Equus_caballus Locus Mono:6:SNORA26
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:6:SNORA26
Equus_caballus
Mono:6:SNORA26
3
SNORA26
1001..1122
2122
CTTGGGCGCCTATGGCCGGGCCCGCCCCTCTCCGCCCCGTCCCCGCCCCAGTCTTCCCG
GTGATTGAATCCAACTAGACAGACTAATTCCTCTGAACCATAACGCCCGGGAAAGTTACC
CGGTTAAAAGGAGACTTAAACAGAAATAGCAAACAAGATCAACCCCAATATAGATTACCT
TAATTTTTTTGTAAGGGTTAGACAGGGACATATTTTCCCCAACGACATCGGTATTAAATT
TTCTACAAGATATTTGTAATTTTTTGACAGGAGAGACATTTCTTCTTTTATTCATTGGCA
GCATTACAATTTTTTTATAAGTGAGGGTAAATGTCCCCGCAANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCCGCGCGAGGCACAGAACGCCGCGGGCGTCGTCGGAAGGAGGCTTCCCGGTGGG
CAGCCCCGGGCGCGGTAACAGCTTTGCGCTTTGCTTCCCCAGGGCGCAGCCGCGGCTACT
TGGTAGCGGGTTCGGGGCCCCGGCCGCGCCTGCGGCGGCGAGAGCCATCCTGGACCGACC
TCGGGCCTGCGGAGTTTGTGTGCAGCGTCTGCTGGGTGCAGCGGCCTCAGTTCTGAGCGC
AGGTAGGTCCCGGTCTTTGAGCGAAATGACACGGCCCAGGCCCTGAGCGCGTGGCCAGTG
GCGACCGGAGGGTTCCCGGGCGCGTGATTGCGGCAGGGGCCTGAATCCGGCTCTGCCTTA
ACGTGGAGAAAATTTACGTTCACGGGCTCCACCAGCACAACAGCTGCTTCTAGTGGGTTG
TCAGAATTGTTAAAGAAACTGCTGAGATCCATGGGATACTGACGAAGCAGGAGCGCAGGA
AACCGTGGGGAACCCTGTAAAAACCCACATGGCCCTTTCCTGTGCCCTTTTAAGGTTGAC
GCAGTGCCTTAAGAGGCTAACACAGAAGGGCAAAGTAAGTCTCCGTAAAACCCGGAGAGG
AGATTGTCGGACTCCTCTTTGGATCCTATCTGGAGTCATAGCTGAACCACAAGAAAATTC
CTTCCAGTTTAAGCACCTTTGTGATATTTTTTACACAGCTCAGCACAAGTGATGAATTCA
AACTTAACCTTAGCATTGGTGGTACATTGAGGTAAGGTGTTGGTATTTGTCACTGAGGGC
AGGACCAACCCACTAGAATGACTTAAAGACTATAAGTGGAGAACGTCTGAAGGCACTGGC
TGACGAAGGTCGTGAAGCTTCCGGAGGCCAACTTCACTGGGCAGAAATAGCAGTTTCCTA
CTCAGACCATGAACTATTTCCAGGTACTCAAAACCTCCCCCAGAATGCCTTGAATCAATT
TTGTCCCTCCCTCTCCCAAAGATGAATGATTATACAGATCTTTATGAGTAGCTGGCTACT
GCCACCAATGGATTCCCATTTTGCTGCCCTTGCCAAACTTTTATGTGCCCTCCCAAATAC
AACCACAGAACCCTCTGCTGAGGCATGGGCCTCCTCTGAAGCATTGAAACTAGCGTTGTC
CACCCGTGCTCCCCCCAGCTCTCAGATTACCCAGTTTTGACAAACCTTGTAACCTATATT
GCCGTGAAAATACTGGGATAGCTGCAGGTATTCTAGGGCAAGTCTTTTCCTTTCAGAAGC
ATCCCGTAGAATATTTCTCATCAGTTGGACCCTGTGACTTCAAGCCTGCCTCAATGCCTA
TGTGCTGTGGCCTCAGCTGCCACCTTGATTAACAAAGCCAGTGCCCTTACACAAGTTTCC
CCTTTCACCTTTATATTCTGCATGCTGTGTCAGCTCTCTTACAAGTCTATACAATAGCAC
CTCTCTACTGAACGACACCCACCTATGAACAGGCCCTGTCAACCAACCCCTCTGTCATCT
TGTACTCCTAAAACTCTAAGCCCAGCTACGCTATTACCCATTCTGATGATAAACAACCCT
ACTCTATTCTATGTAGTTGCCTTACAGCCATAGAGATGCTTTCTAAACCACAAAAAGACC
TCTTAGACGCTTCCTTTAGCCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved