Equus_caballus Locus Mono:18:SNORD87
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:18:SNORD87
Equus_caballus
Mono:18:SNORD87
9
SNORD87
1001..1085
2085
TTCAGTAGCTGCCTAGTTCAATGACTTTCCCTCCTGGGGAGCTGTAGGACATGATCTGT
GCCCCTGGCCATGCCCTTTGCAGTCCTTAAATGTGCTTTCAGGCAGCTTGGGACAGTCAT
TCCACAGGACTGTGTCCAATAATGATGCCAACATAATGTATCTCGGCTCTAAAACTGTTA
GATTTGCTGTTGTAATGCTTTTAGTTGGAGGTCTGCACATTTTTAAAAATATATCTAACC
TTTAACCTGGCTCATACCTCATCCATGTCAAGCTCTGAGACAGAAAAGCAATGGCTGGGT
ACTCATTAGGACCATATCATGTCTTAAAATCAATACTGCCACAGTAAAGAACATCATAAA
TGTATCCACCATTTTTCCTGCCCGTGCTAATGAATCCATTTCCAGCTTGGAAAGATCATT
TATGGAATTATTAGGGTCTAATCAATCAAAAGGACTAACACATACTCAAATCTTTATAGA
TATTTTAAATTGGGGGATTACCAGTTTTGACTACCAGAAAAGTAGAATTAAGCAGTATTT
ACATTCTTTTGTTCCATTAGAGATGTGTTAAACAACAGATAGAAAATTAACTCCACTATA
TAGTCTCAATGTTAGTAGTTTTAAAAGTTCCTTGGGAGCCAGGAAGATTGCAAATGTTGT
TATGTTTATGGTTCCTGATAAGAATGGAAAAAAATCTTATTGGACCATTCTTTCATATAA
GATGCCAAACAAACAGATGGGAGTCCAAATGAGAATTCACAGTGGGATATTTAATTTCCA
GGTGCACCAGAGCCTATGAATTTTGAAGATGAATGAAGGTCATGATAAATGTTTTCCAAA
AACTTGAGATAGAGGATGGCTTTGAAAAAACCACTAGGAGCACAACAACATGTATAAGGT
ACCAAGTTAATATTAAATTGTGTGCTTTTTAAAATGTATTTGTGGTATTCTTGAAAAGCA
GTACCAAAAATTAATACATTTTTACATAGATAGGTTTAATAACTGGCACAATGATGACTT
AACTTTTTGCCGTTTACCCAGCTGAGGGTTTCTTTGAAGACATAATTTTAAGACTGAGAT
GCCAGTAATCTATATTGATTATGTGAATTACTCAAATATAATGTGGTTTTTTAATTAAAA
TGAGTGAAATATTCTTTTCAGTTTATAGGTAGCTGCAGATGAATGTCAAAGTCCTTAGCT
GTGCTGTTGAAAATTCCTTCATTGCCTCAAGTAATTATGATTTATGAAGCAACTACATCT
ACTTATAATTCACAGGTATCTGATAAACTCCAAAGGGCTGGGGCCATTTCCTGTTAAAGT
TGCCTTTGTGTGTCAGGGTATGATTTTCTTTGAGTTTGAGTCTGGAATGATTTTCACTGT
TGGTTTCTTTTTGTTTTTCTGAGGTTACCACATTTTGGAAGGAAAAAATGAAGAATTGGT
CAAGACGACATGAAATGATGAAAATTAGTATTTTATTTAACATTGATCACCTCACAGTAA
ATTATATAGGAAAATAAATGTTTGACTACTTTTGATTGCTGGGCAATAAAGTCTTTAAAA
CATATCAACTCTTGAAACAGCTATTCTCATAGTCACTAGTCAGACTTGTTTTTTTTTGTT
TTTGTTTTTGTTTTGTTTTGTTTTGTTTTTTTTGGAGGAAGATTAGCCCTCAGCTAACTA
CTGCCAGTCCTCCTCTTTTTGCTGAGGAAGCCTGGCTCTGAGCTAAGATCCGTGCCCGTC
TTCCTCTAGTTTATACGTGGGAGGCCTACCACAGCATGGCTGCCAAGCAGTGCCATGTCC
GCACCCGGGATCCGAACCAGCGAACCCCGGGCCGCCAAGAAGCGGAACGTGCGAACTTAA
CCGCTGCGCCACCGGGCCGGCCCCTCAGACTTGTTTTTTAACATACTTTAGGGGTAGTAT
GTTCTTCACAATAACTAGGGTTTTTGTGGATAATAAGTCTCTGAGGTGGCAGGCAGCTGG
GGAGAAATTTCTAGTACCTCCAGTTCTCATACCCTTTCTTGCCTACCTTAGCGGATTCCT
GGAGAGGCCCTAATCACTGCATATTCACTATGTGGACTTCCCCTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved