Equus_caballus Locus Mono:40:SNORA42
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:40:SNORA42
Equus_caballus
Mono:40:SNORA42
21
SNORA42
1001..1131
2131
GTGACCTGTGCTTAACAAATAATCCAAAAAGCCTTGCTCAAGAGACATTTAATCATGGA
ATCTTTTTTATTCCTATGGCATTATTCAAATCTGAGCTAAAAGTACACCTTGAATGATTC
ACTGACAACTACAAAGAACATGACTCTGGATTTACACAGAGATGAGTAAGACACGTGGAA
TATGAGCAGATACAGAAACACATATGCACACAGCAGGATGTTGGGAAGGAGGCCTGGGGG
AGGCTGGAAGACAAGCAAGGCAGTCAGCACCAGACTGACATTCTGAAGAACTACGGAGGA
AGGGGGAGCTGCGAAGTGAAAGCCCCTCGTCAGGGGGCTGCATATGGCCCTGGGTCTTGG
TTCCCTTCGCCAGAAAGTTGGGTCAGTGTAGAGCTGCCTAAAAATATCAGGCTGCTGAAC
GCTTTCTGGCTCTAAGGCTTCTGTTGCCATAGGAACAGTCACCTTCTATTTTCTGAAAGG
TGGTTAATAATTAGATTTGGGAGAAAGCAAATTCTATTTCAAACTTGAATTCAGCTCACT
CTTGTCTCTGATACTGCCATCCTGGGTGTTATTACTGAAAATTCAGAATATCTTGGGGAC
TAATATCCGGGAAAAAATACTAGGTCTATAGATTCCAAGAATCTAAACAGACCCCATGGT
GTAGGTCTATGAAGTATGACTATAAAATCGTGATGCACATGTTTGAGTATGAGTGTGCCT
TTCAGCAAACAAACCAGAACTCGCATATAGAAATCCACGCCCTGTCCTGTATAGTAAAAA
GGGGGTATATGCTTAGTCCAACAATGCTATCAGTGTTTGAACTTTTCTAGAACTCCTCTC
TTGATAGTATCTTCAGAACTGGTTTAAAAGCCCCACTGGGAAATCTATATCCTAACTTTA
TAGACATAGCTCATACAGTAAATACATAATTTTATGTCAATGTCAAAGGCCACTGGGATT
GCAGAGTGATAAAGAATGAACTATTCTTGTTTAAACTACTAGCAGAAGCAACAAACCGTC
CTCTAAAAATTATGTCTATCTCATAGTGCCCCATGCCAGAGCAAACTGTGGCCCCAAACC
ATTGCCTGGACTCTGTGCCCTTAGGCTGCAGGCACTGCAGTGGCGGGGGGGGGGGGGGGG
GGGGGGGGGGGGTGTGAATTTCACCTACACACATCCATCAGGATGGCTATTATCAAAACA
AAAACCAGAATAAAAGTGTTGGCAAAAATGTGGAGAAACTGGAACCCTCACACATTGCTG
GCAGAAATGTAAGCTGGTGCAGCTCCTATGGAAGACAGTATGGTGGTTCTTCAATAAATT
AAACATATAATTACTATATGATCCAGCAATTCCACTTCTAGGCATATATACAAAAATTTG
AAAGCAGGGGCTTAAACAGATATTTGTACACCAAAGTTCACAGAGGCATTATTCATAACA
GCTAAAACATGGAAATAATTCAAGCATCCATTGACAGATAAATGAATAGACAATATGTGG
TATGTACATGCAATGGAGTACTACTCAGCCTTAAGAAGGGACAGAATTCTGAGGCGTGAA
TGAACCTTGAAGACATTATGCTAAGTGAAATAAGCCAGACACAAAAGGACAAATATTGTA
TGATACCACTTATATGAGGCGCCTGGAATAGTCAGATTTCTAGAGATAGGAGTAAATGGT
AGCTGCTGGAGACCTGGGAGGGGAGGGAATGAGGAGTTATTGTTTAATGAGTACAGAGCT
TCAGACTGGGAAGATGAAAAAGTTCTAGAGATAAATAGTGGTGATGGTTGCACAACAATG
TAAATGTAGTAAATACCACTGAATTGTACACATAAAAATGGGTAAAATGGTAAATTTTAT
GTTATGTACCCTTTATGTCAATAAAAAAATTACATCTATAAAAGCAAAGTCAGGGGCACC
CTATGTGTCTTCAAACCTGCCTGTTTTAGTTGATTTCTCAGCCACACAGCTTGGTACACA
CCGAAGTTCTCCAGGGCCAGTCAAACATTTGAAGTTAAGTTAGTTTTCTTTTCACCCTTG
ACCAGATCCTGGTTTGAATTAAGAGAAAAGTAATTTCAGTAAAAAGACTCAGCCCTAAAT
AGGGTCGCCAGATGTGACAAATAAAAACACAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved