Equus_caballus Locus Mono:84:SNORA57
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:84:SNORA57
Equus_caballus
Mono:84:SNORA57
12
SNORA57
1001..1149
2149
CTACCAAATACATTTCTTATACCATAAAACTCTGTAAACATTTACAGTGAAGAAGTCAA
TTAAAAGGTGGGATGGGAACGCTTCCCCCAAGACTCAGGGGGCCTTGAAACTTACATACA
AAATCCCACATGTGCCTTGTGAAAATTCATCGAGTTATTCGCACGCTTACGTGTGCGCTT
TTAAATTTACTTATAAAAATCTATGTGAATGTATGATGTTACTTGGGGAGGTGGGGGATT
CGATAGCTCTCCTTAGATTCTCAATGGGGTCGAAGACCCAAAGAAAGGTTGTTACCTAGC
GGTGTCGTGAGAGGGTAGCAGAGTTTAGACACAAAACACAACCAACAAACGTTCCTTGCA
TAAACGTGAGTGCAAAAGGAAAGCAGAGAGGTGTTAGCTTCTCCGGAGCTCAGCAGGGAA
GGAAGGAGACTCGGTGGGGAGCATCGAGGGGAAGAGGGTTTGGCACTCACGCCCGCTTCT
TGAGGTGGTGCCGCGTGATCAGCCCTTCGTCTATGACAGCCCCAACCACCCGGTGCTTCA
GTCGCCGCTGCCGGTTCAATACCCGCCGTCGCTTGAACAGCTTCTTCTTCAGCTCCTGCG
AGGGAGGAAGATGCTAATCAGACGGAGGCCACGCACCGCGAACCAGGATCCCCGCACCGG
GAGACTGGCCCACCGAGCTCATCTCGGGCGAGATGACAGGGGCTCTGGGGCGCTTGGGCA
GTCAGGGCTCCCACACAGTCACCGTTCGGGGCCGGTTGATCTTTCCCCCAGGAGCTCCCA
TGGCCGCGCTGCGATCCCGGCTCCGGGTCGACGTTTCCGCCTAACGCAGGGTCCGGGTGA
GCCCCGCCCCTCAGCACTCCGCAAGCCAATGGCAGCGCGGGGGCGGGGCCTGGTCTATAT
AAAGGATCTTGGCCAGGCGTCGGGCCTTTCCCGCCGCGGAGACGGAACTACTGGAGGTGT
GCGTGGAGGCCGGGTGGGGGTTTTGGGTGGGGCCTACGGACCCTCCTTTTCTTGGCGGGG
ATCAGGCGTGCGGTCCCGGTCCCCGTAATGTACGGAGGAAGAGGGAAAGGGCTGCAGCCC
TCTCGGCGTCATGTCTTCGGTGCCGGTGGCTTCCAGTCCGCCGGTTCTATCCTCAGGCGC
CGGGACACGGAGCTCCAAGGAGGAGGGCAGCACCGAGGTGCAGCGGGCTCTTCTTCCCTG
GGATGCTCACGCCTTCTTCGGTTTCAGGTCTGTGGAGACGCCCCAGGAGCCGGACCTGCC
GTATCGCCTCGTCTCCACTTGCCGTTGCAACCAATAAAGGCCTTTCGCACCGTGGTAGGT
GTGTGTCCGCGTTCTTTTCCCGGAGGCTGCAGAGTTAGGCTACACGCGTGATTCCGCAAA
GCGGATTTTTCAGGTATCTGGCCTGCCTTGTCATCACCTCCAGATGGTCGCGCTGCGCCG
AACCTTCCACGTGGTGACCCTGGCGGCGGGGGCGCGCCGTGCGTTGACGGGTAGGGAAGG
TGGACAGAGTGGGCGGGCAAGGTGGGTTCTCGGTGAGTCGGGAATCTAGTCCCTGAAAAT
GTGGCCCTTAAAACCCCAGGGTACATTGCACCATTTTTGTAGCCGTCTGATAGTACTCAG
GCGCCGGGTGACACGTGTCCTCCACTCGTGTCCACAGGCTCCCTGGCTGGTAGCTGCCTG
GCAGACCGCTGCCTCTGGGATAAGCTCCATGCCCAGCCCCGTCTGGGCAGCGACCCCACC
TTCGACTGGTTCTTTGGATACGAGGAAGCCCAGGGGCTCCTACTGCCGCTGCTGCAGGAG
GCACGGGCTGCCTGTCCACTTCGGGTGTTGGATGTGGGCTGTGGGACCTCAAGCCTGTGT
ACAGGCCTCTACACCAAGTGCCCGCACCCCGTGGATGTGCTTGGGGTGGACTTCTCTCCT
GTGGCTGTGGCCCACATGAACAGCCTCCTGGAATGTGGCCAAGGCCAAACACCCCTGTGC
CCTGGGCACCCTGCCTCCCACCTCCACTTCATGCAGGCTGACGCCCAGAACCTAGAGCCA
GTGGCTTCCTCAGGCTCCTTCCAGCTAGTGCTAGACAAGGGCACCTGGGATGCTGTTGCC
CGGGGTGGTCTGCCTGGAGCTTACCAGCTGTTGTCAGAATGCCTGAGGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved