Equus_caballus Locus Mono:51:SNORA12
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:51:SNORA12
Equus_caballus
Mono:51:SNORA12
11
SNORA12
1001..1146
2146
ATTTTTAAGATTATAAAGGGGTCCTGAGACCGATAGAGAACCACTGATTCGGGCAGTCA
TCAACAAATAGCTGTTAATATCCCCCAAAAGAAAGGTGACGAGCTCTTCTGTGCCCCGCC
TCCCTGATGGAAGGACACGCACCATCACCTATGAAGTAGTTTTCTCAGAAAAATCTAACC
TGAATCTGATTGAGCCTCTTGATCTAACTAAAAATTTATATTTATTTATTTAAAAATTTT
TTTGAGGAAGATTACCCCTGAGCTAACATCCACCGCCAACCCTCCTCTTTTTGCTGAAGA
AGATTGGCCCTGAGCTAACATTCATGCCCATCTTTCTCCATTTTTTCATATGTGAGACGC
CTGCCACAGCATGGCTTGATAAGCAGTGCATAAGTCTGTGCCCGGGATCCAAACCTCGAG
CGTGCGAACTTAACCTCTGTGCCACCCGGCTGGCCCCAACTACAAATTTCTAGAATACAA
AGGGGACAAAGGAATGTGATGCCAGGGGACTGAAAACATACAGTCCAGGTGTGACAAATC
CACACTGCATAGGATAAACAACTCAGTTCCTTCAACAAATAAGTTGCAAGAGAAAATAAA
AGAGAGATGCAGGGAAATCTATATGTGAAAAGGAACTTAGGAGACATATCAACCAACGTT
TGGACCTTATTTGGATCCTACTTTGATCCTTAAAAAAAAAAAAGACAATGGGGAAATTTA
AACACTGTGGACATTTGGTGGTATTAAAGAGTGATTGCTCCTTTTTTAGCTGTGGTGATG
GGATTGTGTGTGTGTGTGAGAACCCTTATCTATCGGTGCCAGTCACGCCTCAGTCAAGGA
AGCAGAACTACTATGAGTATTATAGAGTGAGGAATTTATTGCAGGAATTAACACCATTGC
GGGACAAGCGGGAGAGGTAAAGTTCCCAAAAGGATCAGAGAAAAGTCACTACCCAGCCTT
GGCACATGTGAATGACTTGGACCTTGCGAGAATCCATAAGCAGTTGTGGTGGCTTTCTTT
CTGGCGCATTTGTTAAGTTTTCAGATGGGCCTGACTCTGCCACATGTATTATTTAGGAGC
TGGCAAAGGCTTGATGACAGAGATATCTCTCTAGCCTTTCCTGCATCAGCGATTGGCTCT
CACATGTGGCAGGGCCATCTCGTAAGTTTAAGTCCTTACAGACAGGCTGACACAGGTCTG
TCTGGCCTGAGGAGAATCTCTGCTGAGGGGTGTTTCTCCACCCCTGTGATGGATTTGCTC
CTTCTCAGGAACTGTGCAGGAGGCATGACCTCTCTGGCACCTGCACAAAGAATTTCTCCT
ATCTCCCTACCCCCTACCCCTACCCCCCAGGTTATTCCTGTGCCACTCAGCTGCTGCACT
GCTGATGACATTAAAGATGCCTTCCTTAGCAGGCACGGGAGCAGCAGATAGAGCTGGTGG
AAATCCCAGAGCACTCTGACATCAAGCAGATTGCACAGCCAGGAGCAGCGTATTTTTTTT
TTTTTTAAAGATTTTATTTTTTCCTTTTTCTCCCCAAAGCCCCCCGGTACATAGTTATGC
ATTCTTCGTTGTGGGTTCTTCTAGTTGTGGCATGTGGGACGCTGCCTCAGCGTGGTCTGA
TGAGCAGTGCCATGTCCGTGCCCAGGATTCGAACTAACGAAACACTGGGCCGCCTGCAGC
GGAGCGCGCGAACTTAACCACTCGGCCACGGGGCCAGCCCCAGGAGCAGCGTATTTTTAT
GTTGAACTTGACACAGGAGAGAAGCTTTTCCATAGAATTAAAAAGAATTTTCCTTTGCAA
TTTGGAAGGGAGGTCCTGGCCGGTGAAGCCATCCTTAATATTCCTGACAAGTCTGACTGG
AGGCAGTGTCAGATCAGCAAGGAAGAGGAGGAGACCCTGGCTCGCTGCTTCTGGAAAGAC
TTTGAGCCCTTTGACTTCACTCTGGACGACTAAGCAAAGGGAAAAACACTTTATGAACGT
CACAGGAATTAGTAGCAGCCTGTTTTTTAAGAAACTACAGTCTCCCATGGGGACTGTTTT
CCTGCCTCTTTCTTTGTGCATTCCCATGGAAGCTGCCTGCTGCAAGAGGCCTCAGATTGA
ATATTTTTTGGAAAAAGTCACATTCTAGGATGAAAATCCTATATTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved