Equus_caballus Locus Mono:31:SNORA36
snOPY snoRNA Orthological Gene Database
Equus_caballus Mono:31:SNORA36
Equus_caballus
Mono:31:SNORA36
14
SNORA36
1001..1107
2107
AGCTGTTCAGCCTCTCTGCGTCATAATTCTCTTGGCTAGAGAAAAAGCAGAAGTGTTCA
TCTACCCAGTACAATAGAAGGAACAGCAAATACAAACTGATTGTTAAGTACCTAGTGTAG
TGTCTACACAACAGGCGCCCAGAGATGCTTGCTTGCTCATATAAAATGCCTTGTGAAACC
CCAAGCGCTCCAAAAAGGTAGATAATCAACACGCTAAAACATAGGCTCTTATTAACAGTG
GTAATAATGTCTTGTATTTCCTAGGCACTCGCTATATGCAACTCCTTTCCCAGTCTATTC
CTTCCTCATGACAACATGCTGAGATCGTACTCTTAACAGCTTCATTTTACAAATGCGGCA
CCTGAGGATCAGAAAGGGTAAACGACTTGCCTGGTCATGTAAGGAGGTAACGACACAGCA
GAAACCAAAACCCAGGCCTATGAGAACTTCCCTTTTTCTTGGGTTGCGAAGACCCAGCCT
GAAGTAGGACCATTCACTCAGTTGCCCCAGTGGTCTCTTGCCTCAGCCCAGCCCTTTATC
AGCAATGGCAAATGACTCTACTGCGATAAAGGCCAGGGTGGACTTGACTGACGCTGGGTC
TTCTTGGGAAGCATCACAGTGACAATCAGGAAGCTGCTGGTGAGGCCCTGAACCTGTGGA
AGAGGACAGTTCTGTGTCAAGGGAGGGACTTGCAAAGACTCCATTCAATGAAACAAGTAC
CTCCTTGAGAACACTATCCGCGGGGCCTCTCGAGTTGGGAAGGCTGATGGGGCAAAAAGA
ACAGAGAAGCTAAGGATCGCTCAGTCCAAGGGGAATTTTATTCTCTTTCCCACATTTCTT
TGGTGGTTAAAATCATGGACTCTGGAGTCAGAAAGCCTTCCCTCCAGGTCTCAGCTCTAA
CATTTATTTAGATGTTATTTAGCTGTATGACCTTAGACAAATTATTTAAACTCTCTGAGC
CTTGGTGTCCTTAGCTGCAAAAAGGGGGATGAAAAAGCAATGCTTTGAGTTCAGTTCAGG
GCAGCTGTCCTGTTCTGTTAATTAAACTCTGGGACATTGAACCTGCTGGGGTAGACGACA
GCATACATTTACCTCCCAGCCTACAAAAACAAAGAAAGAAAGAAAGGGGCGGGTGGGGGC
AGTGATGCTTACCTAACAGAATTTCTTTGAGGATTAATTAAAATAATGTATGTAAAGTGC
TTAGGACCGTAACCGGTACATAGTGAATGTTCAAGAAAAGGTCACTATTGTATTATTTAT
GGACAAATTTTATTATTTATGGGTATGTCCAGAGAAGACTATTGGGAAACACATGGTAGG
GTGAGCCCTCAGTGTTTCCATGGAGATAACAAACACATCCTTCCAAAGACTGAGTATGAA
GAAGCCAAATTTTCTAGGTCAGGTGAGAAGGAAAAAAAAAACCCCAGCTAACAGACCATG
TTCCTGCGAGCTGGAAGGTCTACTGACTTCGAGAAAGGAATGTCCTTGTTGGGCTGGTTC
TGGAGACTGTAACTTGTGCAACAGAGTCAGGAGATTTTTGGAGACACATCAGTAAGAGAA
GGTTGGAGGAAGGGGGTGAGGGCTGCCAGAACCCTGCAGAATCACTTTGCATTTGGCTCG
AAGCCCCGGGGCTTTGCAGCGTCCGTCTGCAGGAAGGATCGTTCTGTTGAAGATGTGTGC
AGGTCTTCAGGATGGCTGAGAGCCTGCAGGATGCTCTGGGCCGGGGTGTACCATTAAAGT
TCAGACAGAACTGGGGCCTGCAGAGCATGCCGCCGCACCAGGGAGCCCTCTGTTTTTCCC
CTCGGAGTGGAGGCTGTTTTCTCTAAGCACCTAAAAGAATTCCTGATCTCAAGTGAATGA
TGCTCTGTGAGGGCGGGGGAGTGTTTTAGGGGTGGATAAGCCAGACTGCGGAGAATTGAA
GATCCAGAATCAAGGGAAGAAATAAAGGATATTGGAGGAGATCCTCGGGGATGTGTGTCT
GCTTACAATTTCTACTCTTCATTAAGAAGTGTGAGAGCTCAGGCTGGATTGTGCTGTTGG
GTGAACAGCTGAATTAGATTAACAGCCTGCGCTTCCTGCCAGCTACACTTGGTCCAAGCC
TCTATGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved