Equus_caballus Locus Poly:17:SNORD48
snOPY snoRNA Orthological Gene Database
Equus_caballus Poly:17:SNORD48
Equus_caballus
Poly:17:SNORD48
20
SNORD48, SNORD52
1001..1063, 1674..1741
2741
TTTTAAAGACTTATCAAATTGTTTATTTTAAATATGTGCAATTTACTGTATGTTAATTA
TACCTTAATACAGCTATTGAAAAAAAAAAAAGACATGAAGCCTAATGTGCCTGACAGGTC
TGCGGCCTCGAGTGGGGCTAGGGATTCAGATTTCGCTGGATAGACGGAGCGGGGTGACAG
TCCCTCGGAGTGACCTGGACCCCAAGCTGGGACGGGTAATGACAAGGGAGGAGGCCACGC
GTCATCATTCACGGACCCACACGGGACTAGACTGCCCCGGAGGCCGCTAAAGCAGAGCGC
CCAGCTGCGCGTGCGTCCGACGGCGCCGGGGACTTTCTCCGGCCTGGCCAGTCAGGTTAC
CTGGGTTTTGATTTTCAAAATTCACAAAACATTTCCGAATATTTACCCAGAAGAGTGTGA
AACATTCACTCATCGCCTCTCTTTCACTTTGCTTTATTCTCCTTTGGACGAACGATGGGG
AAAATTCTGCGGATCGAGTCAGGCATCTAAGAAGGCAGCCATGCTCGTCAGGCCCCCTAC
CCCACGCCTCCATAAATAGCCCTAGTGCAGACATTTTTATTCTTTCTGTGAGATTAACTC
GTTCGCGTGAGTCTTGTGAGCTCTGCAGTGTGCTTCGTGGCGGCTGCGAAATTTTCGCCA
CAGCGAGGCGACGGCGGCGGGCCCTGGCTGCCTGTGCCACCCTTGCGTAGCTGGCCGCGT
GCAGGTACTTGGGGGCCCCGCTGGGTGAGGGGACCGCAGTCTCGGGCTGAGCAGGATGAA
CTACCATTACAGACTAGAGTTTCTGATGTCTCTGTGACGCCACTGCTTGAAACTGACCCA
GCCCGAGGCAGGGGGAACTCAGCTGGGGTCGCCCCGGCCTTTGCTGACCCATTTGGTTTC
TCCCCAGACTCCTGATCCCTCGCGGGCGGGTCCGCAGCGCTACGAGGGTAAGTGGATTGT
GCGAGATGGCGTGCCTGGCAGTTGCCCTGGGGGAAGACGGGGACAATGATGACTCCAGGT
GACTCTGAGTGTGTCGTTGACGACATCACCGCAGCGCGCTGACCACCCCCTTCCCCTAGG
CTGGGATCCCTAGTGCCTGGTGCTTGGGGGGAAGTTGATGGCCAGGAACCCGTATTACTC
ATTTATTCTTCTGTGTCATTTCTCCTGTAGTGGTTTAAGACGTCCACCGGTGTGTTATCT
TTGAATAAAGGTGAGTATTAGGTTTGAGAGTGCTCCCAAGTGCCTCTCACAGACCATCTT
GTCCCCAAGCTATCCCTTTCATGGGGCCCTATGGAGTCTGCCTGCTTTCTAATGAACACG
TACAACAGTGCAAATATTTCACCTGGTAATTTTCCAAGGATCGCTCTTTGGTTTACATTT
CTCTTGTGACCATTACTTTTTAAAAAATCTTTGGTAACTCCACCTGTTTTTTTTCTAAGC
CTGGTTAAACCTGCTTCCTCCATTCCTTTTCTTACTGTAAACTTGCCTACATGCTGGGCC
TCCTTGGTGGAGCCATTTTCTGCAGTTCTAAATTTATTTCCTACTTCTTTTCTCTCCCAA
ACTTCCCATCCCTGAACTCGATTGCTAGATCCTTGTTTAGATTAGGACCATTATGCTTGA
ATGCATTAGGTCTCTTCCCAGAATGGCTTCCCTTGATCCAGATCTCCCTAAATTGGGAAT
GATGATTTCTCAGACTAGAGTCTCTGATGCTGGTTCTGATGTCAAAACTTAAGTTCTGAC
TCATTTGGGGAACTGGATACTTGGGTCTTTGAGAAGGGCCGGAGGGATGGCTGTAACCTC
TGCTTGTCCTTCTCATTTCTTGTCCTGTTTCATCTTGCTAGCATGAGAGCCCTGGAAGCC
CAGCCAGGGGCACTGCCCCTTCACAGAGTTTCTGCATTAACCTGGTGGCTGAAGGGCTGA
AGTTTAGAATTCACCCTCTTGGAGAAGTGCTGTTGGGATGCCTAGGTAATGGGTTCCTGC
CACTTCATCTACAGGCTGTGACAAGAAGTGAAGAGCCATGCCCCTTCTCCCTGGCTAGAG
TGGTGAGTCTCTCCCTGTTTTTCTTCCAGCCCCAGAGTGGTAATGATGACCTGGTTGGAC
TAGAGTCTCTGAACATTCCTTTGAGGATCTTTGAATCCACCTGATCCACTCTTATGCTTC
CCCTTCTCCACCTTGTGTGTCAACTCCCAGTTGCCTGCATGGTTCTAATACTGTTCCTTT
CATGAAATTTCAGGAGTTTGCTGACACAGAGGATGTCTTCTCTTTGGTGTTGGGCAGATC
CTAGGAATTTACATCTTTTCTGGATTAACTTGAGCAACTGTCAACTTATTGGGGAAAAAA
CTGCCTAGAAATTTTGGGGAACTTAAATCGATTAACTTTCACTTCTTTACTTTGTCTTAA
ACAAGTACTTGGTTTTATCAAAAGGATTCCAATAAAATACTTTAAAGCAAATAAAAAATA
GATGATGGTACAAAAAGATTTAGGGAGGTGAAAGGTAACCACCAGTGAATGAGCATCATC
ACATTTGATATCCAGCTGTACCTCTTTATAGCTCTGTACAAACAACAGAAACTAGGTTGT
ACACACGTGGACACTAATGTTAAGGATTTCTAGATTGGCTACCATAATATAATGTAGTAG
ATGTAAGTAACTAGCATTTAAGGTTTTTTTGATGTTAAACAATCTTAACACAGGCATCTA
ATTTGCCTTTTCATGAATTGGTGAAAACAGGTTTTCCAGATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved