Equus_caballus Locus Poly:20:SNORD22
snOPY snoRNA Orthological Gene Database
Equus_caballus Poly:20:SNORD22
Equus_caballus
Poly:20:SNORD22
12
SNORD26, SNORD27, SNORD28, SNORD22, SNORD29, SNORD30, SNORD31, SNORD22
1001..1076, 1352..1423, 1745..1819, 2186..2312, 2522..2586, 2752..2821, 3081..3149, 3435..3560
4560
ATTCAGCCCGGGGCCCAGTACCTGAGGCGCCCCCCGCGCTGGGAGCCTGAGCATCAGGC
CCGGAGTGCGCGCTGGGCGGCTGGCGCGGCACCGAGTCGACGCCGGTCGAGGGTTCAGGA
GGTTCGGGATCCATGGAAGCGGACCCCGCACACGAGTTTAAGGTGTGTGTGGGCAAGTGG
GGCTCAGGGAAGAGTGTGGGGGACAGGCGGCTGTGACCGAGACAGAGCGTCAGTCCAGGA
TCGGCGCGAAGCCGGGGCCTCAATGCTCCAGCCTCAATGGAAACCGGCGGTAGAGACCCC
CGCTGCAGCGCACTTCCTTAATACGCATGCGCACCTTTTTCGCGCCACAGTTTCTGGGGG
CGGGCACTCCACGCCCGCCTTCTCTACCCACAACTCCCCAGGCCCGAGCTCCCTCTTCTT
ATGCGCGTGCGCCCGCTATAGTCCCGCCCCCAAAATCCCGTGGGCCCCTGCGAGGTGGTA
TTTAAGTGTCTAGCTGTGCACCTTCGGTCTCGTTTTCTTCCTGCTGTACCGGGTGGTATG
TGTTTACTGCTTAGTTAGAAAAGAGGGGAGGAATGCCTGCGTGAGCATGCACGTCTTAGA
CTCCCTCTGTGCTGCCGCCTGTTTGGTTGTGGAGAGGGGAAGAGATCTTGGGCGAGTCTC
GAGCAGCACCTGTCTTTGTAAAAGACAAGAGGGTTTTGACGGACTGTCGCGTCGTCCGTC
TCCATGACAAAGAGCCTTTTCACTGCTCTGTGTTGAGCTCGGTGAGGATAAGAATCTCTG
AGGAGCCGGCCTGTGCCCCAGCCGACTTCCAACGCAGTCGGGATCCGAGGCTTTAGCGAA
AACCCCAGCGCTGTTCTAATGTCGTCTTGTCTGCAGGGTTCAGGCGCCCGATTGAGGGCT
GAAGACTGGATAAGATCCCTCCTGTTGTTAAGAGTAAGTGGTTCCGGTCATCCTTCCCCA
CTGTTCTTCCATTGTTGAGTGTGGATGTCCTGTGGGATGTGCTACGGGGATGATTTCAAG
CACTGAACTCTCTCTTTCTGATGGCTTAGTGGAGAAAACGTAAAAACTCTGAGTAGCACC
CTCCGCAGCAGAGGTTTGGGTTTTTTAGCTCTAAGGTGTTGAGACACTATCATGGGATGG
TAAGATTGTCCCAGGTTAAAACTAAATGAAAATACGTTGTTTTCAGAGGTGGTTCAGCTC
AAAAGAGATTGCGGGTTGGAGGATGGGACAAGACCTACTCCTGTGCGAATCGAGCACCGC
AGTGATGCTCCAGGTGGGTACACGTGGTTTATGTAGCTATGGGTAGGGGCACAATGTCTC
TGTGGGACTTGCTCGTACAATTTGCATTGGCCACTCCATGATGAACGTAAAAAGACAAGC
ATATGACTGACCTCAAAAGTGATGTCATCTTCCTACTGAGAAGTGGGCCAGGAGTACTCA
AGGGTGTTTGAATGGCTACTCTTAGGTACATATAATGCCTTTCTTTTCTCTCCAGCATCT
TCTCACCAATTCTGAGGAATTCAGCTGCCTCCCAGGATGATGAATACAGGTAATTGTTAA
AATGGCAGGTTGGGGTGTCATCTCCTGTGTTCCCCACAAGCAGGTGGGCAGATGGTCAGT
GGAGCAGTGTTGCCTTTTTGCTCCTTCCAGCTTGTTCTTGGAATGATTTTCCTGGGGAGA
GAGAGCAACCCGGCAGCACAGTTGGTTCTTGTGAGGGTGTGCTCTTCCCTCATCCACATG
TCACTGTCAGATGATTTGAATTGATATGCTGATCCTCCGTGAGGTACGACAGTTAATAGC
ATGTTAGAGTTCTGATGGCAGTTTCTGTTAATGGAGAGATTTATTCCATCGTTTATTTTT
TTAATAACCATGTGCTTCCCTTTCACAGGTTGTCCAGATTATAAATTCATCTGTGTTCCG
GTAAGTTCCTTCTCCCAATACTGTGGTAGATTAGCGTATATGTGAACTCGTCCAAGGGAT
AATCTTATCACTGGGTTTCTTTTTTTGTTACCAAAGCTCTGGCTGGCCCGTATAGCTTTT
TGGTTCCTCTTATTCCTTGTAGTGATGTTTCTTGATCTCGTGCCTCTCCTAGATGCCCTG
TGATCTGCCCCAGGTCGACTCCTGTAAAGAGTGGAGAGTGGTGAGTGCTTGTGACCTTGC
TGGTTGTAGCTTGCCCCAGAGTCCAGTGCCAGTGAGGAGAGCAAGCATCCTGTCTTAACC
CCTGTTTAGCCCCAGAGCCAGTAATGGTGAACCCACTGGGGCTAACTGGGAGAGAGGATG
AAAACTTGTTCCATAAGGAACGGTCCGAGGTACAGCAGGTGCCTGTCGAGAGCATTTGCT
TAGCTTTTCTTGGCCCCTCCATTAACTGTAGGTAGAATAAATAGCTTTGGCTGTTGTAGA
TGCTTTGCTAATTACATGATTTTCTCATTCAGGAGCACCTTGTTTGTGTATACTACTGGA
AAGCCTCCAGAATTGAAAGGTTAGTTGATAAATGTCTCTGTCTTGTGCCACCAAGTAGAC
AGTTTCTATGATGAAGCAAACTAGCTCACTATGACTTAGAATGAAAACAAGTGAACACCT
GAGAAACGGGGGAGACAGTGTGGGGTACCATGTGTAAGATGCCTTCACCCACAGCTTTGT
CTTTCCCCAGGTGCTGTTACCAGTAACCTGCTTTTTTGCTCGAAGGTGAGTAATCACCAT
ATGTTGGTGCATGTAGCATACTGGGTTGAAAAAAGCGCCTTTTTAGGCCTGTATATGTGA
TGACTTACATGGAATCTCGTTCGGCTGATAACTTGCTGTTGAGACTCGGAAATCTGATTT
TCTAGGAACAGTGGCTTAGGTGGGAACAACTTTTAATGCAGGAGATAAGCATTACTGATT
CAGTCTCTTTTCTTTCAGGTCCAGCACCTTGTCGGGAGCCCAAGAATGATTTGAGGTAAA
TGCCTTCACAGCACTATCTGGTTGCTATATAAAATTTGCCACAGTTTTTGTGTGTGTGGT
GCTTTGGTCTGGATGGCTCTTCAGACATACTGGCTTAACCCAAAGTCTAGCCGTTCCTGA
ACCACCTGTGACAAATTCCCACTCACCAGTGATGAGTTCAATACCGCCCCAGTCTGATTA
CTGTGACTGAAAGGTATTCTCTGAGCTGTGAGCTTGTCTTGGAGGGGAAAGTGACAACAA
AAAGAAGTGAGTTGAATACAATTTGCAGCCAATAAGAAATTTTTTGGACTAGCTGGTAGT
TTCTGTAAGATGTCTGTTGAAACCTACATAGCTGATATAGTTGTGTCTTTTCTCCAAGCA
GCAGGGCCTCTTGGGGATGCTCACTTAGTTCCCAATCATTCTTTTGCAGCGAAAGCATAT
GCCATATTTCTGCTCAACTCCAGTCTGAAGTTAGAGGTAAGTAAATTTAGATGCAAGGTG
GGCCAAGTTAAAATTTCCCAGTGAAGAAACTTTCACACGTCTTACCTCCTGTCCTAGTCC
CAGAGCCTGTAAAGGTGAACCCACTGGGGCTGGTTGGGGGAAAAGAGGAAAGCTTGTTCC
AGAAGGAACTGTCTGAGGGATCATAAGGATTTCTAAACATTGGGAAAGGAAGAATAAATC
ACTTGCTTAAAAAATCATTTGTATAATTTTTTTCAGGACTGAAGAAAGATCAAAGCGCAT
AAAATGGTAGGTATCTGTTCATATATTGGTGTTTAGTATTTAATAGACTGTGGTAAATTT
ACAAATTCATATAGTGCATATATTCTTTCCCATCCAGTAAGAAAACTCACTTTTTTCTTT
CTACAGGAATCCAGCTCTTGGAGGACATCGGAAAGGGAATTTTCAAGTTGTTTCTTGTAC
AACCTAGCTATTCAAATTGGCATATAGGAACATTTCAGCCTTTCTAAATAAAAAGGGTTT
TTTTAATCGTCACTGATTTGTGTGTTTGAGTGGGTCTAGCTGAGAAGGAATTAACCTTGG
AGAATTTGCTGTTACTTTCTCTACCCACTTTATCCTGGCAGTTTGCCTGATGCTGCTTTG
TCTGGCCCAGGGAAGCATTCAGAAAGCCTCCCTATTAGACCTTGAAGGGTTTTTTTTCAC
CTGTATGTGCTCTGCTGAAGCAGTCCTGCATGAAAAGGTGATGGAGTTTGAGTGATCTTC
CAACTGTGCCTTAAAACGACTTCAGCAGACTTGGGTATAGGCACTAGGAGCCAGTGAGGC
ATGGCAGTTAAGATCCTTTAGACTCAAAATTTGGTGTTTTAATTGTCCCACTTCTGCACA
TGAAGCTCCAACATGGTTTCTGTGAAATCGAACTGCACTTCTTTAAGATCAGGCCTAGAA
CTGAACGTTAGAAGTCCTGTAGCAGTACCCATTTGGGTACCTGGTTTCTCCATGTTTTTC
CCAGTCACTGAGTGTAAAGTGGGCCACTACTGATTGGCCTCTCCTTAATTTCAGCTCTGC
ACTTCAGCCTCACTGAAGCTACTCTTGCATTTCTGTTTCTCTAACAAGCCTCTGAGCCTC
TAGATTTATTCTTCCCTCTCTGGAATTCCCTGGATTCTTCAATGTAGGTGATTCATTGGA
A
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved