Equus_caballus Locus Mono:46:SNORD93
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:46:SNORD93
Equus_caballus
Mono:46:SNORD93
4
SNORD93
1001..1074
2074
ATTCTCCGAATTTAGTAAAATTTTTAAAAATCTAAAGTGAGTGAATGAAGGAATCATTG
TAGCTGTCATAGGTACCACATATTGCGGGGTTTACGTGTTCTCAGGTTGTGAAAGACCCT
TTTACTGATTAGGAAACCAAATAGGCTATCAATTTCATCATACTTTATAGAGGAAAATGT
AGTGTTGCAGGCTGTGTTCTAGGCACCCTTTTCCCAGCCATATATATGGGCCCAAAGCAC
ATGGACGCTTTTCTCTGGCCCCAATACCTCCATCTGATCAATAGCACTGCAACACAGAAA
TGCCCGCTCTGTTTCACGATCGCTTTAGGTGTTGGGGATTCCCGTGGAGCCAAACTAAAC
AATTCTATCCGAGAGAGCCAGGCAGCTGACAGGGAAGCAGCTTGAGCCAGGATCTATTTG
AGGATTATGGAAACTGAGCAAGTGCTGAGGACAGTTCTCAACTTCTGGGCTCGGCCTCTG
GGTAAACAAGTTTCAGGCTTCCTTTGGTTTTTAACTGTTAAAGGTTTGTTTCAGTTCTTC
CTAGGTAAATAATGTTGCCAGAGTTTTGTTTTCTCTAACATTGATGCTATTCCATGTTTA
ATGTAACAAAGAAACAAAGTTGGAAAGATTGTGACTGCTGACATTCTAGTAAATGGATTC
CCAGAATGTAGAAATTTAATTCACTATACATTTTACTCCTGGCTGGAAATTACAGGTGAT
TTCCCAGTGTCAGGAAATTTGGAGAATGTAGCTTTTTTACAGGAATTCTATTCAAAGGTA
GCTTTTTATGCATTCATCAAAGGTAGCTAGTAGATAGGCACAATAAAAACCACTCCTTAC
ACACAAAAAAAAGCAACATAAAAAATCACATAATATCCTTAACATTGTTCTTTTCCCTTA
TCTGCCAGGTTCAGTGCAGTTACAAGATGCTGATGAAATTAAGGTATGGACCAAATGGAA
AGAATTTGGCTTGAGTTATTAAGTAGTTGAACTGAAAGTCTTGGCCAAGGATGAGAACTC
TAATCTGATTGGATATGCTTCTGCTCTGATGGGTTAAAGGATTTACCTGAGGCCAACTTG
ATAGGAAGACGTTTATTAAATGCAGTCACGTGTCGTTCCCCCCCCCCCCCACAACCACCC
CCCATGTTTTAAATTTAAAAAAAGGAAAAAGGGGCTGGCCCCGGGGCCAAGTGGTTAAGT
TCGTGCCCTCTGCTTCAGCGGCCCAGGGTTTCGCTGGTTCGGCTCCTGGGCGCTGACATG
GCACTACTTGTCAGGCCATGCTGAGGCAGCGTCCCACATGCCACAGCTAGAAGGCTGCAC
AACTAAAAGTATACAACTATGTACTAGGGGGATGGAGGGAGAAAAAGCAGGGGGGAAAAA
GAAGATTGGCAACAGTTGTTAGCTCACGTGCCACTCTTTAAAAAAAAAAAAGCTTCCAGC
AAATAGGTAATATTTTATTATGCCAAGGAAAAGGTTATTTTAAAAAGATGGATTTTTAAG
TGATTTGACATTTACTATTTCAAAATGTTTATCTTTTCCTCTGGTGGCTATTTTGGTAAA
TTAAAGTCTTTTGAGAAGCTTTGAGGAGTTTGAGTCTTATGGAAAGCTGAGGTAAATTGT
TAGCATTACAAAGTTAGGATTTTGAGTAAAAAAATTGTTTTTCATTAGGAACGTTACTGT
ATCTGAGTTGACAATGTGTATTAGTACATTGGGGAATTCTGTTTACATGTCTACAGAACT
TTTCTAACACGTGGTCTAGAAACCACTGTGTTTCTCTTAATAGTATATCTTTTATTTAGT
AATTTCTGATCTAATTACATCTGTGATACTTCTTTTACAGGGCTGGTGCTTGAGAGGCAG
AATTGTGGTGCTCGAAAGAAGCTTTTCAAGTAAAGTATTTGAACATGTGGCGATTGGTAT
ATACAGAATAGAGGGGGTTTTTTGTTCCTTTCATGGCTGTAGTGGGGGTGAATGTTGAGA
AGGGACGTGGCAAGTGTCTGTAGGAATATACATCTGCCCCATAGAGAATTTCCAGAGAAT
TCAATTCCATTATTTAAAGTAGTTTTTCTATCAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved