Equus_caballus Locus Mono:38:SNORA76
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:38:SNORA76
Equus_caballus
Mono:38:SNORA76
21
SNORA76
1001..1129
2129
CTGCACCGCCTGTCACTTCTAATTAGACCTGCAACGTCGTAAGCTTCAGGAATTGTCTT
GAGTGTCTTATTAGTCAGAGTTCTTTAGAAAAACAGAATTAACAGGATGTATGTCTGTGT
ATATCTATCTATCTATCTATCTATCTATACATTGAGATTGATTTTAAGGAATTGGCTGAA
ATGATTACAGAGGCTGCCAAGACTAAAATCAGCAGGTGGGCCAGCAGGCTGGAGACCAGG
AGAAGAGTCAACATTGCAGAGGACGTCCACAGACTGTCTGCTGACAGAATTCCTCCTTGG
TCAGGGGAAATCAGTCTTTTTGCTCTATTTAGGCCTTCACCTGATTGGATGAGGCCCACC
CACATTAGGGAGAGCAATGTGCTTTACTCTAAGTCCAGCAGTTTGAATGCTAATCTCATC
CCAAAATGTCTTTACAGAAACATCCAGAATAATGTTTGACCAAATATCTGAACACTGTGG
CCCAGCCAAGTCACATAAAATTAACCATCACAAGTATGTTGGTGGTGTTTTAAAATTAAA
TTAGAAGCATTTTGAAATTGGGAACCTTATTCTGAACCTTTGGTGTCCCGGGCAGCTGTT
AGGTCTCTGCCAGGTTCCCGATGGGACTCAGCAAATGTGGGCTGAGAGAAGGCTCCAGGG
AAGGAGTTTTTAGTTACCAAGTGTCAGACCAGCATGGGGTTGGGGTGGGAGAGGATAAGG
GGACTGTTCTACCAAGGTGACCACTTAAACTAAGGTGGTCTTGCTCGGAGGACTTCACTG
CAGAGGTTAAGTTTGAGTTAAATTAAAAATTTAAAGATCATGATATTTCCAAATGAATCA
AGAAAGCAAATTATTTTTTTCAGTGACTGTGAAGCTGGAGAGATCCCGGCCGGACTGAGG
ACGTCGGATCTCAACGTCCTCGCCGCCCTTGGCCCTTCCCCTGAAGCTCCTCAATAAAAG
TGGTTTGATCCCATCGCTGGCGTGGTGTTTCTTGTCGTGACGTGCTGCCTTTGAGCCCCT
GCTGCACCTGCACGTGGCGCCGGGGGTCAGGCTGCGCCAGAGCACGCGCTTACGCACGAC
TGGGGCCGCCTGCTGCTCGCCGGCAGCCCTTTTAACCGCTAGCGACAAGGCGGGGCGGGA
GGAGCCAATTACTAACCTTTATGATTTTGACTGCCCTTCTTTTCCCTGCTTCCTTCTATC
CCTTTATTCCTTCTCCACATTGGAAGGAACATAAAAATGACAATGAACTGAAAATATATG
TACAGGTACCCACGTGTTCCACGGAGACAGATCTTTGTCATTGTTACTTTGTGGGTTGTT
AGAAACTCATCTCCAGTCTAAAGTGCTGGGAGTCTGTGCTCAGTCAACGTCATCCAGCAA
CCAGTCTCGGTCAACAGCTGAAGGCCTCCCTCCCTCTAGCGTCCCGGCCCCAACCTCATT
TCCGCTTCCTCCATGTGAGGAGCTGCATATGCTGTGAGATGAAGCCTCCACAGGGCAGCT
GGAGAAAGTACATACTCGAAGGAGACTTGTAACACCCAGGGCAGTGACTATGTGCTGGTG
AACTTTGTGTGTCAGTGTGGCTAGGCAGTGATACCCACATGTTTGGTCAAACACACCTGA
ATGTTGCTGTGAAGGTATTTTTTTGGATGAGATTAACATTTAAGTCAGCAGACTTTGAGT
GAAGCAGTTTATCCTCTGTAATGTGGTGGGCCTCATCCAATCAGTTGAAGTCCTTAAGGG
AAAGACTGATGTCCCCCGAGGAAGAAGACGTTCTGCTCCAGGCTGTCTTGGGATTCAAGC
TGCAATGCCAACTCTTCCTTTGGGTCTCCAGCCTGCTGACCTACCCTGCAGATTTTGGAC
TTGCACCTCCGTAATTGTGTGAGCCGATTCCTTAACATAAAGCGCTCTCTCACTCTCTCT
CATCTACCTAGATATATCTAAATACACACACACACACATCCGATTAGTTCTATTTCTCTG
GAGAACCCTTATACTGTGGTCGGGTGGATGTTGACGCAAAGGAGAAGGGAACTGAAGCAT
TTCATGTGACAAATGCAGCCATCGGGAGCAGCCACCTGCTGCAACCACTGCTGAGTCACA
CACTTTCGGAACTCCTAGGGCGCTTAGTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved