Equus_caballus Locus Mono:26:SNORA32
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:26:SNORA32
Equus_caballus
Mono:26:SNORA32
2
SNORA32
1001..1101
2101
GGGTTCGCCAGTTCGGATCCCGCATGCGGACATGGCACTGCTTGGCAAGTCATACTGTA
GCAGGCATCCCACAAATAAAGTAGAGGAAGATGGGCACGGATGTTAGCTCAGGGCCAGTC
TTCCTCAGCAAAAAGAGGAGGATTGGCAGCAGTTAGCTCAGGGCTAATCTTCCTCAAAAA
AAAAAAAATTGATAACTATATTTCAATAATTGGTTTCCACTGCTTTTAAAAACATTATTC
TAAAAAGTGCCTGCAGGCTTCCCCAAGCTGCCAAAGGAATCCGCAGCATAAAAGATGTTA
AGCTGCCCTGGCTAGAGTTTCAGGGCAGAAATCTAGTATATTTGAGGGCCTTGGAGATTA
AAATCACTCTTCTGAGGCCTGAAGGCATTTGCTGTTCTGCCCTTACTGGCATCTTCCCCC
TTGAAAGAGAGGTCATCTGGAGGAAAGCCCAAAGCACTCCAACTTGGGGTGGGGTCTGCC
AAGAGCAGAGACCCACCGACTATCTGAGAGGAAGTCAGGACTGCTGAGCAGATTTTTGAC
CTCCCCTTATGTTATTTATTTTGGTCCTTGTCTCCCCACAATGCTTGGCAGCACAAATCT
CAAAACAAAAGGAATTTCTACATGTGCCTGTATTCAGAAAAAATAGGGGCAGGGATGGCT
AAGGACGCTGCACACCTCACTCCACACCTGGAACTGGGGGAAGAAAAAATCCCCAAGAAT
TCTTCTATTAAGGAAGGAACAATTAATAACTTACTTCCGTTCTAGCTGCATCCGGGTTTT
CACCATCCATATAGGATTCATTAAGGAATTTGTGACAAAAGCTGGGAAAAAAAGCACAGA
AAATATCATCACTGAACACAGTCAATGCTTGTTAAAGCTGCCTATTTCATATGATAAACT
CTGAAATGAGAATTTCAATGCCTTAATAGTGAAAATGGACAGTAGGGAGCAGTTACGTTT
CTGTACTGCAGGTGGCCACTATGGTCCCCTAAATGTAACATCTGTTGGTATGCTGGACCT
AAAAACAAACAAACAAACAAAACTCTTCCCACTGGGTTTTTTTTCTGCTACCTTGCTAGC
GTTCAGCCTATTGGGAACATTTTACTAACCCTTGTTTTATTTCCATTGCTTAGATCAGTA
CTGTCCAGTATAAATATACATCACGAAAGGTCATGAATGAGACTGACCATGGCTAGTGGT
GGTTGTACAGTGCATGCCTAGATCTCTGGAGTCTTGCAACTATCTTTTGCCTGGTTAATC
CTTCTTAAATTTTTTTTTTTTTGAGGAAGATTAGCCCTGAGCTAACTACTGCCAATCCTC
CTCTTTTTGCTGAGGAAGACTGGCCCTGAGCTAACATCCATGCCCATTTTCCTCTACTTT
ATACGTGAGATGCCTGCCACAGCACAGCTTGCCAAGGGGTGTCATGTCCGCACCTGGGAT
TTGAATCGGCGAACCCGGGGCTGCCCCTTGAAATTTCTTTTTTAAAAGGGCTATCTTGAA
GATTATGACTCAAACTTTGGAGGAATTAAGGTGACTGGAAGGAATCACAACATGGGAAAT
TATTTAAATAAAAATTTATGGACTTAAAAAAAAATCCCAATTTTCTAGAGCCCTGTCTAA
TCTTTCCAGCCTCTAGGTGGTGCTGTTGGCATTTCTGTTCATGTGATTCAAATCATTATA
GTAAATATGAAACTATCCTAAAACTCAATTTATGAGCTTCAGGGCCAGAAATAATTTGTT
TTAAAAAGTTGCTTATTTAATCCAAAAGGTTACTTTATTTTTATTTATTTATTTTTTAGG
AAGATCAGCCCTGAGCTAACATCTGCTGCCAATCCTCCTCTTTTTGCTGAGGAAGACTGG
CCCTGAGCCAACATCTGTGCCCATCTTCCTCCACTTTATATGTGGGATGCTTACCACAGC
ATGGCTTTTGCCAAGCGGTGCCATGTCTGTACCCGGGATCTGAACAGGCGACCCGCAAGC
CACCAAAGCGGAACGTGTGCACTTAAGCACTGAGCCACCAGGCCGGCCCCAAAAGGTTAC
TTTATATCTAACTTAAAATAGAAGGAACCAAATCTCCATTTACCTGAAGCCAAACTCACA
CT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved