Equus_caballus Locus Mono:23:SNORD55
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:23:SNORD55
Equus_caballus
Mono:23:SNORD55
2
SNORD55
1001..1080
2080
GTTGTGACACAGGCTCTACAGCCCACAAAGCCTAAAGTATTTACTTAACCCTTTACAAG
AAAAGTTTGCTTTATACCCTCTCCCTAGGTTCCTTCATTCTGGTAACTTTAATTACCATT
TGTATACCAACGGTTCCCAAAGTAACGTCTTCTCTGTCCAGATCTCTTCTAGAAGGATAA
CCAGACATGAACGTCCAGCTGCTGGCCATTCCCACTTACATGAGTCACCAAATCTCAAAA
AGAACATGTTCAGAACAGCTCCTACCTTAGCCTACCCCATCTCAGTAAATGGCATCAATA
TTCATCCAACTGATCAAGAGAGGAATTAGGAATCTTTGACACACCTGCCTCTCCCTAAAC
CCCCACGTCCACACTATCACCGAACCCTTAAACCAAAACCCAAGTCCCGCACTGGTTTAC
GTCCCCGCTGCCTTCCACCCTTTCCAGCGCGCCCGCAGCTCTCATCCTGGACGACAGCAA
GAGCTTCTAAAACAAGGCTTTTCAAAGCGTAAAGAAGGCCAGGCTGCCCCCTCGGCTGCA
TCCCACGGCTGTGCAGCTCAGCCGACAGCCGCCGACCCCGCGGGACTCGCCCTCCCAGCG
CCTCCCCAGGGCTCCGGCGCTCAGAGGACGCCCCGGCCCCGCGGGCCCCGAACGCCACCG
CAGAAACTTAAGTGAGGCGCCCGGAAATACGTCAAGGGGGCGGGACGGCCGTTTACAAAC
CGGGCCGTGACGCGCTGCGTTTTCTCTTTCCAGCCGGCGCCGAGCGATGGGTGAGTGGCG
CTCTGCGCGGGGCGCGGGGGAGCGAGGCGAGCTCCATCCGCGGGCATCCGGCCTCGCGGG
CAAGCTAGGAGTGCGGGCGCCCCGAGCCCCCGGCTGCCTGCAGCCCCGAGGCGGGCGGGG
CTCGGGTTTTGGCCCCGAGGCCCGCTCCGGAGGGTGCCGGGGCTGCGGCGGCCCGCGGCC
CCAACATGGCTGCCGCGGGAAAGGGTCCGGGCCGGGCCGCACGTGGATGATGACACCTTA
GTGATGCTGTGGACTGCCGAGTGCGCAGTGGGGACGCCAACCTTGGAGAGCTGAGCGTGC
GGCCTGCCCGGCGCGGGGGTCGGGGGCTGGCTAGGCGACCGCCCCGGGTCCTGGTGGCTC
AAACGTCCGCCCCCGCTCCCACATACAGGCATCTCTCGGGACAACTGGCACAAGCGCCGC
AAGACCGGGGGCAAGAGAAAGCCCTACCACAAGAAGCGGAAGTATGAGCTGGGCCGGCCC
GCGGCCAACACGAAGGTGCGTGCAGGGCCTCTGCCCGGGGGCGACCCCTGCTCTGCGTGT
GGTCTCTGCGTCTTTGTCGGCTCTGTGACTTGTTATGGGGACTGGGTGGCCTCCTCACTT
GGACTTTTTGGGGTTCTCCTAAAGAGACTGCACGGAGACGTGCTGTGTCCGAGGACCCGA
AGGGCGCCTGCAGGACGCGGCTGCTCACGTGAGAGTCAGAAGCCTCTTGCATGGAGACTT
AATTCGCAGTGTCTGGAATCGGGTTTTTCTCTGTCGGAGGTGACTAGAGTGATGAAAAAG
TATCCTTAGGTGTGGTTGTGGCCGTCTTGGTCACCTCTGTGCCACTTGCCAATGCTAGGA
CTTGTCATAGTTACACTGACTGTCGCCTCCCGCCGGCCCAGGTTCCTTTCCCTCTCGTCC
TGCTCTCCTGGGTCACCGAGCTCCTGTCTCCTTGTGTTTTCCAGATTGGCCCCCGCCGCA
TACACACAGTCCGCGTGCGGGGAGGCAACAAGAAGTACCGGGCCTTGAGGTTGGACGTGG
GGAACTTCTCCTGGGGCTCCGAGTGTGAGTGAGGCTCTGCGGGAGTGGGTGGGAATTCAG
CGCCTAAACCTTTCTAAGCTTCAGTGAGCGCTTTTAGCAGGAAGTCCATGGTCCTCCAGC
AAGATATTGAAGTGTCTCCTTGTTGAAAGACCTTGAGGTTGTGGTCGCTGGAGAGTTCTC
TCCATCCTGTCCTGTCTCTGAACTCCTACAGGGATTGGGGTTGAATCTAGAGACTATGTT
TGTGTGGTCGCCAGCCACCTCTGGAAAGATGGGTTTGTGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved