Equus_caballus Locus Mono:72:SNORA33
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:72:SNORA33
Equus_caballus
Mono:72:SNORA33
16
SNORA33
1001..1124
2124
TATAGCAATTCCAAATATTGCATAGGACCTAGTTATACTAAAAAATTATTTGCTGTTTA
TCTGAAATTCAAATTTAACTGGTCATTGAGGTTTTTTGTTTGTTTGGTTTGGTTTGGTTT
TTGCTACATCTGGCAACCCCGCTAGGAAGGAAAGGACTCCCAGTGCGTGCCCTGCTTGCT
GCCTTTCACCTGGACCCACACCTGCATCCCAGTCACATCCACCATTACTACCCACCTGCC
AGCAAAACACACCGCAACTAAGGAAGTGGAGGAAAGAGAATTCCTCCCTAAAGGTCACAG
CAGATGTGTGGAATCCTCTAAGTCCAGGCTTCACCAGGAATAAGCCTCCTCCAAAATGGG
AGGTGGCCCATGACCCTCCATCGTGTCAACTGTGTATAAGAAGAAAGGAAGACTAGGAGG
GGCCAGTCTGCTTCAGGGTCTCTGAGCTCCAGGGCCTTTGATCTTTACCCTCAAATCTCT
ACCACCAAAAGCAGTGGTCCAACAAATGACCTTCGACATGGCTCATCAACATCAGCACCC
TCTTCCACAGGGGGCAGTGATGGCAAATCATTTATTTTCACCTAAGCACAGGGTAGCATG
TTTCTGGGCCTCGGCTAATACTTACATAACGATGGTATGCTAGTTAAACTGATGGGTTTA
CAAGACGTATATAGTACACAAGATATTTTTTACTTTTTATTTTTCCAGCATAAATATATG
TGGAATACCAGAACCACAGATGAAATAAGATCATGTTCTCACTCTCCTGTTGTTCAGTCA
GACGCCCGGGATAGATCTCATCTTCTGAACAGTTATCCAGCTGAGTATCAGAGATGCTCC
TGCCTCTCAGGGTGTTCTTGCTTCTTCATGACCATACTTACAAAAGGCATCTGTTCTTTT
GACAATGCCCACTTTAATGGACATTAAGTAATGTCCATAGCTGTGACTTTCAAAATTTGT
ATGTATCAAAATCATCTGGAGGACTTATTAAAACATGGATTATAATGAATCTGCTTACCT
GAAGTGTGTTTCCGCAGAAATTTCGAAAAAGCTGGCAACAGTAAAGGCATGTTACAAGCC
TTAAAGACATTGAAGTGATTAAGGTTTCTGAAAATGGCTATAAGAAAATAAAAGAAAACA
ACAGCACAGGTTGATTCGGGGATTCAGCAGGTCTGGGTCTGGGGTGAAGCTTGAGGATTT
GCATTTGCAATGTGAGCCCAAGTGATACTGCTGCTGGTCCGGGGACTGCACTTTGAGAAC
CACTGGGCTATAGATTAATCTTCCTTATTGTGGCCGGACGTTGTCCTCTCATGGATGTAA
GATACCCGTATCCTTTTAAAGCGGCCATTAGATAGCATCAAATCAATTTCAGAAGACACA
CGCATGTATGTGTGTACAAGCAAAGATGTTACAATATTTATATATCAATTACTTTGAGGG
ACAATAAATCCATACCTAGCTAGTGTTACATTAAATATAGAACACTGTGGTCTTCACATA
TCTTTACTCTTAGTGAGACAAAGAAATTTCTTTCTATAGCTGAGAATCTTTCCCTTCCCA
CCCCTAAACGGCTATGGATATAGTATTAATACTTAGATAGTATCTTCGCAAATAAATTAA
CTTGCAGTTATAAATTGCTAATTGAAATTTGGTTTTCCTTATTTTAATAAGTAGCACATT
TTAATAGAAATATTTTAATATTTAATATTTTAAGAGCAAATTTAAAAATAAAAAAAAATT
TCAGAATAGAGCATAGAAGTTAAACCTAATTCCACTGCCGAGAGAACCTCTGTGAATGTT
ATATTACATATCTTTCTGGTCTTTTTTGTTTTCTCATTTTTGCTGTTTCATGAAAATAGA
ACCACATTGTACATACAGTTTTGTAATTTTTTTACCAAATGATAAATTATGGGCATTTCC
TTATGTTGTTAAATATGCTTCAACAATACGATTTCTAATGACTACAAAGTGTTCTTTCAC
AAAGATATGCCATAATTTATTTTGTTTTTCCCCTATTGCCGGGCTTTTAAAGTATTTCCT
TGTTTGCTGATATAAATAATGCCAAGAGAAACTTCCAGGTTAAAATGCCATCGTGGCAGG
TCGCCATAATAAAACTTCATCTAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved