Equus_caballus Locus Mono:83:SNORD60
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:83:SNORD60
Equus_caballus
Mono:83:SNORD60
13
SNORD60
1001..1083
2083
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAACCCGGGCTTTTTTGGCGG
AAGCCTTAGCCCCCAGCCCGCTGTTCAAAAACATTCCGCCGCCGGGGGCCCCCCGAGAAC
CCCCACCCTCCCCCTCTTTTTCCATTTTGTCCCAATGGGCCGCCCGCAGAAAAAGGATAT
AAATCGCCGAACCCAGAAAGACTCAGCCGCCGAAGCCCTCGGGACTTGTAATTTCCCCAA
CGTCGGGGGTTCCCGAGGGCCGGGGGAACCTTCCACTCGGCTATTAGAAACCCCCGCCTT
CGGCGGGCTCCGACTCTCTGGGTGAGATTGGCGGCTTCAGAATCACTCTATGTTGCAGAT
CGAAGTCTGATTGGCTTTGTGCATCCGTCGCTCACGGTTAGGCTCAATAGCCTCTGCAAA
AGGGAGGAGCTTGGGTGTCGGGCCCAGGATACCGCCCCCAAAAGAAATACCATGGTGCGA
TTGGTGGAAACAACAGGGGTAGAGAGCGGAGCGTATCAGCGGTGAGGGGGGCAGGTACTT
CCGCTAGGATTGTCCAATCACAGGGGTTTGGCAGTTGCTATAAAAGTTCGAACCTCGCAG
GTTCTCCTCCTCTCGGATGAAGTACGACGTTGCGGTGTTTTATTGTGCGGCTTCTGTGCT
CCGCGGGCCGGGGGCGGACTTGGGCGCCGAGTGGAACTAAGGGCGTCGGCCAACCCCACA
GGCCGGCCTAGCCTCGAGGTCCAACTTCGGCCTGAGGTTCACCTTGGTCCTCAGCGTTGT
ACACGTTGCCCCCAGTTCCGCCGAGGAAGTCCTAAACGTCCAGACCTACGTCTCTCTAGA
GGTAAGGCTGAGCCGGCCCTGGTTTCCTCGATACAGCTCAAAGCCTGTGATGAATTGCTT
TAGTTTCTGACACCTCGTATGAAAACTGCGCGCGCAGTCTGATTATTTTGCAAGACTGAG
GCTTCAGGGTGCGCCCTTTCGGCGGGAGGGGCCGGGGGTGAAAGCAGATCTTGCCTGTTC
TGTCGGGGGTGGCATCTGTCTACATTATGGCGCTGTCTGACTTTCAGGGCCATCGGTGAC
CCGGCTGGAGACCTTGAACGTAAGTCAGCATCAGTCCAGGGGCCTCGTGGTAAGGCGGGA
GTCCATGTTTGTGTCTGAAGCGCTTAGTAATAAAGCGAAGGTGGTGAGTGGATGGGAGCA
CGAGTGTCTTTATTTTCTCAAGCCTTTTGCACCCCAGAGGACACCGTGGGAGGACTGGCT
CATCCCTGGGCAGTCTTAGGAAGGGGTAGAGACATGAAAATGGAAGTTCCTACCAGTTAT
TTCCCATATATTTGGACTGCCTTCACCAGTTTTGCCTGTAAGACCAAAAAAGACTTGTGC
CTCTGCGCTGAGGTGGGGCATGAACTTTTTTTTTTTTTTTTAAGATTGGCACCTGAGCTA
ACAACTGTTGCCAATCTTTTTTTTCTTAGTTCTTTCTGCTTTTTCTCCCCAAATCCCCCC
AGTACATAGTTGTATATTTTAGTTGTGGGTCCTTGTAGTTGTGGCATGTGGGACGCCTTC
TCAGCGTGGCCTGACAAGTGGTGCTATGTCCACGCCCAGGATCTGAACCATCGAAACCCT
GGGCTGCCGAAGCAGAGTGCACGAACTTAACCACTTGGCCATGGGGCCGGCCCCAAGTCA
CGAACTCTTAATTCTTCACTAACAGGCCCCTGAGTGCCAATTTCTTTGTTGTTTGGTCTT
CAGGAGGGAAGTTGGCGTTAACCATCTAGGTTCCCACATGCTTCCTGGACGGTGCTGGGG
TTCCAGGCAGCCCCGCTGTGCTTTCTCTGCCAACCTGGGTATGAGGGAGTGCCACCCTCT
TGATGTTCAAGTCAGGCCTTCCCGAGGGTGGTAAAGGGTAATTTCTTTCAATGGATGAGA
CAGGCACTCCAGAAACACTTTATTCACTAGGACTGAAAACAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved