Equus_caballus Locus Mono:47:SNORD113
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:47:SNORD113
Equus_caballus
Mono:47:SNORD113
4
SNORD113
1001..1074
2074
GCAGAGACTGACAGGCATCCTGGCAAGGCCTAAACCTTCCCTTAGCTGCTTCTGAGTCT
CTGCCATCGTCCTGAGCACTGCTAAGTTTTATGTTATAAGGGTATAATTTTACCTAGGAG
AACCTTTTTAGGAGCTGTTGGGTGCACAACTGCATGAATATGCTGAACACCACTGAACTG
TATGTTTTAAAACAGTGGATTTTATGGTACATGAATTATATCTCAACTTTTAAAAAAGCA
AGACCTACTTGAATCATATCTAATGTAACTTCTAAGGCTTTAAAAGAAATACTGGCTGTG
GCTGTTGAAAGGACCCTGCCCTCACCCAAGCGTCAAAGCCCCCTCTGGTTAAGATTGAAC
ACAAGAATTTGGGGAAGGTTGTTTTTGATCTGGACTTTGGTCTTTTAACTCACAAAGACA
CGGAACTTTAGTTTTGGATTTTAATTGTAGTGGTCTTTAACATTTTGGATTTTTATTTGC
AAGATTTAATTTGTGAACCTTGATTTCTCTCTGTAAATTTAATTATGGGAGGGGATGGTA
TTTAAATTTGGGTGTCTCTAAGTTGTTGGCGTTTTATTGTCTAAACTTCTTTTGGCTTTG
TTGACTTCTACTCAGACTTTAAGAGTAGGTTCTACCACTTCTCAATGCTTCTGCATGACA
GATCATGGAGACCTCAGGGTGCTTTTCCATAATACTGTCTTGAATAGCTGCTCCCTTCTA
AAGAGAATAGCCCCAAACAGTTCATGCTGTGCAAAGTTCTGGTTTCCAGGGAAACAAATC
CTGTTACACTGTTGGACCAGAAACTAGAGTCTGGGCCGTCACTACCACCACGAGCGCCAC
CATCATCTGAATAGCTTTTATTTTTTAATTCTATAAACTGATGTTAGGGATATTCAAGGA
TCTGGTTCTTGAGTTTTTGTGAACATGTGTTTTATTATCAATGAATTAATGATTTAATCA
ATACAAATGTAGAAACAAATGAAGAAAAAGACACTCAAATACAGACCAATGGTGAAGACT
CGTGACATAGGAGTCATGGATGATGAAAGTACATGTCTGAAACTCTGAGGTCCAGCATGA
AGTATTAGTCTTAGTATTAGCAAGGAATTAATCTATTCCTTCTATTGAAACTTTCTACAG
AGAGACGCTAGGAGTATTCAAAGATCATATTCTTGTATTGATTTTATAAATATAGATTTG
TTATGAATTGAATAATGATAGAACCATTAAACTAATATAAATATATAAAGAAGAACAGAC
TGAAGCATTGTTTATGAACATGTGTGGTGAGGCAAAAATGTATTTTTGATAAGCATTGAA
AACAGTGGTGCCCATTAAGAAATAAGTGGGTAAAGGTCTCACCTCTTCAACTAAGGTTAT
GGAGATTCTAAGGAAGAGTCAATTTTATTGTTTTGTGGCAGTCTCAAGACAGAATTGTTC
CTTTTGGGAAGATAAAATTGTATATATTAAGGAAAAATAATAAATGCCTAAATACTGAGT
CAAAGAAGCGTAGAAAGCCAGGATTAATGCTGATTAGGTGATTCTCTGAATATCTTGAGA
ATTTGGTTGGCATGGTCAGTCGACCCTGAGTGCAGTGATGAAACTGGACTCTGGCTGTTA
ACAGGGAAGCTGGGAGGCAGAAACTCAGGGAGCTCCAGCATGGTCCTGCTGCTCTGTGAG
TCTCACTCGTTGACATCTCTAAGTGGTGGAGCTGGCACTTGATCTCAGGTCAGCCTGATG
TCCAAATCCATGCTCTGTCTACTCCAGTCATAAGGAGTGTGAGGTCAGTGGGCATGAGGC
TGGAGCAGAGCATGGCCAGGAAACAGACTTAATCTACTTTATCCAAGGTTGACCCTGGCA
GAATCTTTGGTGGTTAAACATTTCACTCCTGAATTTAAGAAGGAAAACCATGCATTATAT
CAGCTGGCCACCAGAGGGCACTGTGGAACAGGCAGCTAGTTGCTGAAGCCAAGGCTGTTT
AGTTTTCCCTAGATCCTGCTTCAAACTCAGATTCTGGTCTTCCCGTCTGCTGCGCTTACT
ATTGGGTCACACCACAAGGCCAGCTAAAGGTTTGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved