Equus_caballus Locus Mono:56:SNORA57
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:56:SNORA57
Equus_caballus
Mono:56:SNORA57
19
SNORA57
1001..1148
2148
TCTTCAATTAAGGAGAGAGTGGGAAGGGGCCATATGCATATACAAACGTTGTGTTACTC
AAAGCACTGGCGTCTTGGCAGGAGATCTGGGTTCTAGACTGTCTATGATTAATCTTGCTT
AGCCTCAGATTCATTATTGTAAAATGGCAGAGGGAACGACGATGTTCATGAAAAGTTCTC
AGGCTGAAATCTCTGGTAGCCATGGTCAGACTCTGGTTTTCAGCATTTCTGAGGTCTCAT
GGCAATCATACATTACCTGGGAGTTAAACGGAGGTTTACTGCAGCATTGGGGTTTGCTGT
TTTTACTTGGAATTGTGTTAAGTTGGCATGGAAAAGCAGGTTATCACCTGCTCATCAGAA
GCTTTGATTGTCAGTCTTTTATGTTATTTATTAATAAACGGGAAAAATGAAAGCATAGGT
TTGATGGGGAGAGATAATAATAATAAAAATTGGTAGCATCCTAGAATCCTAAACTTCATT
TTTCAAACATACTAGTTTTATCCTATGAAGCCTCTTTCTACCTTTATATGAATTTAATTT
AAAAAGTACAACTTGTGTGTACATTTAAGCTCTTTACAAAACTTAACTAGCTCAGATGAG
ACAGTATTTCCTCAGTAAAGGGAAGAACCAGCAAATTCTTGTCTCTAGCCCTTTCTGAGA
AAGCTCCAGCCAATACAGGTCCTTCCATTCTCAGATGTGTGTGAGGGTAGGAACTGCGTA
AGTTACTGCAGTGTGTAATAATCTTGGTCTGTTACGTTTTCATTAGTTCCTATTTATGTT
TCAAAAACCTGTTATTGTGTATTTGTTTGATTTCAGTATTGAGTCAGACTAACAGGTGTT
GATTCGTTAACTTTAAAGAGCATTTCTCATCTTTGTGCTTCCCCCGCTCCAGTTACCCGG
AACTTACATGGCAAAATGCAGGCTTTAACTTTCCTACAAATGGCTTCAGAGCTCTGTTAG
TTTAAAATAGATTTTTATCACTTAAAATCAGAAGGTTATATGCTCCTTTTCTTGGCGGGG
ATCAGGCATGCATCCCGGTCCCCATAATGTATGGAGGCAGAGGGAAAGGGCTCCAGCCGT
CTCGGCGTTGTGTCTTCAGTGCTGGTGGCTTCCAGTGCGCCGCTTCTATCCTCAAGCACC
AGGACATGGGGGAATAAAAAAATCAGAAAGTTATGTGTATTATCTGATAAATCAATGAGG
AATATGATTGTCTAAAGTAATGACTCATATTTTCTCAAGTACATCCTTATTAGCCTGTAA
CTATGTTAGTATAATTTTTTGGTATAAACTTTCTTTTAACAGTTTTTTGATTTTTTTGTT
TTTCTTTGGTGAGGAAGATTGGCTCTGAGCTAACATCTGTGCCAGTCTTCCTCTATTTCA
TATGTGGGATGCCTCCATGGCGTGGCTGATGAGTGGAGTAGGTCTGTGCCTAGGATCCAA
ACCTGCAAACCCAGGGGCTGCCAAAGCGGAGCACATGGAACTTTAGCCACTTGACCATGG
GGCCGGCCCCTATTTTAACAGTTTTAATGTGTACTAGAGCTTTTAAAAAAAATAGCTTTT
ATATTACTCTTTGTTAAAACGTAACTTTTTTCCCTTAATAATCTGCATTTCTGTGAGTTA
CAGTGATATTTATTCTTATGTCGATCTTTGTGATAACTTGAAATAGCAAAGTTAGAGTCC
AGATAAAATTGGCGGAAGCTTTCCTCAAATATTTATACTATTTTTTATAATTCACGTTTA
ACATGAAAATCTCTTATTGCCCATACAGAAAGTAGTTATTCTTATTCTAAAATTCTACAG
ATGTATTGACAGTTTTATTTCAGTATAAGAATTTCTGACTCCCCAGAAAGTAACATTCGC
CTTTCTAAATATTTTTAAGCTAATGATAGATAATGCTTATTTGTTATCTTAAATAATGGT
TGACTTTCAGTGTGGTAGAGTGTAATGCTTAAGAGGACAGGATCTGAGGTTGGAGACTCT
CATAGCTGTAATAACTGGTCTACTAGTAAAACTGGGCCTAGCCCATTGGCGAGAATTCCA
GAGGGTGTGATGCTTGCCGTAGAGATACTGGTATCTGTAAAATGCTGGTAAGCCAGGACA
TTTTGCAAATTATCTATCATGCCTGGTTACCAAGTTTGTAGTGCATTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved