Equus_caballus Locus Mono:63:SNORA25
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:63:SNORA25
Equus_caballus
Mono:63:SNORA25
1
SNORA25
1001..1118
2118
CATCTTTCTCTATTTTGTATATGGAATGCCACTACAGCATGGCTTGATGAGTGGTGCTA
GGTCTGCACCCGGAATTCATACCTGTGAACCCTGGGCCACCAAAGCAGAGTGCGTGAACT
TAATCATTATGCCACTGGGCCAGCCCCTCAAATGGTTTGCATTTTTGATTGATATGAAGA
AGTATCCAAAAGAAATTCAACTCCAAATTGTTTCCTTCAGAGACTCCTTGGTCAAGGCAA
AGGAAAAATGTGAAACACTTAAAACTATTTTTCTTTTAGATCTTCCACAACTCGAACCTT
GAAACAAATGGCGCTTGCCTTCATCTTCCTCTTGCCCCATCCTATGCCCTTCCATTTGCC
TCTGCTTCTCTCTTCTTCACCCACTCCACTTCTCTCCTGGCTGGCCAGAAACCCTCTAAG
CTCAATTATACCTTAAAGTTAAACACCATTCAGAACAGGGAAACCCTCTGGCTTTTATCA
ATCTGAGCTGAGAGCCATTGAAAAAAGACTTTCTTCGAAAAACAAGAAAAATCATAAATA
AACAAGCTTACACTAAACCTAAACAAACTAGAAAAAGAAGAACAAATAAATCCCAAAGTT
GGTAGAAGGAAGGAAATAATAAAAACCAGAGCAGAAATAAATGAAATAGACTAAGAAAAC
AGTAGAAAGGATTAATGAGACAAAGAGCTGGTTCTTTGAGAAGATAAAGAAAATTGACAA
ATCCTTGGCCAGACTCACCGAGAAAAAAGATGGAAGACTGAAATAAATAAAATCAGAAAT
GAAAGAGGACACCACAGAATTACAACAGACACCACAGAAATACAAAAGGTTATAAGAGAA
TACTATGAAAAGCTATACACCAACAAACTTGATAACCTAGAAAAAATGGATAAATTATTA
GAATTATACAACATCCCAAAACTGAATCAAGAAGAAAGAGAGAATCTGAATAGACCAATC
ACAAGCAGAGAGATTGAAACAGTAATCAAAAACCTCCCCATAGGTCATTTCGAAGAGGGC
TTGTGAACCAGGAGTTCTTAATGCTGTGATCAAAGACTGAAGTTCTCTATTGGTTGTAAT
AGTCACTCAAAAGTGCTGTTTTCCTGAGAAGATATAAAATTTAGCCACTTATACCCATGA
GTGAGTGAGTGATGTGGGGAAGTAAATAAAATGTTGCTCAAGTTTAAAAAACAAAACCAA
AAAACCTCCCCCAAAACAAAAGTCCAAGACCAGATGGCTTCTCTGGTGAATTTTACCAAA
CATTCAAAGCAAACCTAATTTCTATTCTTCTCAAATTATTCTGAAAAATTTAAGAGGACA
GGGCACTTCCTAACTCATTTTATGAGGGCAACACTACCCTGATACCCAAACCAGACAAGG
ACAATACGAAAAAGAGAAATTACAGGCCAATATAGCTGATGACCATAGGTGCAAAAATCC
TCAACAAAATATTAGCACATTAAATACAACAATACATTAACAGGCTCATACACCATGATC
AAGTGGGATTTATTCCAGGGATGCAGGGATGGTTTGACATCCGCAGATCAATCAATGTGA
TACATCACATTAACAAAACGAGGAATAAAAACCACTTGATCATCTCAATAGATCAAGAGA
AAGCATTTGACAAGATCCAACAGCCATTTATGATAAAAACTCTCAATAAAATTGGTATAG
AAGGAAAGTATCTCAACATAATAAAGGCCATATATGACAAACCCACAGCCAACCTCATAC
TCATTGGTGAAAAACTGACAGCCATTCCTCTGAAAGCAGGAACAAGACAAGGGTGCCCAC
TCTTGCCACTCTTATTCAACATAGTGCTGGAAGTTTTAGCCAGAGCAATTAGGGAAGAAA
AAGATATAAAAGTGATCTAAATTGGAAAGGAAGAAGTAAAACTCTCACTGTTTGTGGATG
ACATGATTCTATATGTGGAAAACCCTAAAGAATCTACCAGAAAACTATTAGACGTAATCG
ACAGCTACAGAAAGGTACAGAATACAAAATCAACATACAAAATCAGTTGCATTTCTATAT
ATTACTAACAAACTAGCAGAAAGAGAAATCAAAACTACAATCCTATTTACAATCACAACA
AAAAGAACGAAATACCTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved