Equus_caballus Locus Mono:34:SNORD77
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:34:SNORD77
Equus_caballus
Mono:34:SNORD77
14
SNORD77
1001..1065
2065
AAATCTGACTAGAGTTGGGCAGTGGCAGAAATGGGACTTAACCGATTTTGCTGCATTTC
TTATATTTTGTTGATGTCAATGAAATAAACCCGGAAATCAATAAAGATGATGTTTTCCAT
TATTTGCCTGGAGTCTGCTTTTTCATATTATCTCCATTAAAAGAGAGAAAAACAATTACA
TGTGAGAGAAACCCTAACTGAGTCACATTCTTTAATTTGTTGGACACAGTAAAGCCTGAA
AAAGTACTAGGCAAAGATAAAATATTACTGTAAAACAAACTAGAAATATGAATGTTAAAT
TGATACTCTGTCCTGGTTGCACTTAAAGGATTTATTACATAGATTTTTCTCTTTGTTTTG
AACAATTCCACATATTCTACACTACTACTCATCAATGAAATACAACCTTGTTTTGGCCAG
TGGTTGTTTTTGCTTATTCAGCATCACTGCCCATCTTCCTTAGGCTAAAAACCAAACAAC
AACAACCAAAACTTGGAAGAACTCCTCTTTCCTTATTCCATGCAGTCTTGGTGGTATTGT
CAATCAAGGTTCTCTTTATTCTTTCCAAAGGACAGCCATATATGCCAATCAAATTCCTTC
TCCCAGGAACTTGAATTCTGAGTAGAGTGACACAAAGAATGCAGAAGTGTTAGAGCTGAG
AAAATCGAATGGCTAGGTCTTGAGGAGATAATTCTAATTATCCACTTGCTTCTATGTTCT
AGATCCCCAGCATTACTTTGGTTCCTGTCTATCCTGAGGTCTTTAGTTAAAAGACTCAAT
TTCTTTAATACAGAGAAAGTTTCTTTTTTTTGTTTCTTTAAGATACCTGGAATTGACAAA
TATTGTTTACAAGTGGAGAACCTTAATGAATATTGTATTCATCTTTGGTGTACTTCACAA
ATGTATAGGGAAGAATCAAATGTTCCTAATTATTCTAAGGGTCACATAGTTGGTAATGAA
TTATTCCAGAAAGAGAGCTGACATAAAAATGAAAAGTAATATTACTGTGATGGTTGTATA
GCTCAGATTGAATCATGAAGAGATATACCATTTATCTAATGTAAAAAAAAAAATGAAAAA
GAATATTCAAGTAATTTAAGTGCGATGGGTAAAAATAGAGCTGCTAAAATACCAGGATTA
GATAGGCATTTTGCTTATTTTATCTATAAACAAGGCTTGCCAAAATTTTTAAAAATATGG
GTTGGGTGATATCAACTTTGGGCTGCTTATTGATTAATCTGTTTCTGACGGTAGAAAGAC
TTATACTATCTAGTGTCTTCACTATATAATTTTATCAGGGAAGTGACAAACCACGCTTTT
CAGTGACACCTTGAACTAAAGTGGAATGTACAATAAAATACAGATTTCCTCAAATGAATT
GCCAAAACCATTAATCTTTATCTAAGGATCCATAGTAACAGTTTGTTCTCAGTAGCAGGT
GGGGGAGGGAGAGGAAATGTCTTCCAGAAAGCACTTTGGCAGTCAATCTGGTTGATAATA
AAACTTGATGAAACATCTGTGATTAATATTAATTCTAATTCTCCCTTTAATGGATAATTG
TGAAAAAGATAATTTATCCCATTTCATTTAGACTATAGCTGAGTTTTTCAATTTAGGAAA
AGAACACTTCTCCATGTTTCTCAGGTATGAGACTCTATGGGGAAAAAACAGGTGCATAAA
ACCTGCCAATGGTAAAGCAGTGTTCTAGTTAGCCCTGGAAAATATTTTGTTCGAATTTAA
CTGACCACTGCAGACTTGGATGTGACCCAAAGAATGGTTCTCTAAGTGACACACTGGTAT
TTTTGTATCTTCAACATTGTAGAACATTCTAGATAAACCACCGTGAACTGACTTAACATA
TTTTGGTCATATTTGATTCTGCAAAGAGTGTGAGAAAAATGCCCTTGTGAGTAAATGACA
GTAAGCTATTTCTGACCACCAGTGTACTTCAAAGTAGTTGATGATAGGAACTATTTTTGA
CACATGCAAATGTATAATTTAAAGTGCCCATAAAAATTTGTCACAGAAGCTACCATTAAT
TTTGACAGAAACTAGGAAAGTAACTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved