Equus_caballus Locus Mono:58:SNORA31
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:58:SNORA31
Equus_caballus
Mono:58:SNORA31
17
SNORA31
1001..1134
2134
AACTGGCTGCTGCTTTTCATCCACACAACACCAGGACTTAGACAAATGGGACTGATGTC
ATCTTGAGCTCTTCATTTATTCTGACCTTGATTTATTTGGAGCGGAGGCATTGTTTTTAA
GGAAAAAACATGTCATGTAGGTTGTCTAAAAATAAAATGCATTTAAACTCATTTGAGAGA
ATGCCTCTTAGTTTAATCCGTATTTAAATCCATCTTGTGTAGTGTTCCTGGAGAAGCTAG
AGCCTGGTTGTAGACCACTACTAGAAAGCATAAGACTGCCTTCAGATCACTTCTACAGTG
AAAACTACTTCCGGGACTGGAATATAAAAACCAAGAACCACAAGTCTTAATTCTGAGTTG
AAGTAAAGGGAAAGACCATGCTCATAGCAGTGCCAACATTTGAAGTGGATTCCTCAGACA
TTTCATCACCTCCAAACGGAAGTAGTTAACCCTGGAAGAGATTACCAAAAGAATAAAAAG
AGACTAATACAGTTGGAAGCAAAGTATTGTGTCAGCTTATTTATCCTAATTCAAGTAGAC
CCAAGTTCTAGAGAAATCTAGATGTCTCCTGGAATGAATGCTTGTCAAACTCCTTGGAAT
GGGGTTGACAGACTGGCTTGTCCTGCCACCTGTCTTTGTATGATTTTAAAGTGGTGGTTA
CATTTTTAAGTGGTTGAGAAAAAATCAAAGTAGCTTATGGGATGTGGAAACTTACAAAAT
CCAAATTTGTGTCCAGTTTTATTGAAACACAGCTATGCTCGTTTGTTTGTGCATTGACTG
GCTCTGATGCTGCAAGAGCAGAGATGAGTGTGACAGAGACCTTTGGGCCTCAAATCCTGA
ACAAACCATGTGGCCCTTTACAGGAAAGGTTTGCCAGCCTCTGCTTTAAAAGATGAAACT
ATAGATTGAATATGGGATAGTTGGTGGCAGAGGAAAAAGCAACTGTCGGGGCAGTATATT
GTATCTGGGAAGGCTGTGGGTATCAGAATGAGTATATGAAAACGCATCTATTTGACAGAC
CTGGAGCAGTTACTGTCTGCTGCTAAGGTTTCCACTACAGATGCAAGAAAAAGGTGTCCT
CGCGCTTTCTTTCTGTCTCATTGTGGCAGCCAAGATTGAATGGGGGAATACAGGGGAAAA
ACATGGAGAGAATTTTTGCCACTTGGAAGTAACCTTGTAAACAGTGAAGAGGCTGTTTAC
TCCAAGGAAGAATCTAAAGTTTGAGTTTACAAGGGAAGTGTTGAAAACTGTTCCCCTACG
CCTTTGCCTTCTGATTGATTACACTTTTAAAAGCTTATAGCTTAAAACTAAAGGCAAGCG
AGAGATTCTTGTACCTGGTCATGTGGCATGTGAACCCAGCATGAATCCAGTGATTTGGCA
ATCGGGAACTTGTCTTAGTGACTGAAGTCCATTGGGTGGTTCAGAACCTGAGACGGATAC
AAATCAGGTTGGTAGCGCCCCCCCCCCGTCAAGCTGATGGCAATTTTAAGCCTTCTGATT
TCTGACATTAAAATGTAGGTAAAGTGCCAATCACTGATCTAGGAGGCCTCTTGCCCTCTG
AAACGTGGTAATGGGAGGATTTTCAAGTAGTGGTCAACGCTGTGGAGATGAAGATAGCTT
GGTAGTGGGAGAGGTCTTGAGGTTACATCTAAGCTAAAACCTGATTTAGTGAGCTGGTCA
TGGAAAAGTCTGCAAGAACAGGAGTAGCATTGCAGCAGCTTTCTTCAGGAAGTGAAGAGT
CCAGGTATTTGCCTAAGGATGCTTATTTCTGCTCTTTTTCTAGTTACTCGAGTTATATAT
ATTCTCTTTTTCCTTTTTTGTTTGGTGAGGAAGATTGGCAATGAGCTAACATCTGCCAAT
CTTCCTCTATTTTGTATGTGGGATGCTGCCACATCCTGGCTTGATAGCGTTGCACAGGTC
TGCACCCAGGCTGCAAACTGTAGGCTGCAGAAGCAGAGCACGCAAACTTAACCACTATTT
TACCAGGCCAGCCCAACTCTTGAGGTATATTTTGTGCAAGAAAAATATGTGAATTCTATA
CACATCATAAGGCGTAGCATTTTGTGTCATTGATGCTAATTTGATTTGGGCATGTTCTTG
GTGGCCTTTAAGCCCTAGGCTTTGTTACATAATGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved