Echinops_telfairi Locus PTCD3
snOPY snoRNA Orthological Gene Database
Echinops_telfairi PTCD3
Echinops_telfairi
PTCD3
GeneScaffold_583
SNORD94
55877..56013
58159
GGTGTTTAACGTAAGGAGAACCTTAAGATAATGTGGTACTAGTAGTGGCTGAAAGTTGC
GATGCAACCGTGATCAAAATGAATACTAGAGTGCCCTAGACTTAGGAGAGGAGGGCTGTA
GCGAATCTTGAAGGGTAATTCTTTTATAGACAAGACTGATTACGTGTTTAATTAGTCGCA
TAAAGGCCACTATAGTAACTCCACAATCGCTCAATTAACGAGGTCAAATAACGATGCAAT
TCGGAACTACTCCATCTCCACGCGGCTCGGCCGCTCCTCAGCCACTTAGCCCCACAGGCT
TCCAGGCAGCGCACGCTGGCGCAGGAGCGTTCCTGAACTACGGATCCCAACAGCCCATGC
GCCAAACGCCCGCAGACTCCGAGGAGACGGTTGCCCAAGTCTTTCTGGGAATAGTAGTAG
GCCAACACCTCCAGCGCGGCTGCGTGCGCCTGCTTCCCACCAACTCCTTACTTGAGCTCT
TCAGCCGAATACATCCCGAAGGAAATGCCCTGCAGCCGCCGCCAGGGCACGTTCTTGGAG
CCCAACATCTTGCCCGTCAGCTAAATGTTCCGACAACCAAAGAGAGATGTTCCAAATTGC
TCCTGGTCAGTGCTTCACTCAGCTTTCAGCTCGCAACCACGTGATTCAAGGTGCGCTTGC
GCAGGGAGAAACGCTGGCTGGCAAGAGATCGACACGGGCGAGGCCACCTCCATTGTAGGG
GGAGAGACTATTCCCACGACTCACTTTCTTACCTTGAAAACAACCAAAGATGCATCAAAC
CTTAAAGTCATAGATTCGAAAACCTTCTACAAGGCAAATGAAGCACATGAAGTAGAAAAC
TTTAGTAATTAAGGCTTTTAGGTCACAGGCTTGGTCTCAATTCACCACTGCTTTCATTTG
GTTTCGTCCCGGCCAATCGCGGGCTCTTCCCCGCCTACCGGATCCCTCGCTCCCAGAACG
CCCCGCGCGCGGCTTCCCAAGATGCTCCGCGGGAGTGAAGCATGGCGGCGATCAGGCCCA
TTTGCTCCTTGCGGGGCCGCTGCAGGCCTTTCCTGCCGACTGTCTGGAGGGCAGGTCCGT
GCGGACGGGCCCCAAACTGCAGGTAAGAGAGACGTGGAGGACGCGAGGGCCCCAGAAAGA
CGCCCAGCGTCGTCAGAGCCCTTATTCTGGTTTCCTCAAGTGTGCTGTGGAAAGTGCAAC
GAAGGACTACTTGTGCGCATGTGCTTTGTCGGCTCCCGCGGGCCGCGGGCCGTCCAGCCC
ACGGCCTTGAACCAGGCTTTAAGAATCATTGATTTACTTGGGGGCTGGTGAATTTGTGCA
GAACTCAAGAATTAGCATTGTTAACAAAAGGGCGACCCCACTTCTGTAGCGCTTCCATTG
TAGTGCGCGGCCACTAGCAACCGCACCTTACATTTCGAAAATATCATCTGCCCACTGGGA
AGAACTCGTGTCTACCAAATTAAAAGACCATTTGCGAGTGTTAATTAGCCTTTGCAAGAG
CGGATATTTGAGCATATAAATCAATAATTTATTGGATAAGCAGGATCAGATGTCCGTTCA
TATTATGGAATGCTGTGCTTGCCTCAGTTTGGAACATTATGCAAAAAATAGCTTTGTGAA
AATATGAAACAGTAACTTGTAGTAAAAAGTCAAGGGAAAACAACTAAATTCAGGATTTGC
TTCCTTAGTTGGATAGCAGCAAACAGTTTTTTCGTCACTGATAGAAGGATCCTGGTGGTC
AAGTGGTTACAAATTGAACTCTAACCACAAAGTCAGCAGTTCGAAACCACCTTGGGCCAC
TCTTGGGGAGAGAGATGAAGGTTTGTGCTCTGGTAAAGAGTTAGTCTGGGAAGCTCACAG
GGGCAGTTTCTGTACTGTCCGACAGGGTCGCCACAAGTCATCAACTCGATGGCAGTGTTT
GGTTTTATAGTCAGATTAGAATATTAAAAATAAATAAAACAGTCATCCCACTGCTGTCAT
CTGTGTCCATTCAGCAATCCTGTAGGACAGAGTAGAGCTGCCCCAGCGGGTTTCCAAGGC
TTCTTTACAGAAACCGACTGCCATATCTTTTCCCAAAGAGCTGCAGGTGGGTTTCAACCA
CCAACCTTTCTGTGGGCAACCAACGGTTAACCGCTGCACCATCAGACCTCCTTCGAACTA
GTATTGAAAAAAACACTACGTTCACTTTTATATTACCTGTCTAAAAACCTCCTTCAATGC
CTTGCACAGGAGAAAGTATCTGCTTGGTCCTGCAGAAGACTTAATGTGACTCCACTCGAG
TCATCACTGTCCTCCATTTTTCTGGTCCTCTTTTTCCAGCTAGGATTTCTCACTGCTGTC
AAATTGATTCCAGCTCACAACAAACTTATAGGACAGGGTAGAGTTGCTCCTATGGGTTTC
TGAGACTGTAACTCTTTCCGGGAGTAGAAAGCAACATCTTTCTCCCTTGGAGCAACTGAT
GGTTTCAAACAGCTGACCTTGTGATAAGCAGCCCAGCGCATAACCTATAGGTCACTGGGG
CTTCTGTGTTAGTGTCTGGTGTTGTCATTTAACCATTCTCTTTGCCTGAGAGCAACTTCT
CTAACTCAGCATTCAGCTTCAAGTTGCAGTATTTTGCCCTAATGTCATGAGAAGCAAATA
TCATTTGAAATGATTGATCCCTTTCTGAAATTCCCCCACCAGAGGAAGGTATTCACACAT
TGACATAAATATTCATTTTGTTCCATCAATGGTGTTGACTCAGAAATTTGGACTCGTAAA
GTAAAGGTGAGCTAAGAACATCATTAGTTAACATTAGCTTTAGTATCTTTGTTTTTTTAC
AGGCTTTCTTCTGGAAGTGAAACCCTCCTAAATGTTCAAGGAGCTGATGTAACAAGTATG
TAAAAATCTGCTGAAATCACTCTGTTTGGGGATCAGCATATTGTATACTAGTACTGTTGG
GCAACTTTGATAAACTTTGCTTCATTTTTCACATTAAGGTGTTGAAGAAGTGGTCATTCC
AAGAAAGAAAACTTGGTGAGTATTCGGTGATCTTAACAAATGTACTTACTGTGAGGGAGC
ATGATTGTACATGTTAGGGATGGGGGTAATGAGGGTCAATAAATCAGACCAAGTCCTTTT
TTTTTTTAAGATTATTTTATTGGAGGCCCTTACAGCTCTTATATCAATCCTGTCAAGCAT
ATTTGTACGTAATGTTGCCATCATCATTTTCAAACCTTTTTCTATCTACTTGAGCCTTTG
GTATCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTGATG
CGGAAAGCAGTGGGAGGAGCTTGTAGGAAAGGGAATGGCTGAGGTAGGGGAAACCTTGTA
ACTCCAGAATGGAAAGGAAGTAGATGGAGATTTGTGAATGAAGGGGAATGAGCTTTACTT
AGATGAAAAAGTTAAAAGACCCCGCTATATGGATTAATGTTTACTTAGGAGTTAACTCAT
GAACATCACTGTTAGACTAATTTCCTAAGGAAGTTACCTCACATGACATGGGAAATAAGA
CAAATTTGAGGTCATTATGGTCTGCGCTGCAAACTTAGCTTTTTTATTCGCTGTAGCCGT
AAACAAATCACCTGGTCTCATTTATTCAGCATTTGGTGAATATGTAAGACTTAAAACTTC
ACCTCAAAAGCGACTGCAGTGCTGCATTTTGGCATGGACTTGAAGGCCCCGGCAGAAGGC
CAGGTCTTTGTGAGTATGACCTGAAGGCTCGGTCAGTGTTTAAACCAACGACATTCTTAA
GTTATGAAAGTAATGACTAGTACTGAGTGGAAGATGGGGTAGTGTACCTAGCCTGCTAAA
AGGAAACCGTTTTCAGCAAGCCCACCACCCAGAGGCTGATTGATTGGTCTTTCTATGCCA
TCGTCAGGGAGGTAGCGACAACGCTGTATCTCTGTAAGTTAACTGAGCACTTGTAACAGT
ACACAGAGTGCTTTATCAACCCACTCTGCCTTTGTCACTCGAGAAAGCATTACAGCGAAT
GCAAAAGAAGCATTTTGCAGCATATGGCCTCAGGTAACTTGTATCATTTAGCAAGTGGGT
CACAGATATACGTAATCTTACATTCCTGCCCCACATACACAAAATAGCATACTGACTAGT
AGGAACTCAGGGTGTGATAGGCACAAGTGGGAGGGGTTGTAATCCACGAATGAAAGTGAA
GGGGCACCGATAGTGTAGTGATTAAGAATCGGGCCACTAATGCAAGGTTGGCAGTTGAAA
ATTACCAGCCACTCCATGTCTTTCTGCAGCCCAGTCTTTCTACTTCCGTAAAGAGTTATA
TATGTATTAGCTTAAAAAAAAAGTGTCAAAAACTCACAGGAGTAGTTCTGCCTGTCCTAG
AATGGACACTGACGTGACAGCAGTGAGTGAATGAATGAATAAAGGTGCATTTTGTTGGAA
TTTAGTTATACCTTTAAAATACTACGATTGTTTTATTGGCATTGGATGCACCTGAGGGTT
TTATTAAGCGTGCCTATTCCTGTAGGTAATTCTTGTGAACCTGTGAAGTGTAGAGCCACA
ATTACATAGACTAAGGTCACAATCAGTGATGGTGGGAGTTGGAGGCCTGGGAAGAATGTT
GTGTTAGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGGGTGTGGTTTGGCTGGTCTTTTCCTCATGCTTCCCTTTACCA
TACCCTTTGCTTGTTACTGCAGACGCCTGTGCTCACGTCCCCAAGACCTCCCGGGTCGCA
GAGTTAGGAGAACTCAGAGGACTCAGCATGTGGTGGCTGAGATTCATGAAAGCAACAGTA
GCAGAGGGAAAAGTGCATGGGGGAAGTGAGCAACCAAGCAAAACCTCCCCGGGTCTTCGC
CCATCGCCCATCGCCCAGTGAAGTCACACAGGGCACAGCTAATTCTAGCACTGAGCCGTG
ACTGAAATGTCTACAGGGCAAACTTGCTGGAGACTTGGTGCGTGCGGGGTTGTCACTGGG
TGCTAGGCATGTAGGAGGGTGCCCGGAGGAAGTGCAAATGGTTTTCTGCACTTCAGTGCC
TACCGAAGGCGTGAGTAGTTGGACCCTACCCAGTGGCCCCTCAGAAGAAAGGCCACTGAG
AAGCCCGGGGAGCTTCGTGCTGTGGCATGCATAGAGCTGCCAGAAGTGGAATCAACTTGC
AGCAACTGGCTTAGTCATGCAGAACTCCCTGCCTAGCACGTAAGACCACGCCATGCTTCC
CCAAGGAAAGCCGGCGTCCAGTGTAAACCACCCTTTCCAGGTGAGGCACACTCAACCACT
CCCCAGTGCTGGGAATGGTGAGAACCCACCCAAAATAGTTGAATGGAAGTGGTGACCTTT
GAGTTGAACTTAGAGTGGCCAGTGCCACTTGGTTGAGATGGAGAAGATAGCGGGGGGAGT
CGCTTTGTCAGGCAAGTTGGTTTGGGGTGTTTGCACTGCAGGGCCGGGCTGGAGAAGTTG
TTTCCCAGACCATAGTGAAAATCATTGAGGCTGAGGTGGGAAGAATAAATCCAGTAAGTT
AATCCAGCATGTCACCAAAACTAGAGTTACTGGGAGACCAAATAGGTGTGTGGGTGTGAT
AGAATTGGAGCTGGAGGCAGGTGGCTTGTTTTCAGAGTGTAGTCCAGAGCTGCTGTCTGT
GCCTAGACTCTGCATCTCCGCAAAGAGCAGTGTGTTGTCACTGTGTGCTGTAAAGTGGAT
TCTAACTCAGTGACCACGGTGGAAGATCGTCGCATAGTATTTTCTTGCCTCTCACCTTTC
CCACGCTCCAGGTCTGTCCCAGAGGTGCAAGGTAGATTCAAATTACCAACCTTCTGGTTC
ACGTCCAAGCACTCAGCCAAAGAGGAAATGAGCCTCGTATGGAAGTGGGAAGAGCCAGAG
CTAGAGAGTGGCAGCAGGAAAGTAGGACAAGCAGAATACCAACTCCAGGCGTGAGCAGCC
TTCTCTTGAGAGCTGTAGGTCACTGCCCTCGGGAAAGGCCAGGCCAATAGGCCAACTGGC
CGTGGTACAGAAGGGAACAGGCATTCCAGAAAGCCCAGGAAAGAGGGTACAGGGAGTGGT
TTGGGGCAGTTCCAAATAGGGCCTTTCGTGGTGCTGGAGTTGGTTTTATTCAGCGCTCTG
GCACTAGAAATGTTTTAACGGAACCGTGGACAGCAGGACATGGTGAAGTTGCTGCTGCTC
TGCCTCTGGCAGGGGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGAGCAGTCATAGGTGCGACCTT
GTTGTTGGGTGATATAGCCATTTCTTGGAGAGCTGAGAGACTAAGTGTACGTATCGTGTG
TATGCCTTCTCTGTGTATGTGAGTATTCACATGCTGACATAAACCAGGGGTTTCAAACTG
TTTGTGGGACGGTGACATTGACAGATCGCGGGGCTTTCCCCTTTATAAGAATTATATAGA
ATCTTACATGTGTAATTAAAGCGTGATTTGTAGAATTTTTGATCACCAAAACTCACAAGC
TCTTCTTCATAACTATTTAGCTAAAGAGACTCTGCCTTCTCCACAGGACCCCACAGCTGT
TCCCTCTGCATTTCAAGACGACCCATACCTCACTCCAACCTCCACTGTGGAGTCTGTGAG
TGTTCCCATGTAACTTTTCTGGTGCTGGGCTTTATCCTGCTGGTTTGGGTGCAAGATGCA
TATATCATTTAACTTCATTGTAAAAACCTATTAAAAATTGCGGCTCTTGGTACAATTGGT
AGGCTTTCTGAATCTTTTACTGATTCCCCCAACCTCTCCCAAAACTGACTGTTTTAGTTT
TGAGTATTTAGGAATCTTCCCCACTTGAGTGGCCCTCTCAGTTAAGCTGCACTAGCTTTC
TGCTCCCATAAAGAGTTACTGCCTCAGAAACCCACAGGGGCAGAGGGGCCAGGACTGCCC
TCTCCTACAGGGTCACTATGAGTGGGAATTGATTTGATGGCAGTGAGTTAGAGTTAGAGT
TTGAGTTTGAGTTGTCCCCCTTCAGATTGCCTACTGTGAGCTGGGCTTGTTCCCTCGCCC
CTGGTGGAAGAGGGGTGTAATACAACATGGTTTCTAATTGGGATCCAGTGTTGTGTGTGG
TCAGAATATTCTTGCTTAGGGTTCAAATTTGCTCTATAAGTAACCAGTTGATATTTTAAT
CTTTTTTTCTTATGTAGCGCTTATTTTTATTGGCAAAGAAGTCTGGAGCGAATGCAGCTA
AGTTTATAATTAGTTCATATCCCAAATATTTTCTGAAGGACATCGCTGAACCTCATATAC
CGGTAAGGAGAGATAATTGCAAGTTTCAGATAATACTATGTATAATTATATAGGTATAAA
TTATGCTCTCCTGGCTAACACTTGAGTAATTATTTAAATGCCCTCATTTCTTGAGGGAAA
GACCCTTTAACAAGTAGTGTTACCTGTTTCATGATACTAACTTTTTTGACTCTTCCTTAA
ATATATTTGCTCCTCGTAACTTTGTTTTCTGTGACTTGGCATCCTTGACACCAGTTTCTC
AGATCTTTATTTGTACAGTTTCACTAAGGACTCCTTAAGCAATTTGTTGGGTTTCCTGCT
CAGTCTTTCTTTCTCTGCCTGCAATAGCAGGCTTATAGCCCATTTGGCACTTAAATCCTA
CTTTGCACTCCAAAATGTATTTCCAACTACTGTATGTACTTGTGTACAGCCGAGTTTTTC
AGCACATTTTTATGCTGGGAAACACCACCCCCCCCCCCTTGGCTTATTCTCAAGTGAGGG
TCCCACTTACCTGTTCACCGTGCAGTGCGGGTGTTCTCCGGTCTCTCCCGCTCATCTGCG
GGCACCTGCAGCCTCTGTGGGTGGTCCGATGACTGCTGATATCACCGCTCCTCTTTTCTC
CTGCACGCCGGCAGCCTCTGTGCTGTCCGTGCCGTACTGGGCAAGAACCTGCCTGCTTCT
GTGTGCTGGTACCTGGGGCGCACGGCATCCTTGTCAAATGAATGTCGGATGTAGCCACTC
TTCTCCAGGGCTGTGACCAAGGACGTAGCCTTTACCGTCTTACCTGTACTTGGTCACGCC
GCCTTGCTCCACCCAAGCATTGCTGAATACAAGTACCGGTGTATCTCTGGTCTTGGATAT
ACAGTACGTTTATATACAGTACTTAGTCTGCTATGTTTTATTTTTTATTTTCTTATTAAC
CCCTATCTGGACTAACCCCTATCTTAATAACCTCTATGCTTGCATAGAGCAGCCTGTGCT
GGGCTCATCATATACACACTGTGTTGTGTACACACNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTCATAAGCTTTCGTAGTTGTTTGTG
ACTTAATTTCGGGTCGACTGATAGTCTAGTATGTGCGGTACTACTTTGTCTGTACAGTGC
CTGCTGAGTGTCATTTGTGCTCATTGGACATGACAAGTGTCCCCGTCCCTTGTGCTTATC
AGTAGAAATCAGTACCTCAGGTGTACCGGTGTACTGTGTCCAAAACTAGTCCATTCTGCT
CAAAGCTCCCTGCTGCTTAAAACCCAAACAGCCCTCCTTCTCATTCATTGACTCCTCGCA
GCCCGTGAGGAAGCCAGGACCGTCATGTGGTGCACATTGAACCCCAGGGGAGACAGTTGT
AACCGTAGCTCAAGGTTCCCTTTTGCTAGAACAACTCCTATGGGATCCTGACCTCTAGTG
GGCCCTTGACCTAAGCAGACCTAAGTTCAGCATCTAGAAAGCTGGGAGGCAGCCAGACAC
AATCTTGTTTTGGAGTTGGGGGAGGGGCTTCATTAGATACTTAATACAAGAGACGGTACT
GTGGATGAAACATGAGTTGGATGAGTGCAGTAGTTCTGTTTGGTGTGTAGGAAACACAGT
ACGTACCCTATTCAGTTGTCCTTTTACTTCAGCCTACATGTGGTGACTGGTTATTTTGTT
TTTCTAGTGTTTAATGCCGGAGTACTTTGAACCTCAGATTGAAGGTGTAAGTGAAGCTGC
CCTGGAAGAAAGAATTAAGCTCAAAAAAGTCAAAGCTTCCGTGGACATGTTTGATCAGCT
ATTGCAAGCAGGTAGCAACATTTCAAAAAAGTCATTCTAAGAAGGTAGTCTTTGAAGATG
GGTCAGAGTCCCTGGGGCTAACATTTCAAGCACTGTTGTATTTGCGCTGCTAGTTGGTTG
TGCAGTTTATGTATCTGATAGTGTAATAGGTAATCACTTTCTGCTTGGCTTCATCTTAAA
CAACATAAGAGTTCCAACTTGGGTAACTTACCCTCATGTGCTCGACCACAGGTAGAAAAA
GTACCATCTTTCTTAGTTTCCAGTCATTTGTAAATGTCAGCTGGGTACTGGGTACTAAAT
TAAATCGACCTATCCCTTGGTGGCATAGTGGGTTACGCATGAGGCTGCTAACAGCAAGGT
CAGCAGTTGGGATACACCGGTGCTTTGGGGAAGAAAGAGAAGGCTGTCTCCTTCAGTCTC
AGAAACCTTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNAGTTGCAGTTGGCAGTCACGTAGAACAGAGAGCACCGA
GCCTTCAGATCTGGGGCCTGGATAGTGGTGTTCGCTCGGACACTAACTAGCTTTACGGCC
TGAGAAAGGTCGCTGAGTTGCTCAGAGGGTCTTGAAAATCTTGGTGGTGAGTGTGGTCTG
GATGACCCCAGGGCTGTCGGTCCAGCTTGCACGGCTGAAACGCTATCAGGAGAGCCCCTG
TGGAATGTGGGAGCACCAGCATGATCTAAGGCAGAGCAGAGCCTATGCTGTCCATAGCAC
AGAACACCATTCTGACAGAAACTTAGAGGAGCTGCGGGTTTTACAGTCACTTTCCAAAGG
AACTGGTGCTGCAGTAATATTCCCGGGATTACACAGCACCGAAACGACAGGGTTGGCTGC
CTCCCCAGGGGAATGAGAGTCCACAGCCTGTGCCCTCTCCACTAGGCCAGGCGCTGTCTT
CTGGGCTTTTTCATTCCTTGAGCAATTTTATTGTCAGCGTATTTATTTAGAAAGGTGTGA
TGTAAAATAGTAAATTTTGCCTCTTTCCTGTGCCCTTTTTGTAATTGAGTGTCAAAATGA
GAACATAGTGCTTTTAGCATCTGGGTTTTTTTTAATCATCTTATTAGGGGCTCATACAAC
TGCTATCACATTCTATACATACATCAATTGTGTAAAGCACGTTTGTACATTCATTGCCCT
CACCATTCTCAAAACATTTGCTCTTTACCCAAACCCCTGGCCTCAGCTCCTCATTTTTTC
CCCTCCCTCCCTGCTTCCCTCTCCCTCATGACATGACCCCTTGATAATTTATAAATTATT
ATTCTGTTATATCTTTCCCTGTCCGACGTCTCCCTTCACCCACTTTTCTGTTGTCCGTCC
CCCAGGGAGGAGGTCACATATACATCCTTGTACTGTAATCGGTTTCCTCTTTCCAACCCA
TTCTCCCTCTACGCTCCTAGTATCGCCATTCACACCACTGGTCCTGAAGGGATCATCTGT
CCTGGATTCCCTGTGTTTCCAGTTCCTATCTGTACCAGTGTACATCCTCTGGTCTAGCCA
GACTTGCAAAGTAGAATTCGGATCATGATAGTGGGGGAAGGGAGGAAGCATTTAGGAACT
AGAGGGAAGTTGTATGTTTCATCGTTGCTACATCGCACCCTGACTGGCTCATCTCCTCCT
CGCTGCCCTTCTGTAAGGGGATGTCCAATTGCCTACAGACAGGCTTTGGGTCTCCACTCT
GCACTCCCCCTCATTCACAATGATATGTTTTTTTTGTTCTGATGATGCCTGATACCTGAT
CCCTTCCACACCACGTGATCACACAAACAGGTGTGCTTCTTCCATGTGGGCTTTGTTGCT
TCTGAACTAGATGGCCACTTGTTTATCTTCAAGCCATTAAGACCCCAGACACTATGTCTT
TTGATAGCCGGGCACCATCAGCTTTCTTCACCACATTTGTTTATGCACCCGCTTTGTCTT
CAGCGATCGTATCATGGAGGTGAGCACAGTGATAGGATTTTTTGTTCTTTGATTAGCATC
CAATTCTGGGCAAGCCTCTCAGTGCAGACCTGGGTCCCAGTCGAGCGCTGCTTACATTTG
TCGAGGGGTGGGCATGGTGGGTATGGATGGCTGGGCTCTGGTGGATATGAAAGGTGAGCC
CTTTGACACTCAGGGCTTCTCTCTCTCAGGATTTGAGCCCATCAGATAAAGAGCTGCATA
TCAGACTTCATCGTGGTCTATAGTTGTTCATGTTAAGCTACATGAGAAATGGGGAAAATG
TCCCTGTCTGCACCTCTCCTGCTGACACTAAATTGGTAAAGTGATGGGTGATATTAAGTC
TAGCCAGCGAGTGGAGTAAGTGACAGATTTCAGCATACTGGCTTTTGGTAGTTCTTGTGT
TTTCAAGGTTTCTTTCTTCTCCCCACACAGGAACTGTTATCTCTCTGGAAACGACTAATA
AGCTCTTGGATCTGCTCTGTTACTATGGTGACCAAGAGCCCCCGGCTGATTATCATTTTC
AGCAAACTGAGAAGCCAGAAGAATTGGTAATCAGTCGCCTTCTATAGTTCATAAGGGTAG
ACCTGGCATTGGTTTCAGTTGCCCCTAGAACCTCTCTCGGATTAACGTAGGCTCTGGTCA
CGTATCCAAATAAAGGTCAGAGCCTTGTGCTGAGACGGAATGCAGCAGCCTGACACTCGG
TGGTGTGCACACGGGAGAGAAACGATTAATGTAGCCCGACGTCCCTTTTACAGATGCGTG
GGCTGGTGTCACTTCAATGACAGTACGAAGCAAACAGCCAAAAGATTCCTGGTCCCTGGC
CCTCCTGAAAGCCCGTGCACACACAGGCCAGAGGAATGGCCATGCTAGACTGGGTGTACC
AGGCACAACGTGCCCGGAAGGGCTGGCCTGCGGTGAATGGCACCCATCTCAACGCTGAGT
TTTACTCTTAGAAATAGCTGCCCCCAAAAACATTTGGATCAGATGCACAAATATTGTCAG
TGTCAAGTTCTGTTTCTCACCCCACAGCCCCCACTAAAAGAAAGGAGTAGGTTGTCTGAA
TGCTGGTTATTGGAGAGTGGTTGAGAGCACTAGTGTAGGTCTGTTTGGGTATGGGAAACT
GAGATGTTAATAGAAGCCCACCTGTCACCAACTCTGACTCAGTGACAGGCAGTTGAACCT
CCTCCCTACCATTAGCCTTTCCAAGGCTGTAATGTTTCCAAAATCAGATGATCTGGTGGG
TTTGAACCATCGAACTTGCTGTTAGCCCTGGAGCTCTTAGCTACTGGCCACCAGGACTTC
TTAGACAATGAAGTGGAGAAGCAGCATATATAACCTGTAATAACGAGCTTACAAAAGTGG
TAGAAAAATAAAATCTAAAGATAATACAGGTTTTCCACAAATATTTTGAAACCCCTGTGT
ATATTCGCTTGATTTTATAAGTATCGTTTTACATGTGTGAAAATGAATCTGGGTGAGCAG
AAGGCCATCCCAGCTCTTCTCCACTAACCAACCTGGGGCCTTCCTTGCCAGCCCCCCAGC
AACCACCCTCCTGAGGCCACAGGCTCCTGAGGCAGCTTGAGCTATGCAAGCCAGGTCTGG
CTGGCTGTGTGTCAGCCTGACCCAGATCTTGATCTGTAAATGTGGGGCAGTTTATTAATA
AAAAGAAAACACTGGCTGCATTGCTGGTCAGTGCTTACAAGTGTTGGGACTGGACCAGAC
ATCCTGTCTCTGTAGATCGGGTGTCAGGGTGTCTTCTCTTGCCCCTCATGATGAAGAGTA
TTTTTGTGTGGATTCAGCCAGATAGCGTTCAATGTATGTGCTTCCTCAAGAGACAGACTG
TTGCGTGGCCTTCCAGTTTCTTTCTCTCCTTGGGCAAGGCCTGATGGGGCCAGCTTTGCT
TTTCATCTGTAAATTCTCTGATCGACCATGCGGCATTGTTACATAGAGGTGTGCACGTGT
ACTGGTCTACGCTTTTCCTTCTGATGGGTCTGTTTATACTTCCGTGAGGTTCTTTTTGTA
GTGCATTCCATTGTGGTCCTAACTTTGATTTAGTACCTGCTAATGATTCATTTCAGGAAG
AGGCCACAGAGGAAAACAGCGAGAAGTCTAGGAAGAAGATTGGTCATCAGCTCGGATTAG
CTTGGAAGTATGTTGTCGTAATTGATAACAAGTTGATTCTGACCATAGGGATCCTATAGG
ATAGAATGTAACTGTCCCCATGAGTTTCCTAGGCTGAACTCTCCTACGAAAGAGGTTGGC
TGGTCTTTTTGCCCCCAAAGTGCTGGTGGGTTTGAACTGCCAACCTTTTTGTTAGTAGCT
GAGTTATTAACCGTTACACCCGCAGGGTTCCTTAATTCATTTGAAGTTCATATTACTATC
TAAGGTGCTCTAGTTGTGCTGTCAGCTTATATATGTTCGGCTCATAACCACGAGGTTGGT
AGTTCAAATCCACCAGCCACTCTGAGGGAGTAAGATGAGGCTGTCTGCTTAGGAAAGATT
GGCAGTCTTGGATACCCTGAATAGGGTGACTCGGAATCTGAGTCACATCCATGGCAGTAG
GTTTGGGTTTTTGGTATTGTTTCTTAACAGTGCACGAGCACGCTCATCATCGTCCCACAC
AAAAATGCGTTCAATAATATGAAATGTAGTTTGTTTTTAATTTAAAATTTGTATTTGCCT
CCATTTGGGCATTTCTAAATAAATACCCTGCAACACGTGTTTTTGTAATGTGGCATATGT
GCGTAGAGTCCATGTATACATGTATACAAAGAAACCATTAGTGGATACTTGTGGGAAAGT
GTATGTGCGGGGTGGCAGCGGGTGGGGAGACTTGATAACATCCTGGTTCTGCCTTTTGAC
GGCATAACTGGGCAACTTAAAGCTGAAGTTCTCCTGGGCGTGGTTTTCCTCACTTTCAGA
GTTAGGATGGCCGTATCTTCCTCGGGGTGCTGAGAGTGTATGTGCAGGGCACACTGTGGC
ACAGTGCAAACAATCGGTGGTAGTGGTATTGGCGCAGCCTGTGTCCCTGGCTCACATTGA
CTGTCTGTGTCTAGAGAAAACAACAATGCTGAGAGGATATTTGCTCTAATGCCAGAGAAA
AACGCACATTCCTACTGCACAATGATCCGGGGCATGGTGAAGGTTAGTCTTTTCTGTTTG
TACTTCTGCTACGGCAGGATTTCTCAACCTCAAAACTGCTGGGGGACTGACCCATACATA
TAACACATTTCATGGCTCCTTGGCCATGGGTTCCATTCTGACTCGGCAATCCTGTGGGCA
CAGGAGAGAGCCAACACCGCCTCTTTCTCTCTCAGAGCAGTTGGTGGTTTCGAACAGCTG
GCCTTGTGGTTAGCAGCCCAACCCATAACCACTATGCCACCAGGGCTCCCCAGGAAGGCA
AAATAAGAAGCATGTCTGCTTTGTTTGCTGCTCTGTTCCCAAACTATAGCAGTCATCGTG
CATGTGATTTCTTGAATTAATTTTGCCCTTTTAATTTTTCTCCTTCTAGCACCGAGCTAA
TGAGCAGGCATTAAGCTTGTACTCCGAATTATTGAACAGCAGACTTAGCGGTGAGTGTGC
CTTCAAGAAGGTGTGTGAGCGGTCTGGCTCTTCCTCAGGGCCTGCTTTGTCTTGGCTCTG
ATATGTGAGACAGGATTGGAGAAGGTGGCTGCCACCTCAACTCCACATTGGACTAAGGTC
GTCTCCTTCCTTTACAGCTGATGTACACACCTTCAATGCTTTGATTGAAGCAACGGTGTC
GGCCATGAATGAGAGATTTGAGGACAGGTGGAAAAAGGTGCAGGTAAGGAGGCGCCCTTG
TTTTGTCTTCGAATAGGCCTCGGGTGCACTGGTAGCTCTTCACTGAGTGTAGGGTAAGTG
GCTGTGCATGGCTCGTGGGAAGAATAAACTTAATTCCCTCAGAGCAGACAAGTAGAATTC
ATGAAGATCTGGGTTTTATTCATAGGTGTATGAATATGTGCTTTTTTGCAAATTATAGAA
AATGTATTTTAAAACCGATGTAGCAAATTTGTTGTAAAGTTATCTCATAAGTTCTAAACA
TTAAAATCATGGAATTGCTGTTTGGTAACGTGGAGTAAAACGTGTGCTTGTATTGTACTA
GTTATTTTAAAAAGCACAAACTTAAAAGTCCATTCTAGCATCGTCTTTGCCTTGAGCCTT
CTTTCCGGGAGGACTCACTGGATGAGGGCTGGACCATGAGATGTCGTTGGACGCATGCGG
GCACTTCTGAAGTGCTTCCCCAGCAATGTCACTGGTCCTGCTGATTAATAAAATAACTCT
GAAATCAGGAGTTTTGGTAACTTGCTATGGATGTAGCCTGAATGAAAAATTCTTCCTCTT
TTTTGCCTTCGCTCAAATAGGAAATACTGTCATAATATCCTGGCATAAACAATTATTTCC
TGCTTTTGATGAAACAGGAACTGTTGAAACACATGGTTGCACAGAACGTGAAACCAAATC
TGCAGACTTTTAATACCATCCTGAGATGTCTCCGAAGATTCCAGGCGTTTGGGAAGCTGC
CGGCTTTGCAGACCTTCCGGGAGATGAGAGCCATTGGAATAGGTAAGGAAGGGTGCAGGC
AGGTTGCTGGCTGCAGGTTCTGGGTCCAGAGCGTGCAGGTCGATAGTGGAAACACCTACT
GGTTGCCGTGAAGGGCTAGGGACTGCCTTCCTGGCTTGGAAGAGCCACGGGGTCATCTTC
ACCTTACAGCCCCCTTTAGTACCTTACACCGGTGGTTCTCAGCCTTCCTCATGCCGCTGC
CCTTTCACACCGTTCTTACATTGTGCTGACCCGCGACCATACCGTTAGTTTCGTTGCCAC
TTCTGTACTATAACTTTACTAATGTTATGAATCGGGCGACCCGTGAAAGGGTTGATCGAC
ACCCCCAGGGGGTCTGACCCACATGTTGAGAACTGCTCCCTTGTTAAACCGTTTTTAATG
AGTTTTTTATTGTGAATCAGGTGTGTGGGTGGGCAGGGTTACTTTCCCGACCAGGGCTTC
TGCACTCATCCATTAAACCACTCATCAACACACACTCTGCCTCCTCTGAACGCAGCCACT
TCTCTTGACAGGCCTCCCTTCTCCCCCAGTCACCCAGGTCAATATCTGGCAACCTTCTAG
GCCAGCCGTGCTCAACCTTTTGGAGGTCAAGCGCCCCTTTCTCAGGGATCACCTAAGACC
ATCAGAAAACACATATTTTCAGTGGTCGTAGGAACCGAGACACCTCTCCTCTATCCGTCT
CCAGGGGTCCACCCACATGCAGATAACACCCACGTATGAGCCCCTGAAATGTAGACTGTT
ATCCGTGCTACACCATGCTTCAAGACAAAATTTCACTTAGTATTTGTCATTAGAAATAAA
TATTCCACAATATATAATTACATATTGTTTTTGTGATTAATCAGTATGCTTAATTATGTT
CAGTTTGTAACAATGAAAACATTATGCATATCAGATATTTACACTATGACTCATAACAGT
AGCAAAATTACAGTTATGAAGTAGCAACGAAAATAATTTTATGGTTGGGGACATCACAAC
GTGAGGAACTGTCTGAAAGGGTTGCGGCATGAGGTTGAGGTTGAGAACTACTGTTTTAGG
CGGTTGCTTCTCTTCCCATCCTCTTCAACCTCCCTCAGGCACCTCCAAAGTCTGTCCCCT
TTGGTGGACAAGTCTGTGTCTTGGTTTTTATCCTAAGCGGTGTCTGTATCTGCCCTTTGG
GGACGGACTCCCCTCAGCAGAATGTCCTTCAGTCCCTTTCAGCCGGGAGGTGCTTCGGAG
TTGTGGTCCAGTGTTCCAGTGTGTGTATCTCTGTTCCTTTAGCCATTTCTTTTGATGGGC
GTTTCGGCTGTTGCCACCTTTTTGCTGTTGTGCACCGCACTGCCATCAACATGAGAGCAC
ATATGTGTAGTCATTGTCCAGCGTTTACTTTTAGAAAAATCCCTGAAGCTTTTCTGGCTT
GTTCTTACTTCTTCAGGGAATAGTAGTCAGCAGAAAGGATTGCTGGCCTGTAAGGAATCT
CCATTCTCAGTTGTTGGGGGTAGCACCGTACTACCTCCGTGGTTGTATACCTTAGTGCTC
TTTTATTTCTTAATTGTGTACAGAATTCTGCACTTAGAATAGACTGGCCTCAAATTCTGT
GACATAGTCTAGCAAAAGGAAACATGTAACCCAGATGTGTGCTTGTGTGTTGTGTCATTG
TGCATCATTCTTAACTGAGAATCAGGGTAAGAACATGAGCTGTTTCGTTTTTATAGTAGC
ATTAAGACTTGCAAACATGATGGGATCTATACAACTATTTTCACCTGACCAGAAATGAGT
CTTGATTAAATAACAACGATACGTTTTTAGTTCAGCGTACAATGATAAGATATATTTTGG
ACAAATTTGTTTTGACTTATTTCTTTTTTTTTTTCTCCACCTGGTAATTCAAGAACCCTC
GCTTGCAACATATCACTACATTATTCAAGTATTTTATCAGTCTGGTAAGTATTATCTTAC
GTTACGTTGCTTATATAGAAAATTAAACAGCTCCCTTGAGTTTACCTGACCAGTTGTTAC
AAATTTACATTAGAACTATACACAGAGGCTTCAAAACACTTTCCGAAAGGTAGGATTGGA
AGGTAAAATAGAATTTACCCATGAGCCCGAGTCCTCCTCATAACCATTTGGATGCAGACA
TTGTGGATACGTGAATTGATTTGTTTGACTAGGAATATTGGAGGTGGGTTTTTTGATACA
TTAGTACTCAGTCGTAAGACTGAAAGGACTGCCTACAGGTTTTAGCCCTATTTCCCCACT
TGGTTTCTTATCCAAGTTGTATTGTAAGGGACATGGCTATTTGAATGGGTGGGTCAGTTC
AGAGGGGGTGAAAGTCAAGCTGAAGAGCCTCTGGTGGAGCCGAAGGACAAAGACCTGTGG
TCTCCCCAGATGAGCTCCGGGCTGGAGAGGGAGGGAGGAGAGTGTGCCTCTGCACTGGGG
GCAGGCGTGGCAGTGGTGGAGGAGATGGACTTGCTTGACCCGTTTGTATCCTTTGCAGAC
AGCGCTTCAAAAGTATCATCCCCTATCATCTATGATATAATGGATGAATTAGTGGGGAAG
AAATTTGACACAAGGGACCTGGATGATGGTATGTCATTTTGCTCATCTAAACCCTGTGGG
CTTTTGGAGTGCTGGTTAATTGAGGCTTTGTATGTTATTTGATGAGCACAGGGTTTTGTA
GTATTTTGAGTGGTTATTCGGCGAAAGCCAGAGTGTCTGGCCATTTGCTGTGCCTCTTCC
CTCTTTGTTTTATTCCTTTAGCTTTATCTTGTGTATTGTCAGTTATATTGCCAGGATTTA
TTACTGTTACTTCCTGGAAAAACTCTTTTTGCCCATCCTAACCATGGCTCTTATGCACTT
TGGTTTTCAGATATGTTTTTTCAGTCCGCCATGCAAGTTGTGAGTACCATTTCTGGTTGA
GTCCTTCCCCTGGGGCCCTCATCGTCCCCGGTCTGTCCTCGGACCGTGTCTTGACTCAGT
CTGCCTTCCCGCGCGGCTCCTTTCACCTCCCGGCACTCACCATGCAAGTCTAGCTGCCGG
GGTTTTTTTCTTTTTCTCTGACATCTACTGCTATTCCTCTCATAGTGTCTTTACCCTGTG
TTTATTGTTTAAATTCCCCTTTTCTGTATTTCTGTTCCAGATACGGCTACAGAGCATTTC
ATTCATTCCTGTTCATGACTTTTTACTTGACAGTTATCATATATTTTCAAGTGGTTTCAG
AATGAATGTTATACCCTGTTACCTAAAGATAATTGCTTTGTAGTGAAATGTGTATCACTC
CTGATTTTTTTCCCTTTGTATGTGAGCACATCTCTCCCTATATGTACCCTGTGGGGGAGG
GACTTTGATGACAACACACTAGTGCATGGTGAGAAAAGACTATTGCTTTCATAAGTCAAT
AATAAATATTGGTACTTTTCAGGCCTTTTCTCTCAAAGACCTAGAACTTGCTTATAAAAT
ACATGGCCTTTTGAACACTGGCGACAATCGGAAGTTCATTGGACCTGATTATCGGCGTAA
TTTCTATTAGTAAGTGTGCTAGAAATGTGTCTTTGGGCAAGAAGTCTAAGTGACCATGAG
TAGAATGGCCAGCGAGAAGATGTTGGGGGCCTTCCTTAGCGTACCTGCACTTATTGTAAG
GACCAGGCCCCTGATTTAATGAAACCCACTGCCGTCGCTTCTCAGTGGGTCTGGGTGTAT
CGGCTTCTCTAGGGTTTTGAGGCTAAATCGTGGTGGCAGCAGAGAGCGCCATCTTTCGCC
CGGGGAGCAGCTGCTAGGCTGAGCTCCTGACCTTGCGGCTTGCAGCCCTGTGCTGAACCC
CAACCCAAAGTGCCACCAGGGCGCCGGGTTAAGTGGAAACAGTTCATTGAGCGCTTTATC
TTTCAAGCCCATGTAATCTTTTTGCCTTACCTCTACTTTGCAGGTTTTGTGTTTTTTGAA
TTTTGGAACAGAGTGGATGGGTCACAGAAAGGGGCTGTCTGGCTTGTTCTGATATCTTCC
CCAGCACCTTGCTTTTGTTTTTAAAGAACCCAGACTGGCTCTGTAAATGGATTTGCTTGG
GCAGATGAGCGCATGAATGACAGGTGGGACCCTGTTAATTGGTGTGGTGATTGCTGCCAT
CTGTGCTCAGATCCTTGCCTCACATGGAATGTTCTCAAATGAGTACACGTAATTAGCAGC
ATGGGGATTATATAAGGTGTCAGCCTGAAACTGTGCCGTATTACCGCCTGGTGTTAGGTG
TGAGGAGCCCTGGTGGCCTGTGGTGGGTTACTGGTTGAGCTGCTAACCACAAGGTCAGCA
GTTCAAGCCACCAGCTGTTTCCATGGAGACAGCTGAGGCTTCCTGCTCCCATCGAGGTTG
ACGGCGTCCGCGCCTCTGTGGGAGTGTGCCCATGGAGGCAGTGAGTTTGAGTGTTGCTTG
GGCGGGGGTTTTCTAACTCGCCTTTTCTCTCAGTGGCAGGTTCTTCAGTTTGCTTTGTCT
GATGGAACACATCGATGTCACCTTGCAGTGGTATAAGGACCTGATACCTTCAGTAAGATG
GTTCATGGCTTAATTTACCATCGCGGACAAGTCTGTGTCTTTATTAGTGCTGTTAAAAAT
GTACTTGAATTTTTCTCAATTAGGTCTTCTTTCCCCATTCCAAAACGCTGTTAGATCTTC
TTCAAGCCTTGGATGTGGCCTGTCGGCTAGAGATGATTCCTCAGGTCTGGAAAGGTCAGT
TTCACCTTGTGGGGGCCTGACCTCTGTCCCTGGTAAATGCCCTGTGTATGGTGAACGAGC
ACATAACCATTGTTAATGATAGCCACTTCCACTTTGGACTGAATTGAATACATTAGCTGA
AGGCTGCTCCCAGCCCACTTCTTCATGTTGCACATTGGATTGTGTAAGTTAAATGTGCTA
AGGACCACCTACCTGAGAGTCTTCCTCTTCCAGACCCTCAGTCTGATCCCATGTCACGGG
CTCCCTGACTCGGTACCAAGTGGCATCAGTTGGTTTGGTTGCTCCCCGAAACCAGCAGTA
CTTTGTTTCTAAGCATAACAACCGTGATCATGGTTTCTGTGAGCTGTTCTGTCTTGAATT
GATTGCAAAATAAGACATGCACTTCTAGGGGATTCCTGTATTAACATCCATTTCTACCTT
CCGTGTCTGAAAACTAGAGCTTGCCCTTTTAATTTGCATTACTACTATAATTGCGTATAA
AAGATTGAAACTCCCAAAGTATTACAAGACAGTGACTTCCCATATGGAAGTGATGACTTC
CCGTGTGCTACGTGTGCTTTGTTGAACGGAATACCAGGCCCACTTACACAGCACCTGATT
AGAACAGGTTACTGGCCTTGGCTCTCACTACTGTTTTTACTCTTTGTTGCCTTGAATTAT
CCTGGTGGCTTTCTGGAAGCTGGGAACAGATACTGTTAGCCACTTACTTTCACCTTCCCT
GATGAATGGTTGTCAGCTGGAGATGGACAGAGGTCAGCCAAAGCTGCGTTGGGCTTACGA
GATGAAGGTCACTCATCGCTGTCCCTTTCCCTTCCAAGATAGTAAAGAGTACGGCCACAC
CTACCGCAGTGTTCTGAGGGAAGAGATCCTCACGCTCATGGCCAGGGATAAGCACCCGCC
AGAGGTAAGGAAGCCACCTTGAAACAGTGTGTTGTCTCCGTGTGACTGGTGCTAAGCAGC
ATGCCTTTCTCACCAGTATCAGTGTAAGGATCAGTCTGGTCTGTCTGTGGAGGATGCTGC
CCCCGGACTGCAGGTTTCAGTTAGGCCCATTGAAACTGGTCCACACATTAGTGTCATTTC
TACAGTCCACCTCAGTCCTCTAACCCAAAACGAGAGCTATGCATAGCCTGTCTGGGTACT
GGAGGGCTGACTAGCTCGAGACATGATGTTCCCTACTGGGCAGTACTGGGGACACATGGC
GGGGAGTGAGTCGGGTCTGACTACCCCCACAGAACCAAGAAGAGATCAGCAGCGGGAGCA
AAGCCAAGCCCCAACGCCCCTGAGGAGTCCCCCAAAATAGATTTCAGGCTAGGAGGGACG
GTTCCTGGACCCACCCTCACCACCTTCCAGGACTGTAAGTCATATAGACTTTTATAGTCA
TAAAAGTCAGTGGACAGACCTGTAATTATGTACGCTTTTCCGATATTTTGTGTACTAGGG
TTTTTATTCATTCTTTTGTTTTGTCTCTGTTACTGTTTTTAAACCTGTATAAAATAGGCA
CGGGAAGCAAGCCCGAGGAAAAAGCAATGGGACAAATGGTTCTGGGGGACTGTGTAAATA
TGTAAATATATTCATATAAATAGGTATTGGTCTATGAACATGTATTTATATGGCAATACA
TTGAGAAAGTAGACGGACTTTGGGCCTCTGCTCAAGTCCTCCCTCAATGCAAAAACACTT
CTAAAACTGGTATTCTGTGATGCTCACCCTCCTGACGTGATCGCTGAGACAAAGCAGGTA
CATAAGCAAATGTGGAGAAAGCTGATGGTGTCCGGCTGTCAAAAGATGAGCATCTGGGGT
CTTAAAGGTTTGAAGTCAAACAAGAAGCCATCTAGCAGAGAAGCAACAAGCCCACCTGGA
AGCAGCACACCAGCCTGTGTGATCACGAGGTGTTGACAGGATCAGATAACAGGCATCAGA
AGACCCACAACAAAATCAAACATATTGCTGTGAACAAGGCGGGTTGGAGTGGAGACCCCA
AACCTATCTTTAGACAATAGGACTTCCCCTCACAGAAAGATTAAAAGGACAGAATGGGTC
ATCCAGGGCGCAGTGTAGCTCCGTTGAAACACAATAATCCTCTGGTTCTTTGAGGCTTCC
TCACTCACACTGTCATAAGCTCAGTCCTGCCTTTTAGTTCTGGCTAAAATGTAGCATGTA
CACTGGTACATGGAATTCAGGTCAGATAAATCCCTCAGGAAGAGAAATGGGAGTCGTGAT
GTTGGGGGGGGGGACCAATTGGGAATGATTGATGCATAATTCTCCTCCACTCAGGGGGGC
GAACAGCAGAAACGTGGGTGAAGGGAGTCAGTTGGTTGGTGTAAGANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATCGGTGAGGGAGGGCCCCTT
GGATGAGTGCTCATCCAGACTAGTTGGGCCAATCTCACTGACTCGGGGTCCTCTCAGCTC
CAGGTGGCATTTGCTGACTGTGCTGCCCGACATCAAGTCTACGTACGAAAGCCAAGAAGC
CAGGCAGAACTGCCTCAGATTGGCCAAGCTGCACCTCTCAACTGTATAGCTAGAGCTCTA
TCTGAGAGCCAGGAAGAACCCAGGAAGCCTGGTGAGTGGACTGCTACAAGGGTAAATGAG
GAGTGCTTATATTCATGTGTAAGATAACAAAGGTTCTCAAACAAGATCGTGGTTTATCAG
GACTCAAACTAGCATCTATAGCAAGTTTCTGTACAATGAATTATAAGTGGGAAGTTCAAT
ATATTAAGAAATAGGTAACCCAAGAAACTGATTTTTTTTTATGTTCGTTGAGCTTCCTGG
AGCAACATTTTATTCACGTGGTGTTTTCTCTCCTCACCCTCCTCTCTCAATATAGGAACT
GGGTGATGAGACTTCTAAGAATTGGGCGTGAGGGGGTGGGGTGTGTGTGTATAAAGTTTA
TGGTTGAGGGTTTACAAAGTACATATTGGGCAGTTTTCTTCAATTCACATAGCCGTCCCA
CACTGTGACCCCACTCATCCATGCACTTTCTCCCCCTTTCCTGTGCTCCCGACTTTGTCC
TTTGTTTAGTGCTACCCTCTGACCTCAAAGAGCTGATGACTCTCAGGTGGTGCTTACCTT
TCTAGTTACCACTCCCTCTGTAGACTGATTTGGCTGACAATGGAGCCACGGGAGATCCCT
TCCTAAGGGTTACTTGGGGCCATAGGTTCAGGGGTTTGTCATGCATGGCTTCTTCACAAG
AACGGAACTTTTACGGTCACTAGTCCAGAATGCGACTGCAAGCTACGTCCAGAAGCGTGG
AAGCTTGCTGACCTTTGGTGTCAGAAGTGACACTCCATCGCTTTGACACCCTGCTAGGAA
GTGTGCTGCTAGTGACAGGTGTTTGCTGTTAGCAGTGGTTGGCTAGGTGGGCAGGTTGCC
ATGCCTTTGCTGTGAATCAGGCTGTGATGATTGGCGCAGGGGTACGGACCTCAGCTGAGC
CATGGGAGCTGAATGTCAGTGTCTCTCCTCCGTCCTGCATGTGGCAGGGTGCTGGCGAGC
ACTGGCATGAGACTGGTGCCTCAATCTGAGCCTGCTCTTCATCGCGGAATGGAGGGACAG
CCGGCGGAGCTCAGGCGCCCCCCCCCCCCTAACCTAAGTCCACGATGGAGTCCTTCCCCA
GGGGATAGAGTGGCACCTGGCGGGTGTGAGTTCCAGTCCACTTGGTTCTCTGTTGTGTAG
GCCCTCACTAACTTAGGTGTTTGATACAAAGCATTTGAGGATGTGTATCAACCTCGCATC
TATTTAGTGATCAAAACAGAGCTATCTGAAAAGTATACCTTCCCTTTTTCAAACTGGAGA
TTAAACTCTTGCTTCTCTCTGAAACCTGCTCTTAGTGTTCTGTTGCCCTTGTTCTTCTGT
ACATCTCTCCTCCTTTCCTTCCTGTGCAGAGTATCTGCTAGGGTGCCCACGGCGGTGCTA
CCCCCCAGCAGGCTTACTGGCATGTGCAGTGCACTCAGGTGGGGCTGCTGCAAGGTGGCT
GTGCCCAGACAGGGCAGGCAGCCAGGGGAAGCTGGAGCCCACAGATTTATGACAGCGAGA
GCAGGGGGAACAACTACTGTCAGTTGGGTGCCTTCTGCATTTCTGTTTGTAGTCAACATC
TTTCTCCTTCCTCATCCTGAACAGGAAAATGCTGGGACTTTTCAGGAAGCATAACAAGAT
TCCCAGGTAAGTTGCAGTTAATAGGATGCCCCTGCATACCACCTGCAATTAGCCACATGG
CCTGACTCTTCCTGTGGGGCAGTTCCGTTTCGTCACCTGCTGCTGCCACGTTTGAGCATG
CTTCTGATAGGCACGTTCCCATTGGCAGCTGCCCTACCACCAGGGCATCTGCTCAGCAAT
TGCAGCGAGGTGCTCGCTGAATGCAGTTAGCCAATGTCATGTGACTGCTTTTGAAAAGCT
ACTGTAAAATAATTTTTCACTGCACTTCTGAAATGTTAGGATTTTTGTGTATATAGACTC
TTTCACTGATGGTGGAAGGATTTAGTTGGAGAAAGTTTTCATTTGGCTGCTCGTTTACAG
GAATGAGTTGCTGAGTGAGTTTGTGGATAGTGCAAAAGCAGCCAACAGCCTGGAGCAAGT
CATTGAGGTGGTGAAGCTGGCGAGTGCCTTCAGCCTGCCTGCCTGTGATGGCTTTCGCCC
CAGAGAGTGCTGGGCCGAGTTTGCCATCACAGAGGAGCAGAAGTAAGTGGGTGCTGGGAT
CTTTGCGGGAAAGAAAGGTGGGGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTGTCAGCAGGTCTTCATGTATTGGATAACAATTGCTGTTCGGTCAAC
AAGATCAGTTTCAGGGCCCTTTACGGAGGATGTGAAAAACGGCATTTTAAAATTAAATAG
AATGATGACAGGAGTTTAGATTGCACGACTGACCTGCAAGTGGAGCCTGTCAATACTCAT
AAGTTATGTGCATATGTGTGGGTTCGTTATTTCTACATAGCCTTTGCCCTGCCTTTCCCA
CGTGAGGTTTGCCCAAGTGTCTCCACTGGCCCTTTAGCTCCCTTTTTGTAGGCTGGGCCT
CCTTTAGAGGTATGACTGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1101, 2822..2874, 2977..2978, 2980..3014, 18771..18816, 21226..21294, 21857..21961, 24007..24130, 43050..43165, 44696..44766, 45674..45761, 46129..46189, 46337..46422, 47057..47201, 49073..49123, 49678..49771, 49962..49965, 50055..50078, 50602..50708, 51633..51711, 51803..51893, 52718..52803, 54897..54926, 54928..54967, 54969..54985, 54987..55013, 55015..55033, 55035..55050, 56604..56645, 57000..57114, 57117..57133, 57135..57159
1001..1101, 2822..2874, 2977..2978, 2980..3014, 18771..18816, 21226..21294, 21857..21961, 24007..24130, 43050..43165, 44696..44766, 45674..45761, 46129..46189, 46337..46422, 47057..47201, 49073..49123, 49678..49771, 49962..49965, 50055..50078, 50602..50708, 51633..51711, 51803..51893, 52718..52803, 54897..54926, 54928..54967, 54969..54985, 54987..55013, 55015..55033, 55035..55050, 56604..56645, 57000..57114, 57117..57133, 57135..57159
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved