Equus_caballus Locus Mono:93:SNORA18
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:93:SNORA18
Equus_caballus
Mono:93:SNORA18
Un0041
SNORA18
1001..1130
2130
TGTTGTTTATTTGGAACTGGTATCTCTATTTATAAATTACTTAACTATATTAAGATTAC
TAGTTTTATATTAATTTTCTTGTACCAGGAGCTTTAGAATTTCTTTAGCTTGAGAAAATG
ATCATCTACTTCTCCATGTGGGAAAGTAAAACTGTGAATTCCACAATAAACTCTAGTGAC
AGATTTTCAGATTCTATGAATTTCAAGGCTACTTCATCTCAAGGATGTATTATTGATCAC
AGCTGCTGGAGTTTGATTCTGATCTTGTAAGCTTTGCAAAATAGTCAATTCCAGTTGGCA
TAGTTTTAGTTGATGTCTTCTTCTATTTCAAGGCATAGTAATTATGAAAAGGGGCGTATA
TTGGATCCAATTTAGGTGCCTCCCCAGATACACTCTATGTATTATATCTTATGGACATAC
TTTTAACACAGAGCTTTCATGCCCACTGTTTCCACATCTCCTGCCCACAGAGATTATGGT
CTAATTTTTGTCCAGGGTTTTATAATAAAAATGATAGAACTGTAAAGATGACTGAATATG
CAACCTCACCAGGAATTTTTTGTTGAAGTCAGTATTCTGATAAGAAAAGAGTGGGAGTCT
GAGATCTAGACAGACATAATTGTGCAGGGCAGGGTGAAAACCATGAAATCACAAATTATC
TTGCATTCTCCTGATTATCGTAAGTAGCCTCCTCTCCCTTGAAAGAAAGGAAGGAACAGT
TTTACTTAGCCTAGACACCACGCCATTACCTTATTTGAAGAAGTTGTCATGCAATGGTAT
TTGCTTTCCTCGTGGGCTTCCTCCTACACCCCTTATTGCTTCCAACCAGCTAACGAGGGG
AAAGCTTCAAGAAAGTCTAAGCACCAATGTACATTCTTGCTCTAGGATAAAATGAAATGC
ATGAGAAAATTGCAGGACTTTGCTGCTAAGTACAAGTGTGAACCATGGGAGCACTTCATT
ATGGGAGATGTTAACACAGAATGGCAAAATATAAATCTTGGATTGAGGTCTATCCAATGG
GGCTTTTTCTGTAGACTCACATTATTGGAAATGTCTCGTCAAGTAACTATGTGGTTTGCT
TTACTCACAGAACTATCTGTTAGATCTGTGGGAAAGAACTACAATACAGAGTTCCCAAAA
GTATAAAAGACCCAACAGTTGACTTTTTTTAATCTTAGGTATTGACAGTATCTTAAATAT
CTGTACTATTCTTTGGTGTGGAAGCTTAGGAGTGAATATGATTTGAACTTAATTCATATT
TAGAAGACCCTAAAGTAAATTTCTTGAAGAAATTAATTCCCAAAGTTTCTAGCTGGGACA
TTTTTGAAGTGTGTCATCAGTATATCCATATTCAAGTGGAGATAAAATAAACTCAACTAA
AAAATTGTGGGCTGACTAACATGACACCTGTGGATTAAACATGGGTTATATTTATTTGTT
TATTTATTTTTGTCTTTTTACCATTCTTTGAAATGTTTATTACAAGTATTCTTAAAGACT
TCTCTACATCCATTACGGAATGGTAAAACTTCCATTCGCTGATATAACACTGTTCTCAGT
GCATTTTTTAAATTCTTTCTTTTCTAAAGGAATCATATTATAATATATAAATACACCAAC
TTAACATATGCACCTTAAATTAACACCACGTTATATATCAGATATATTTCATCTAAAAAA
AAAGCACAGGCTCTTTGTAAAAGGGCAGTCGTGTAGATGAATCTTGACTCAAATTTTGGA
GGAACTAAAGTAAGCTTGATGGGCTGTGGAAGGAATCATATGTAAAATTCCCTAAATAAA
AATGTATTGACTTTAACCAGCCAGAAGAAATGATGAAATTCGGCCATTTGTGACAACATG
GATGGACCTTGAGGGTATTATGCTGAGTGAAATAAGTCAGAGGGAGAAAGTAAAATTCCA
TATGATCCCACTCATAAGTAGAAGATAAAAACAATGACAAACAAACACATAGCATTGGAG
ATTCGATTGGGGGTTACCATGGGGGAAAGATGGGGAGGACAAAAGGGGTAATTAGGCTCA
CATGTGAGGGGATGGAATATGATTACTTTTCAGGTGGTGAACATGATGTAATCTACACAG
AATTTGAAATATATTATGATGTACATCCACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved