Equus_caballus Locus Mono:15:SNORA35
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:15:SNORA35
Equus_caballus
Mono:15:SNORA35
X
SNORA35
1001..1129
2129
CCAGATTATTCTTAGAATTCCAGGATAGCTGAGCACCCGAGTGGGCAGCATTTGGTAAG
GTACCATACCAGGTTAGGACAAAACTAGAAGGGATAAAGACAAAGGCTTGTTTTGATGCA
AACACTATATATTTAGAGTAGTGCTTGATTCATAGAATTTTATCAATGACTTTATGAAGC
AATAAGTGGAAAAAGAAGTAATATGATTTTGCCAGTGGCTGCTTGAGGTAGCACATTTTT
ATAACCAAGAGAAAAAAATGGAAGGCACATCACATGGTTAGTTTTCTCTTTTGTACATTT
TGGAGAATGAGAGTTCCTTCCAGCTGCACAGGAAAAATATGTCTTCGCCTTTCACATAAT
GCAAGAATAATGATCTACAAATTCTTCTCAGGAACTTTAGGCAATTTTTAAATAGTCACA
GTCAACATTTAAGCCAACATAAACAATTAGGTATAAAGCAACTTGGCTTTTGTGAGAGGA
AATTATGAGTAGAAAAAAATGTATAATTAGAATTATTAATTTAAAAAATCCAAAGTTTTT
TAACCACGTTTCTCACAAATGGTAATTTGAAACAGCAAGAAAATTGCCATTGGCAAGAGG
GGAGATGTGATAATAGCTATTATTTATTGAGCATCTACTAATGTCAGGTACTGGACTGGA
CTCTGTAAATTCTTTCTTCTAATTCTCACAACAGTCAACTGTCAATGAAGTAGTTATTAT
TGATCCCATTTAACATATGAGAAAACACAGGCTAAGAGAGCTTAAGTGAGTTTCAAGGGT
TCCACAGCTAACAAGTGACAGAGCTGGGATTCTGAACTCAGACTACCTGACTCTAAACTC
ACATTTCCTTCCTCTGAAGCTGACCCATGTATATATACAGTAGCCATGCTAAGAGAATGA
AGCAATGGATCCTGAGATGTTTCAGGTCTCCAATCCACTCGCTCCTCCAACCTGGTTCTT
CTGCACAGAGCATGGGGTCCCAACCCTAGCTCTGCTGTCTACAGCACTGGCAAGTGACCC
GTTGGGCTCCTCCTTGACCAACTGGGCATCGAGCAGTGCAAAAGCAAATCCCTCCACAAA
GCTGGGAGAGTCATGCTGTGGGCTACTCCTGCATGCAGGTGGGTACATATCTCCCGGGTT
CTGTCACCTTGCGTAAGAAAAGTGATGTGGTGGAGAGACAAATCAAGCAGCTCAGCCTGC
TACTACTAGATAAAGGTGACTATGTCCGTATCAGGTTAATACCAGGCAATGGATAAATAT
AGTCACCATTATTAAATTATTATCACTATTATTACTAGCTGTGTAGCTCTTAGCAATTTA
CACTAACCTCTCTTGGACTCAGTGTCTTACTCCATAAAATAAGGTTGACACTACTGGAAT
GATCTAAGATTGTCATGATGATTACAAGATAAATTCATTTAAATTCCCTGGCAGATTGCT
CATTAAGTCTTAGTAGGATAGGAGAGATAAGTTCTTTTCTCCTTTCAATGTGATAGAAAT
GAGATTATAATTATCTTGCAGATGTTGGTTCCTGTGTATTTTACTTCCCCACCTTGCTAC
GAGCTTCCTGACAGACTAGCCTTCCCCAGCCTCTTCGTCCCCTGTATATGACAGTCTGTT
TAAACCTAATGTTGACAGAATTCCTTTCCCAATTATTTCTTATAATTCAGATCTACATTC
AAGACCCATTCCTGGCCCCTTCTTTCCTTCATAATACTTTTAAATACTCAAGTTCCCACT
AATCTCTCCTCCTACTACACAGTTTGGCAATGACCACTTTCCCATTTTTTATATTCATTT
ATGTTATCTCACTAGCTAAGTTGTAAACTCTTTGAAAGCAAAGATTCTGTCTTCTCAAAC
ATCTTAGTACTTGTTGTAGCTCCTAGCCCAGGGCCTTGCATAAAGAAGAAGCTCAATAAA
TAATTACTGGTAGATAAACTCATGTAAGTTATCTATGAAATCAGTCATTAATTCTTGTGA
CCAGAACTTTAAGAAAGCCTCTAGAAAATTGAATATCATAGTTTTAGCACCATGTAAAAC
ATGGCACTATTTTATGTGGTAAATAAAATATAGACTGAAAACTCACTTAAAATCCAGGAA
AAATTAGGTTGTGAGAGATGAATCCATGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved