGGTGTACCATATGAGGCAACACATGTCCCATTATGCATT
CTACTTCTCCTTGAGTGACTGACCTATTTTATGGCATCCCCATGAGAAAAACATCTTTTT
ACTGAAATTTTGCTGAAATCATGTTGAGACATTTTCTTAGTCATGGTTACTCTCTATGTT
GTGATATTATTTTGGTCTAAATATAGGAGTAGACATATTCACCCTTATTATAATATTTTC
ATGTTGCTCTGCATTTGTAATGTTTTTGAGACATTTATGAGGACTCATAACATAAAGACT
AGACATTTGACCACAAGTTGGAAATACCTGTACATGCATTTCTTAAACCAATACAGTGTA
TACAAATTCCATGTGGCCTGATCTGATCTGATTTCTACATCCTTAGATTCATGTGGCTTC
AAGAATGCCAGTGCATTATGAGCATTCATATACAACACACCACACCAATTGTTATTGATA
TGACTTTCTTGAATATATAGACAAGGGAAGATCAATGGGATGCTCTTGTTTCTGCATGAA
ACCACTGGATTGCTTCTCCAAAGTCAAGTGACCTGTAAGTTTTGTCCTTATTAAGTTTTG
TAAATCAATGGACTAAAATCTATGTAATGGGTCTTTTTTTGAGTATCGACAATTTTCCTC
AATTAATGAAAAGCATGCATGACCCATACACACTGGAGAGACATAGTTATTTTCACACCT
GTTCTATCTCTGTCCTCTTAGATGATGATATGGAAGAACATTCTTGGGCTTGCTGTGACT
GGAGAGATTGATACAACCCAGGTATCCTGTAATAAATATGCCCTAACTCCAATTCACCTT
AGCACCAGAGTTCCAGGAAGCCTTCATTGGTAAGTTGATCAGGTCCAGATGTATGTAAAC
ATGGGGAGTGCCATGGCGTCAGTCAGGGATGAGGCCTTATATTATCTTGAAGAGAAATGA
TGACTTAAAAATCATTCTCAATAGAATTACACTGAGGCTCAGCTTAGATGACAATCCTGG
GATAGATAATAGTCACTCCTTATTTCCTTTCTAAGAGAATTTTATTTTGAACTTGAGATA
TGAAACCTCATGGGTAACTTGTTTTTTCAACTTTTCTATGCACCTATAAATAAACAAAAA
ATTCTCATTTGTTAAGCTTTGTTTTGGTGATCTATAATTTCTACTAGTATATCATATTCA
GGTTTCATTCCTTGGCCCTTTTTCTCTCATTTTGTGTTTCAGTAAGACTTGCTCTCAAGA
GATGAAACATTCCATTATAAAATATCAATAGCTTATTTTGTTGACACACATATTCCATAT
AGAGCATTGAACTATTGAAGACTCACACCTAAGACAATTAGTTTTCCTCATTCAGGCAAC
CTGAATATCAACACAGAATTTTCTTCTTGTTGTAATCCTCATGGCAAAATACGTACTTTG
TCTCTGAACTTCTTATGATTGAATGTTATGCAGTTTTTTGATTCACTGTTACCTAGTCCA
ACAAACAATATTCATTTGGGTGTAAATACATGACTGGACAAAAATTGCTGTAGTATTATT
ATGGGACTCTTATGGTGTTCTACTGTTTTAGGTCAGCGATAAGCTTCCCATAACACTAGT
ACCATTCTAATAGAGGAGAATATGAGAGTTCGGTAATGTGCTTTGCCTATGAAACTTAAA
ATTGAATAATTTGATGGCAAAATTTATACCCAAATTTTTGTCTCCTGAGTATCGTGTAAC
CCCATTATTTTCAGAATAATGAGAGTATATGCTGTGAATAATGACAGCTTTTACTTTTAT
GGACTTTGAGATGACTAGATTCACCAATTCAGTCATCATGGGCCCCAATATGGTTTCTTC
TTCCCAATGAGTGAGTGACCTACTAGATGGCCTACTCTTGGAAAATGTTCACTTTTTACT
GAAATTTCATTGAAATAATGTTGGAATATTTTCAGTCATGTTTACCATCTCTATGGTATG
ATGAATAATATTATATGTTACCCATGTCAAGAATCTTGTATGCTTTGTCCTTATGATGTT
AATGCATCAATGGTGTAGAGCCTTAGTAGTGTGTCTTTGTGATGGTATGGACAGTGTCTC
TCCACTAATAAATAGCATGTATAAGACAGTGTCTCTCCACTAATAAATAGCATGTATAAG
CCATACACATGTGAAGGATTTATTTCTGATTTTGAACTACTATCCTATCCCTATCTTCCT
AGATAACTATTGAGTAAAAGCACTCTTTGTACTACCATCCAAGTATACGATAGTGAGTCT
AACTGGTCTCCTGCCACTTTTGAACCATGGCTTGAGGATGCCATTTTGGTAAATGTTTAT
AAGTTAAAGTGCAAGTATGTGAGGAGAGTGTCTTGAGGAGATGTGATGTCATAAAAATCA
TGCTCAATAGGATTATGCTAAGGCCCAAAAGCGGTCCAAACTGTGAAACAAGGTGTAGGC
CATCATTAGATTTTTCTAGAGTGTTCTGTTTTGGGGTTGGTAGAAAGAAATCCTTTTGGG
AATCTTGTTTCATCCACCTCTATTTATCTGCTTCTAAGAGAATTTTTTTATTCTTTTATC
CTGATTTTAGTGTCTTTATTCTTAGTATTCATATATTTTAGAATAGACACATTTGCTTAG
TTTTCCTCATTGTATGCTTCAGAATGTCCAATTAGCAAGAGATGTGCCATTCCATGGAAA
AGATATGAGTTCTGCCATTGGTGATTAAAAAGTTCCAAATAGGCTGGGGCTGTCCCAGTG
GTGTAGTGGTTATGTTCACACTCTCCGCTTTGGCACCTGGGGTTCACAGTTTCAGATCCC
GGGCACAGACCTAGCAGCACTCATTGAGCCATACTGTGGCAGCATCCCACATAAAATAGA
GGAAGATTGGTACAGATGTTAGCTCGGTGACAATCTTCCTCAAGAAAAAAGAGGAAGATT
GGCTACATATGTTAGCTCAAGGCCAGTCTTCCTCACACACACACACAAATTCCAAATAGG
CCATTTGACTGTTGAACTCTGGCCTTTAAAATGATTACATCCACTTCTTCATACAAAATG
AGTGATGGCCTATTCTAAGTTGCCCTTGATTTGTAAAATTTAATACAACTACAGGTGGTC
TGAAATCCTATTTCCAGATCCAGATTTTCCTGTGGCTTTATTAAGTTTATGGTAGTCCCC
TCTTATCCATGGTTTTGCTTTCTGTGGTTTCGGTTATCCATGGACAACACAGTTCAAAAA
TATTAAATGGAAAATTTCAGAAATAAACAATTTATAAGTTTTAAATTGCACATCATTCTG
AGCAGCATGATGAAATTTTGAGCTGTCCTTCTTGGTCCCACCTTGACGTGAATCATCTAT
TTGTCCAGAATGTCCACACTGTATATGCTACCTGCCCATTAGTCACTTAGTAGCCATCTC
AGTTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved