Equus_caballus Locus Mono:67:SNORD115
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:67:SNORD115
Equus_caballus
Mono:67:SNORD115
1
SNORD115
1001..1076
2076
GGACACAGATTCCACCTGCCACCTCTGGTGAGGTGGGAAGGAGCTGCATTTTCTGAACA
CTGAGTCTGCTGGAAGTTGTGCCAGCAGGGCTCCTCTCCATTTTCCCTCTGGCCACAATA
ACTTGGCGGGTCACACATACACACCAAGGCACTATAGTGTGGGATCACTGTGTTGGCAGG
GGACCTGCTGAGCTGATGTGCTAGATGGAGAGAAGGGGCACTTTCTCATACAGGGGCCCA
CTCTGCACTTTCAGGCAGTTTGCCTGAGCTGCTGCACTTAGTGGGGGCTTTTTCTTGAGG
GCTGAGCTGCAGCACTTGGTGTGGAGCTTTCCCATGGGTGGGGCTGCCAGAGGACAGTGG
GCACTCCCATAGGCAGAGCCACAACTCCAAAAGTGAAAGTGTTCATGCTCATGTCTGCCT
GCCCCCTGCCTCCTCTTACAGTTGCATGCTGGCTGCTGTGTGAGGACCTGTAACCTAGAC
AGCTGCCACCAGGAAGAGGGGGAATCTTCCTACCTCCTTTCACTGTTTCCAGGGGATCCT
ATACCCCCACCTTCAGATGTATAGCTGTGTGGATCTCTCAGACATCCTATTGTGATTTGT
AGGGAACCTCTGTTGGTTAATGAATGTCCATTTAGTTGTAACTTAGTGAAGAGAAACTAG
GGAACAACTCACTCCACCATGATACTGACAACACTAATGGGTCATGTTTTGAGTATCATA
TATGTCAATCTTGTAGAAATTAGGAAGTACAAGCAGGAGCCATATACACATAAGAGAGGT
AATCCTATTCTTTGTCTATAGTCTTACTCCTGTCCTACTACAGAAAAACTACTGAGGAAG
AACACTTTTAACCCTGTTGCCCATGGGGTAATTTGTATCACCTAAGTGTCCTGCACTGAA
TATGCCAGCATGGAGTCCACTATAGCACCAGTGTTTAAGAAAACCATCTCTGATAATCTT
ATTAAGTCTAAGTGTATGTATGCATATGAGTGCCATGGCTTGGGTCAAGAGTGAGATGTT
ATCTTGAAGGGAAGTGGTGACACAAAAATCAAGCTCAGTTGGATTATGTTTAGGCCTAGC
CTAGGTGACAATCATTGAATGAGACTTTGGATTTCTTAGTTCCCTTTCATGGAAATTTAA
TTTGGGGCTTCAGACAATGAAATCTTTCTGTGAAACTTGTTTTGCATACCTCTATCTATG
CATTGCTAAGTGAACTACAAAAAAATTCTGATTCTTTAAGTGTTATTTAAGTTATCTATG
ATTTCATGAATATTTGGTGCTAAGACTTTGGTTATTTTTTCCTCAGTGAATCTTTCAGTA
AATCCTACTGGCACTATTTTATTGATTACAGATGAGTAGCTGCCTTTGCTGACTGAGAAA
TTCTAAAGAAACAATTGGACTAGTAAGACTCACCTCTATAAGAGATTTACTCATTCATGC
AACATGAATATCATTGTGGATTTTTCTTCTCAATGATTGGCTAACATATCTGATGCTGTA
CTCATTAGAAAACTTTTAGAAAATGTTTAATGCACTACATTCAGAGTTTAAATACACAAA
TAGATAAAAATTTCTTCTATAATATTAATACAGTAATTTAACAGTGCTGGGATATTCTTT
TATCACTGATTAAGTTTTTATAACTGAAGGACCATCATAATTGTGGTATGAATGTAAGTT
TCAGTATATGCTTTCCCAGGTTGAAATTGGATAAAACAATAACCAGCGTGGTATCCAATT
TTCATTTTGATTGTTTCAATAAGTTCTGCTGGCAAGAGATGCATCAATCCATTGTTTAGA
GGTAACTGACTGCCTTTGCTGAAAGACAAATTCCAAACAAATGATTGAGATATTGAAGAT
TTACCTCTGAGACAATTAGGTTTACTCATTCAGGCAACATAAATATTATGCATTTTTCTT
CTCAATGAGTGGCTAACCTGCTTGCTGTGATCCTTATAAGAAAGCCTATGTTTTTTTTTC
CTTTTTCTCCCCAAAGCCCCCCAGTACATAATTGTGTATACTTAGTTGTGGGTCCTTCTA
GTTGTGGCCTGTGGGTCACCGCCTCAGTGTGGCCTGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved