Equus_caballus Locus Mono:74:SNORA70
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:74:SNORA70
Equus_caballus
Mono:74:SNORA70
15
SNORA70
1001..1135
2135
ATGAAATTTTTAGAAATAATGTGAGGAAATGGTTATTGAATGGAAGAAAATTTAAAATA
ATGAGGGAGTGGGGGGGCCTGTTTTGGTCACATAGGGCAATACTACTAAGAATTCTAGGG
GAAATAGAAACCTTTGCTCATAAGCAGGTATGTAGTATTTTCTTCTATAACAAACTGGGA
AATCTTTTGGAAAATCTTTGAAGCTTCCAGGAGAGCCAAACTCATCCCTGCCATGTCTGC
TCCGTCGTTAAATATAGAATCTGAGATCCCAGAGTGACTGGTCTGGTATCTTTTATGAGC
ACAGCTTGTACACAAAATGGTCTTCTGTGTTCATTTTTAATGTGGTCAAGTGAATATACT
TTGGAATGTAAATTTATTTTCTTAGCTTTTTTCTTTTTTTTACTAACAATTTTACAGAAA
AGAAAAATCATACACATAAAACAACTTGCTACAGTTTTTTGGATCTTTCTTCAATCCTTA
TCAGTGTACATATGTAAGATTTATGAGTTCCTTATGGGATTGGCTGTGATCACATATTCC
ACTCATCCCTGTTCACAGCACCCTTTGCAATGTGACCTAGATGTTCCTCTCATCAAGACA
CGGAGTCTATTGCCTCTCCTCTTGAATCTCTGCTGGCCTTGTGACTGGCTTTGACCAAGA
GATTGCAGTTTCTGCTCTTTCCCTCTTGCGATGCTGCCACCATCATGTGAAGAAGCTGGA
CCTAGCTTCCTTGCTGTGAGAGACCACGTAGAGAGAGAAAGGTGTACTCTTCACCCCGCA
CCAAACTCCAGACATGTGATTGACGCCATCTGAGACCATCCAGCCCCAGTCAAGCTGTCA
GCTGCCTGCAATCACATGAGTGACCCCAGGCTGGGCCAGCCACAACACTATGCAGCTGCA
CCCAGCCCAAATTGTTAACCCACAGAACTGTGAGCAAATAAAATGATTGTTGTTTTAAGC
CACTAAGTTTTAGGTAGTTTGCATGCATAATAGATTGCTGTCTGCAGCCAATTAAGCCGA
CCATGTCCTTTTCCCCATGGAGGCCAGATGTGCAGTGGCTGCAAACAGCAGCCTCCTTGG
TAGTGTATGCAGCCTGTTGCTTGTATGGGTTGCCCTAAGGGACCTTGGAGACAGCCTTTT
CCAGTAGACATTTCGTGTCAGATGCCATGCCCAGTGTAGGCTCCAAACCGGTATGCGAGG
TGCCTTTGTAAAGCCCCAGGGCACAGTGGCTAGGGTCCACATTGGCCAAGTCATCATGTC
CATCTGCACCAAGCTGCAGAACAAGGAGCATATGATTGAAGCCCTATGCAGGGCCGGGTT
CAAGTTCCCCGGCCGCCAGAAGATCCACATCTCCAACACGTGGGGCTTTACTAAGTTTAA
TGCAGATGGATTTGAAGACATGCTGGCTCACAAGCGGCTCATCCCAGATGGCTGTGGAGT
TAAATACATCACTAATCGTGGCCCCCTGGACAAATGGCGAGCCCTGCACTCATGAGAGCC
TCGGCACTGCCCTCTTCTTACTCACGCCCATTAAGAAATCCTACTTACTATCAAAAATAA
AAAAAATAGTAGATTTCTGATATAACTGGGTACGTGAAATTTGCATTCTAATTTTGGAAT
TATTATTATCTTGGATATAATTTGTCACGTATTTGGATAAATTGCAAGTTAACGGTTTAA
AATGACTATATGTAGTTCTATTGCATTACTTTACCATAGTTTACTTAAACTTTTCCCAAT
AACTGGACATTTGGTTTGTGAAAAATTTTTCATTTTTATGTACAATATTGTTCAAAACCT
CTTTGCACAAGTGGTTTCTAAAATTTTTCCCTGTTATTTTCCTAGGGAATTTTCTCACCA
AAAACGGAATCAGTGCGTGAAAGAATGTCAAGTGTTAACTCTCGTTACATATTGCCCGAC
TGCTTTCCAAAAGATTATCAATTTACAGTGAAGCCAGCAGTATACTTATCTCCCCATACT
CATTTAGCAAATGTTCTAAATATTTAGCAATTTTTAAATTAAAGTGTAACATATATATAG
CAAAGTATGCAAGTCTTAACTATATATCTATTAATATTTATAGACAGAGAGAGAAAGAAA
GAGATAGAGAGAGAGACAGCTAGACAGATTCCGTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved