Equus_caballus Locus Mono:17:SNORD58
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:17:SNORD58
Equus_caballus
Mono:17:SNORD58
8
SNORD58
1001..1066
2066
CCACATTGTCAAATCTAACGAATGTTGATGAATAAATGTTTCGTCTGTATCTAATAATA
CGTGGTCCTGTCCTAGAACTACAAACTTGTTTTTAATTGATTGATATTTAAAATCTTTAT
TTCCAGATAGAAAAAAAAGGAGAATTTTGAGACGGTCTCTAAGGAGGCAACTCGTTTTCA
GATCTTCTAAAACATATTCCACACTCCCTTTCTCCTTTGCTTTCCTCCTCCCCTCTTCAA
ATCTCGCTCCCCCCACCCCCCCCGGCGGGGAATCTCGCGAGAGGTCGAGTGACCACGAAT
TCTCCCAGAAGCTACCGCTCTTCCTCTTCACGTCTGCGGCCTGAGGTGAGTGTTTCGTAG
CGGTACGTCTCCGAGTGCTCAATCCTCTGATCATCGCCGCCATCCTGGCCTCGGGGGTGC
CCATCTCGAGACCCCTGGGAAGAGGACTCTGGCAACTACTGATTCCTCGCTGAAGGCGGT
GTTCCTCTGCGCGGGGGACGTGTCGGAGCGCCCGACTTGGCGCGCCGTGGGCGTACGGTC
TCTGCTTCCCGCAGAGGGGCGCGATGGACGGGAATGGGGGTGGTGGGGTTTCAGGCGGCC
CGCGGTCGGGACGGCCTCCGACTCCAGAGGTCCAGTGTTTCGCGGTGAGTGGTGGCCGCA
AGGAGAGAAAGTTGCGGAGCGATAGAGTCGAGTCGGATCGAGGCTTCGCTCCTTTGCGCA
GGAGCGTTTCAGACTCGCTGGCGTGGTGGCAGTCTGAAAGTGTGCGGAGGGACAGCGTTG
CTGGGGAGGCCGTGTGAGCCCAGGTGGGGTCTGTAGAGGGCTGTAGTCGAGTTCTTCCGG
GTCGGTTTACGCCTGAAGGATCCCGAGTTGGATGGAAACAGGCTCTGTCTTCTTCGAGGG
TCAGAGGGTGATGAGGTCCTTGTCACCAGTCGGGTGTCAGCGCTGCTGTAGTCACTGGTA
GACGTAAAGGGGATGCAGGCTGTGGATGGAGAGCAGGGCAGCTGCGATGATGGCATTTCT
TAGGACACCTTTGGATTAATCATGAAAACAACTACTCTCTGAGCAGCTGTTGGTAGCATT
TGATACGTGTTTAAACTGTAAGTTACTGTAGATGTGTATTGACAGAATTAACTCTGCTCC
CTTGCAGGTGATCTCCGAAAATGGTTCGCTACTCACTTGACCCGGAAAACCCTACAAAGT
GTAAGTGAACAGGAAAGGGGTGCATGTTTCTTATTTTGGGGTAAGAGAAACCATAAGATG
CCGAAAATTAACGAAAGCTTTGCTCATCTTTTAGCATGCAAATCAAGAGGTTCGAATCTT
CGTGTCCACTTTAAGGTAGGTGCATCATGGTCATGCTCTAAGCGTCTTCCATGTGTCCCA
GTGTGTTTTGACTATTCTGAAAAGGTAGCTGCCGTGATGCTTTCTTAGGACACCTTTGGA
TTTACAGTGAATATTAATCAGTTCTGAGCAGCCACCTTTTTGTCTTTAACCATCAGTTTA
TAATGAGCGCTTTGATGTAGGATTTGTGGAATTGGGTAAAACTACTAGAGAACTACTTGC
GAACCGAGTGTACAGATGAACGTATGCAACAGTAATTGTAAGGATAAGATATGGAGTTTA
AGAGACTACAGTGAATAAACAGGTTTAGGATTTGTTTTTTCATAGCTTCAAACCAAGCCC
CCCTGGTTCTCAATCACAGATCCGTTTTTCTCACTGTATTACCTCACCTCCCAAGAATGG
AAAGGTTTTAGCACTTGATAATATGTGGACATTTTAAACATCTGAGAATTTAATGTTAAA
GTTACTTTAGAAATGGTGATCCTTTGACATAGTTAACGCTCAGTTTATATTATTATATTT
AGAACACTCGTGAAACTGCCCAGGCCATCAAGGGTATGCACATCCGAAAAGCTACCAAGT
ATCTGAAGGATGTCACTTTAAAGAAGCAGTGCGTGCCGTTCCGTCGATACAATGGCGGCG
TTGGTAGGTGTGCCCAGGTGAGAATTCGTGGCTGCCATTTGAAAAGGCAGAGTATAAGGG
AAAGTGATTGAATGGGGTGAGAATGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved