Equus_caballus Locus Mono:61:SNORD83
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:61:SNORD83
Equus_caballus
Mono:61:SNORD83
20
SNORD83
1001..1078
2078
CTGGCAATAGCGGAGGAGTTAGAAGTGGCTTTTGAAAAAAAAATTTCAGACAGGCATTT
TCTAAAGGCAACCCCGGAGCGCGCGGGAACTATAGAACCGTAGAAGGTCCTCAGTCCTGT
CCCTTGCGCCTGCGCGCTAGTGGTCTAGAAGGCGGGAGGGCGAGTATAGCGAAGCCGGGA
ACCGGAAGTGAAGGCAGATTCCCACTTTCGTTGCTGTTGCCGCCGCCATACGCGCTCTTC
TTGCTCAGGTAAGCTTTGGCCTTCAGTACCATCCGCCTCCATCTGCGTTTCTCTGTGGCC
ATCCTGTCGCATGGACTCCTGATACCCCTTCCACAGGTTATGGTCTGGTCACTGGGGCCT
AGTTGGGTCATTATTTCCATCGCTTGTACCCCTTTCGAGAGCAGAGAGCTCCTGGAGGAG
GTAGGGAAGCTGAAGCCGTGGGGAACCCAATCCAAGATGGTGGCCCCGGCGCCATTGTGT
TCCCTTTGCTCTCTGCTCCTTTGGTGGGCCCCTCATTTACCGGAGGCCCTAGTGACGATG
AGAAGTGGCGCTAGGCGTTCTCTGGTCTTGGGCATTTGCAGAGGGCGGGGCTCTACTCAC
CTCTCATTTCTGGGTTCTTTCTCGGCCCGCGGTTGGAATTGGAGGAGCCTACTTCTGGGC
CTAGTTGGAGCTTTCTCACCGCGACTTGCCTACGTTTATTTGGAGCGCTTTCCAAATGTT
TACGGGGGTGTTTGTGTGTTTTTGGGAAAGATGTCTCATGAGGAGTAAGGCAACGGTGAT
GTGAGACCACCTGGCAAAGGTTCTGGTAAAGCCGGAGCGAGGATACTTCTATCTCAGTTT
ATTGCCTGCCTTCTTACTCGTATGATGGAGAGATGAATACCCTTTTCTGACCGAGCCTTT
TCTCACGTCTCCCCGCGCGATTAATTACACGGGGATTTCTTAAGCACCAGAAGGAGATTT
CTGAGGAGTGGGAGGCTGAAGAACTGTGGGAGGTGATGGCAGCCATATGATGTTTTCATT
TGGAGAAACGAGCGCTTTGCGCAATGATGACCTTAATCTATCACCCTTGACTGATGGCTG
CTGAATTAGGGGTTGACACCTTGAGATTATAGGGAAAGCACAAGGTTTTCGAGGACTTTT
CAGGACTTGTGTTCGTTTCGTTATCTTCATTTTCCACTACCTTAAGTAATTAATCATATT
TGCTTTTCGTTCTCTTTTCTTTTTCTCCTCCCTATTTTTAGTTTATAGATCAGGAATTTG
TAAGCTGGTCTTCCTCTCCCAATTTTATTGTTTCTGGTACTCTTATCCTAATGTTGAGAA
CCTGTATCCTAACCTCCCCTGGGACCGCTTTTGCTTTTGCGTTTCCTGTTTCTTTGTTAC
TTTTTTTTTCCTGGTAAAGGTTTCATAGTTAGGGGAAGTGGGAAGTGTGTGAGGATGGAA
AAGTGGTGGTGAAGGCTCTGCTCATGACTGATAAGTCTTTTATCTTTTTTTTTTCGTAGC
TCTTCTGTCAGAGACTTGTGTGTTTCTTTTCCACTACTGTTCCTCAAGCCCCACTCTCCT
CCCTTGCTTTCACTTATTCTGCGTCAACCCATCCAGAGATCCCTCCCCTTCTCTCCCTGC
CGGCCTAGTTATGGCAGAGAACGATGTGGACAATGAGCTCTTGGACTATGAAGATGATGA
GGTGGAGACAGCAGCTGGGGGAGATGGAGCTGAGGCCCCTGCCAAGAAGGATGTCAAGGG
CTCCTATGTCTCCATCCACAGCTCTGGTTTTCGTGACTTCCTGCTCAAGCCAGAGTTGCT
CCGGGCCATTGTTGACTGTGGCTTTGAGCATCCTTCAGAAGGTAAATTTTTTTGTTGGGT
GTAGAGTACTCATTAGATTGAGGAAATGAGAAATAGATGTGTTTATGGTTCCTCAGATAT
AAAGTTATATGTTTAGGATAGAATAGGAAATAAGGAAGTAGCAAAAACTATTTTAGCAGT
AGAAGAGGTTTATACAGGTTGGTTTTTCATTCATGATAGCATGAAAGTGCTAGTGATCCA
AAAGCACCGTAGAGTTCCACTGTTCATTCTTTTGACTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved