Equus_caballus Locus Mono:11:SNORD43
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:11:SNORD43
Equus_caballus
Mono:11:SNORD43
28
SNORD43
1001..1064
2064
GGGAGCGGCGCAACTCTTTCCAATTCAACGTGCCTGCAAAATGGCAATAACGCTCATCC
ACTGTGGGGGATGAAAATGGGACACCACGTGTGAAAGCCCACAACAGGGTTATTCAACCC
CAGAGGGGACTGCATTTCAAATGAAGAGAAGCGACGCAGCCAGCTTCCTTAAGCGCAACG
GCGTGTTTCATTCAATTTGGCCGCTGCCCAGCGCCGTGGGTTTCTTGCATTCTAATTCTC
TGCCTGCATTTCGTGGCTCTTCACTAAGTTTGAACCCAGCTGCTCGCCGTAGAGTCTCTC
CTTCCCGCCTCCGGAGCTGACGCCCGGCTGGGAACTAGCGCTAGGCGGGGACGGGCGTGC
GTGGAAGGGGCGCCATGTCCCCGCCCCCCGACCCGACGTCCGCCGCGGGCGCGCGCTCGC
ACGCCGGAAGGGGCGGAGCCAGGCTGGGCTTTATATATCAGGGGCCGTGAGTCAGCCGAC
CTCTACCGGGGGATTGTGACAGGAGGATGGTACGTGTGGATATGGCGGCTTCCGCCTTGT
CTCCAGTGGCGGCACGGCTGAATCGGTGGTGCATCGCCGCCATCTCGGCTCGCCGGGCGC
TGGGGGCCTGCTCTAGGAGCACGGGGGCCTCTGCGGCATCCGCAGTCAGGCCTATTTTCT
GGAAACGGTGGAGGCGTGTGGTTGGCCTTGAGCTTGCCGGTCGGCCCAGCGAGAGGCCTT
GGGGCGGGAGCTGAGCGGGCGGGCCGGGTCCCGATAGTTTTTACGCCTTGGGTTGTTTCT
GAGTCCCGCCCTCACCAGTTTGGAGCTAGTGGGGATCGGAGTCCGTGAGCACCTGGGCCG
GGAGGACCTGGCGCGGGGGCCCTGGCGGTGCTGTTGCCGAACCGGGAGGTGCGGATGTCA
GAGCAGCAGGCGGGTGGGGGCCTCGGGCCGGTTGGTCGGGCCTCGTTAAGAAAAGACAGA
GACGGTTGGTGCAGCTCCTCGGGCCTGTAGAGTTCCGCAGCCGCAGGTGATGAGCTTATT
GACGGGCGGACAGAGACTCTGTGCTGATTGTCACGTTCTGATGTGGCTGTCGCGCTCCGG
GGGCCTGCGCGCCTCATCTGAGCTCCGCTCGGAGCGGGAGGCGCCTATAGTACCTTCATC
GTTACCCAGCCGTGGTCCAGAGGCGCTTTTGTGGTCATTGTCCCTATCTTGCTTTCCTAA
AGGCACCTGCTGAGCAAATTTTGGTGCCAGCACCTGGTGTGCCCTCGTGTTTAGAGGAAA
AAACCGATGGCTCGTTTTCCTAAATTATGAAGTGCAGATTTGAGCTCAAGGTTCAGGTGA
AACTCAGTTGGGTGCTGCTTTCTGGGCGTGTGATCCTGCAAAAAGTGCACCGAATCCAGG
CTGAAAGCCTGTGACCTGGGTTGCTGGGTCTCGGTTCAGCATCACCGGAGTCCGTTTAGT
ACCCAGGCAGCTGGGATTCAAGTGAGAGCTGCTGAAACGTTTGGGTGCTGACGGTGACCC
TTTTCTCCTAGTCTCACAGGAAGTTCTCCGCCCCCAGGCACGGGTCCCTGGGCTTCTTGC
CTCGGAAACGCAGCAGCCGGCACCGCGGCAAGGTGAAGAGTTTCCCCAAGGATGACGCTT
CGAAGCCGGTGCACCTCACGGCCTTCCTTGGCTACAAGGCCGGCATGACCCACATCGTGC
GTGAGGTCGATAGGCCCGGATCCAGTACGTAGGAGCTGCATTCTCCAACCTGGAGGCGCG
GGGTCGGAGTGGAGGGTGGGACTGGCTAGGTGGGGCAAAGCTGTCAGAAGAGGACAGACT
CCTAAGAGATGAACAGAAGCTTTGACGGGGGTGGAAATAATAATATATTTTAGGACTAAC
TAATATTCCTGAGGTTCAGATGCCTGGCACTGCTTGCCTTAGGCAGAGGCCTGTGATGAA
GTCAGAGCACGATGTAAGTTTGTCGAGAGCCACAGCAGAGAAGTATGCTGACTTGGGCTC
ACCCTCTGAGACTCAGATAGAAACTATTGACATGTTGCTGGCAGCACTGAGCTGCCAGCC
TCACCTAAAAACTCGAGGTATTGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved