Equus_caballus Locus Poly:6:SNORA16
snOPY snoRNA Orthological Gene Database
Equus_caballus Poly:6:SNORA16
Equus_caballus
Poly:6:SNORA16
2
SNORA16, SNORA44, SNORA61, SNORD99
1001..1135, 1605..1735, 1962..2094, 2779..2858
3858
CCACCACCTGTGAAAGCAGCCCCGCGCGCGCGTCGGGCTGGGAACCGGACGCGCCTCCC
GACGCCAGAAGGCGAATGGACTACAACTCCCAGCGGGCTGTGCGACGCGCTGCTCCAATT
GTCAGGCGCGCCGCGAGGGGCAGGGTCTATATAAACCCCCTGCCGATGCGCGAGCGTCCT
TTCTCCCGGCCGCCGCGTTCTGGGTGTTTTTTCTTTTTGGGAGGCCGGCCTGCTGCCATG
CAAACCTATCCCCCGCCGCACCCCGCTGTAGCCTCGCCGCCTCCAACCCTGCCCTCGCCG
GGGCTGCCTCCCGAGGCTGCGGGATGCTGAGCGTCACACGGGGAGCCGGGCCTGCCAGCC
TGCTGGGGCCGAGGTGCGGGATCCACGTCGGCCACATGCGCAGTGAGAGTGGCCAGAACC
CGTCAGGGTGACGCCCTTCTCCCGCCTTGGCCTGCGCGGCCCTGCGCCCCGGTGACGGGT
GAGTAACGCGGCCGTGTGCGCGGCAGTGCTGAGCCTGACGTGGCTGGATTTGGGGGAGGC
CGCGTGGTGGTGTCAGCCTGACCTTCGATTGAATCTATCTGTGACAGCTACCTGCTGGGT
GACCTTGGGCGAGGGACTTCACCCAAATTATCTGGCTGCACAGCACACGTTAAGGAGGTC
ACCCTGGTGGATATAGGGACAAGATTTTTTGGAGGATGGGTTTAGAGTTATTCAGGTCCT
ATTTTGAATCCCAGTTTTATCACTGTCTGTAGTGATAGGCGACCTTCATTCAGGAACTTA
ATTGATCTAAACTTCATGTCTGTAAAATGGGGATGATAAAATGGTGCTGTGAAGATTAAA
TGAGACAAAACGCTGGCACATAGTAAAATGAAGTGGTAATGGGGAACTGTGGGATGTCTG
TACTCTTTTTTGGTCTCCAGAATGTCCCGGTAGATGCACAGGATCTAGGTGAGTCTGAGG
GCTGAAGAGCCCTTGGGGCTGTCGTGTGACCTGGATTGCCCTGTGGCCCTTATCGAAGCT
GCAGCTGCTTCCACATAGCTGCTGTGGTCAAAAAGGAGCCCAAAGTGACAGTTTTCCTCG
ACGGTCGCCGTTCTGTTTGCTGTAACTGATCTGCAACATTTCAGGAAAAGACAATTCCCC
TTGTACTTGCCATTTCTCTGGTATAGACAGAGAGCTTTACTAGAATTGACGTTTCCAGAG
GCCAGCAGAAATGTTCCGTTGGTGGGGTCTCGCATGTAGAGTTAACAGAATAAGGCCTTC
GAGAAGTAGCGTGCCAAGGCCAAGACAGTATGGAGGCAGATGGGAATGGGTTGGATGTCT
GTACTGGGAAAATCCAGCGGCAAGTCATTGCCCGCTTAAGGCATCAGTACCTGGACCAAA
GATCAGTCAAACCTTTATGATTCTGAAGAGCAGATGAAGGGAACAATAAGATCACTCAGG
ACCACTGTTCCCACCCTAGCTGTGCCAGATGGAGACTGCAGGATGACTGAAGTTGCTTTC
TGGTGAGTGAGGACTCGGGTCTTGACAGCGATGGAGCACAGCAGCCTCAGGACCAGGTAG
GTTTCTTGTGGAGACTTAATTTGGGAGCTACCTGGCGGGTCAGAACAGCATGTTTCCAAG
GGCTGTGGCTGGTTGTAGCCATGGGATCTCCAACTGCATGCAAGAACAACCTGGAGAGAC
TTTGACAGCTCAGGTCACCATAATACCTGCAGCTGCCACTCGCCTTTCCTATAACACCTC
AGGCCTGGGCTGGAAGCCTTCTCCCCGAGGCCAGGTGTTTGCGTTAACTTCCATGTATAT
GGGTATATCGGGTCAACTTTTTGGTTTAGAGCTTTCTCGCTTTTTTCTGCAGGTTGCTTC
AAGTTTCCTGGCGGTATCTGATAATGAAGAATCTGAGGATGCCAGCTTGCTGCTATTGCT
GTGCTTTAGAATAAGGTACAGTTAGATGTTGAGGTCAGCCTGCCCCTCCGGTTCCCTTTC
CCATCGGATCTGAACTCTGGTCTTGGTGGTCGTAAAAGGAGGAAAAGTAATGCTGAAGCT
GGCCTCACGGCGCTTGTAGTCTGCTATAGAGCATGTGGGCTAGTTTCACACAAGGTTGAA
TTCTCTCTGAACTTATTTTCTTCTCCCATGGTAAAATGGGATAATTTGAGGTTTACAGGG
AGGATGTATGTGAGGCCCTGGGAGGCTGGTGTGGTGACTGCTGTTGTTTCTCTATTTGGG
AGGGGTTCATCAATGGCCTTCTTGTCTCTTGATGGTGTACCTTTTTTTAGAGTGTTACCA
GGAAGCTGTGTTCATCTGTGATTGTGGATCCAGAGAACTGGGTAAGTTAGTGACTACCTG
AAGCTTTATCACAACTTCCTTGGAGTTTCAGGTAGTGCTTTACTGTCGTGAGCCCTAAGC
AGTGCAGTAAATAGATGTCACTCGGGTCTGTGTAAAAATCTTGGCGTTTTAATACATCAT
TTATATCTGGCCTTCCCTTGTGTGCCATATTTGTTAGCTGCTCATGGCCAGAGAACAAAA
GTAAATGTTTGCAGATTTGCCCACCGTTGAGGCCAAGAGCACATCCTGCTGTGAGTAGAA
TGCAGCAGAGGGGACAGCCCTGCACTTTTGGCAGCAAGGGCTGGTTGCCGTGAATGTGCT
GTAGTGGCTTGGGCTCATGCTCCCTTGTCTGGGGTGACCTCAAACCATGGAGTCTTTACC
CCCCCGCCCCTGCAGGCAGAGTGGGAGATGGATTAGGTAGAAACAGTTCCATCTGGCTCA
GGGTATTTTTTTTAGGGTGACTGGTCCAGGATGAAACCTAATCTGAATGGACATCTATGG
ATGATAGATGCGGATATGGGACTGAGACCAGCTTTTAGGAAAATGTCTGGGTGGCACTGA
TTAATTGGGGCAATACTAACACACTGGCTTATACTTCCTTTACAGGAGAGAAGTGGTACA
AGAAGAGGCAAGCTAAGACAACAGGTTATTTTAGGTGGGAATGGTGACTTTTTTTTTTTG
TTTGCTAATGCTGGTACATGGCATCTAAATGACCAATAAAAGACTATGAAAATATGTTTG
TCAGTTTTCTTTCTTTTTTTTGAGGAAGATTAGCCCTGAGCTAACATCTGTGCCCATCTT
CTCTACTTTATATGTGGGACACCTGCCACAGCATGGCTTGACAAGCAGTGTGTAGGTCTG
ACCGCACCCAGGATCCAAACCGGCGAGACCCTGGGCCACTGAAGCAGAACAGTGTGAACT
TAACCACTGTGCCACTGGGTTGGCCCATTAATGTCTCTCACATTGTTGGTTTTTCTGTAT
CTAAATACTCCTTTAGACCCAAGCTGAATTAGTCTTTTTTTTTTTCCTTCTCCCCAAAGC
CTCCCCAGAACATAGTTGTATATTCTAGTTGTTCCTTCTGGTGGTGCCATGTGAGATACC
ACCTCATCATGGCTTGATAGTGGTGCTAGGTCTGGGTCCAGGATCTGAACAGGCAAAACC
CCAGGCTGCCAAAGTGGAGTGTGTGAACCCTGAACACTTGGCCACTCGGCTGGCCCCTGA
ATTATAGTCTTAATCTCTTCATAAAAAAAGGCTGTCCTTTCAGGACAGTCTGATCAATTC
CATAACTGCAATTCCATGTATTTCTCCTTTGCTGAGTGTAGGATTGGTGCATCCTTAAGG
ATCTTTGAAGGTTTCTTGTGGCATAGGCAGTTTGCCTCAAGCTCTACCCACCTCCCCATT
CCTCTAGCATAGAATGAGATCAGATGCAGATTTCTAGCATAGACCCAGACTTTTCAAGAG
GGTCCTGGGTACTGGAGATGACAATATAAGTTGGAAAGTGGGATTTCCTGATTTGGAAAA
TAGAAATGTGTAGAAGGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved