Equus_caballus Locus Mono:90:SNORA11
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:90:SNORA11
Equus_caballus
Mono:90:SNORA11
Un0019
SNORA11
1001..1130
2130
ACAAGAGGAGGCCCCAGGATTGCAACTGCCTGGTGGTCTGGCGCGGGGCAGCCACGTCC
TGGATTTGGTAGAGGGCAAAGGGTCTCACCAGGGTGCTTGTGGAAACGGTCCTGAACTCT
CAGCCACCTCTCTGTTCCATGTCCCCTCTCTGTCCCCAGATGAGAGCTAAGAGAAACCAT
CCGAATTAGGGGCTCCATCAAACCCCTACCTAGGCCATCACTGATGAGCAGGCATCTGGC
CCCTGCTGCATGCCCAGGCCTCCATGGGGATGCCCCATAGGCTGTGAAGCTCTCAACCCT
GCTAGGGAGTACTCCTGCCCAAATCCGGGCACCGCCACCGTCGCTAGTCATGCATTCTTT
TCCTTGCCCTCAGGGTGAGGCACCCATTCCTTGGCGATCTGCGGAAGCTCATCACAGATG
ACTTCGTGAAGCAGAAGTGAGTATTGACTGAGTGAACTTTCTCTCACACTCGTGCATTGC
TCATGTGCTGGGCTGGCTGAGGAAGCCCTTGCCCATCCCATATCTAACACTAGAGGGATG
AGGGTCTGTGGTGTGAGTGTGGGTTGGCGGTATTGTGAGTGTTGGGGGGAGTAGAATTTC
GGGGAGTCTTGGGGAAAGGGAGCACACGTTGACTGAGCACGCGGTGTGGGCTATGTTGTA
GCCACCGTCTCGTCCGGCACCTGCCCTGTAGGCTGTGTGAGAATTTCCCCTGCTTTTTTA
CATCTCAGGAACCCGGGGCTCAGATAGTGGAAGCCTGAGCATGGCCCTGGCTGGTAAGGG
GCCCACTCTCTGGTCCCTGGAGGACGCGTGTGCACTCACACGGGTGCACCAGCGCATGTG
TATGCACACATGCACGCGTGCGTGCGCGCGCGCACGCACACACACGGTCGGGAGTAGGCA
CGGAGAACGCTGCTCTTGGATGACTGTGTCTTCCCTTCACAGTCGTTGTCTATGGTGGAC
TGTCCCAGGACTCAGCCAGGCCATGGCCAAGACCCTGTGGTGGGGTGTGCTCAGAGCAGG
GGACCTGAAGAAACAGCTCCTCTGTTTACAACACACCCAACAGGCATCTGGGTTCATTGT
GACAAGGGGCACAAAACTTGTGGCCTTCCTATGAGCAAATACCCTACACGGGGGCCCCCC
TGCACCTCCACGTGGCCGCTGGGCAGGACCAATGGCCTAAGGCTGTGAAGGCCTCAATAT
TGGAGGCAGAAACCCTGAGGGGGGAGGCGAGCATGGGAGTGGGGCATGGGCTGGAGGGCC
GGAGCAGTCCCCCTGCAGGAGCTGAGCTGCAGCGCCGGGCTGGGAAGGGGCCACCTGGGA
GCCAGTAGTGCAAGAACAGGTCTGCCTGGCCGGAAGCCAAAGTTTATTTTCCTCTTGCAC
TAAGGTACCTGGAATACAAGAAGATCCCCAATAGCAGCCCACCTGAGTATGAATTCCTGT
GGGGCCTGCGAGCCCGGCACGAGACCAGCAAGATGAGGGTGCTGAGATTCATCGCCCAGG
TGACGGAGAGGCTCTGTTCAGGGCCGGGCACTGGGGTTGGCACTTCCCAGACCTTGTTTG
TTTCTTGGTCACGACCTTCTTAGGCCGTTTGTCCAGTGAGGATACTGAAGCTCAGAAAGG
TTGTCTAAGTCACTTACACAAGTTCACAGACGTAGTATGTGTGAGGGATGGGGCGAAATC
CCAGGTCTGGCCCAGAATGATAGGAGCCCGATTCCAGGCCTCTTGATTTTTGTCATGATT
ACGCAAAGCCTTGCACGGGAGGGTCTGTGGCAGGAAGCAGGTGCTCAGTGAACGTAGGGT
GGCTGTTAGGATGGTTGCTGTTATTCCATCGCAGAATCAGAACCGAGACCCCCGGGAGTG
GAAGGCTCATTTCTTGGAGGCTGTGGATGATGCTTTCAAGACGATGGATGTGGATATGGC
CGAGGAGCACGCCAGGGCCCAGATGAGGGCCCAGATGAACATCGGAGATGAAGCTCTGAT
TGGACGATGGAGCTGGGACGACATACAGGTGGAGCTCCTGACCTGGGATGAGGACGGAGA
TTTTGGAGACGCCTGGGCCAGGATCCCCTTTGCTTTCTGGGCCAGATACCATCAGTACAT
TCTGAATAGCAACCGTGCCAACAGGAGAGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved