Echinops_telfairi Locus ENSETEG00000013908
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000013908
Echinops_telfairi
ENSETEG00000013908
GeneScaffold_2036
SNORD42, SNORD42
1463..1528, 3104..3173
4541
GCTGTGTAGGATAAGGGGTGCTCAAAACCGAGCTACGCCCCTCGAGATGGGGGGCGGGG
AATAGAGGACCAAATGGACCAAGAACGCCGCCGCCCTTTGCGGAAGTCACAACTCAGTTC
TCTTCTAGTATAGACGACGTCCATCACGTTGACCCCTTCGACCTTCCCCTACAAGGACTT
TTCCTTTTTTGCAGAATATTTTTTGGACTCAAAGTAGAAATCTGGGCAGGGACCAAAAAA
AGGGGAGTGGGTGGGAGGGGAGGCACAGGTCTTTGTAGAAGGCTAACCTAAATGACACTC
TGAGGATGCACTGGTGACTGGGGCAGGAGATGACTGAATGAAATTATTCACAAATCCTGG
GGAAAACTGAGTGACATATTGGCAGAAAGTCATCAAGAGTATTACAGGAAAACATGATGT
CTGACGCTGGCACAGGTAAAACTGGGGGTTAATATGCCACCCCACCCCGTGGACCTCTTT
CCTCCTTCCCTCTGCCTGCCTGGACTTTTACAGCCACCAAATCGCGACGTTATAGCGAAA
CCACATCTCTCAGCACCTCAGTTCCCACCGGGCAAATGCTGTTCTAATGTTCTAGAACTT
TGCTCCACTCTCCCAGAGTCATCCTAACTTAATCTTTCCAGTGGCAGTGCTACTGTCTGC
TGGCAATGCTGGCCATCTTCATCGGGACTGGAAGTTGCTCAAAATGGGAAGCGCCAGGGA
CCGCCTCCAAACAGCAGCCTGCTACATCACCCAGAGGCCAGAGCAAGTAAACACGCGTCT
CTTTAAAACTACAACTCCCAATAAGCATTAGAGCCTGACGGGAGGCGGGGTGGCGCATGC
CCAGTTCCTCTTGAGGAGCTACGAAACCTGAACTACCACTACCGGCGGACGCCGTGCTAC
AAATTACCCAATCCGCTTTAAGGAAGAAGCCTCGCGAGATTTCCGTGAGACTTGGCTCTA
TAAGCCCGTAAGAACGGACTCAGGAGACCCTTTTCACGAAGATGGCGCCGAAGGCGAAGA
AGGAAGGTCTGTTCTGGGCTTCGGAGCCACCTTTGGCGTGTTTAAGCTGCCCGCAGAGTG
GAGGGACTGGGAGGGCAGCTTCTGGGCTAGTCCCTGGGGTTAGGTCCGTAGCTGCTGACA
GCATTTGGGCCGTGCTGCGGCGTGTGGGCCCGGCCGCGTGGTCGGCGGCGGAGTAGGCAA
TGCGGGCGGCACCGTGCGCTGGGGAGAGGCAGTCGGCTCCCTGCTTGGGGAAGCTCTGCC
GCAGCGCCTTACCTCCAGAGCTGAAAAGAATCAGGCCTCAACCGTAACCATCTTTTCTTT
GATTGGGCAGGGCTACTTAGCGCCCCCACCGCCGTAGTAAGTGCAACTCAGGAAATGGCA
AGTAGTTGGATCAATGCTGGTTCCGTTTTTCCACCTTTTTATCCCTGGATCACCCCAGGG
GGATCTCCACCGCCCTCCGGGTCGTGCGTATGATGGAAAAAAAACATAGTCTGAGATGCG
TGATGTCTTCAAAGGAACCACTGACGCACGTGTGGTCGGCGGGTGTCCACCCACAGCCGT
TCCGACACGGACAAGGGATTTCTGAGCCCCCGTTTCTCTGTTTCTTTCATTCTCTCCCAG
CTCCTGCCCCTCCCAAAACGGAAGCCAAAGCAAAGGCTTTAAAAGCCAAGAAGGCCGTGC
TGAAAGGCGTCCACAGCCACAAAAAAAAGAAGATCCGCACGTCACCCACCTTCCGGCGGC
CTAAGACCCTGAGACTGAGAAGGCAGCCCAAATACCCCCGGAAGAGCGCCCCCCAGGAGA
AACAAGCTGGACCATTATGCCATCATCAAGTTCCCCTTGACCACAGAGTCTGCCATGAAG
AAGATCGAAGATAACAACACACTTGTGTTCATTGTGGATGTCAAAGGCAACAAACACCAG
ATCAAGCAGGCTGTGAAAAAGCTCTATGACATTGACGAAGCCAAAGTCAACACCTTGATC
AGGCCTGACGGTGAGAAGAAGGCATATGTTCGACTGGCTCCTGACTGTGACGCTTTAGAT
GTTGCCAACAAAATTGGAATCATCTAAAGTGAGCCCAGCTGCCTAATGCTAAATATAAAC
TTTTTCAAGATATAAAAAAGAAAAAAAAGAAATCTTGGAGGGGACGTCGTATCCCTGTGG
GACACAATGCCCCCAAGGATCTGAAAGAAGAGATTGATATTCAGTTATTCAGAGTTCAGG
ATAGTAAGTAGGAACCCCAGCTCCTTGCAGATGATGATGCCAGACTGCCACAGCTGGAAA
GCGCAGGGGAAATCGGAAATTGCGTGCAACTATTCGGTACGAGATGAAAGGGTGAGATGG
CGATTTGGTGCCTCTCAGATCCCCATTTCACACTGAAGGGCAGCATCCCGCGTCCCTTAA
GGGGGCAGAAAGGTTCGGTTCCTACCTGCTCCANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCAG
ATGCGTCAGGCTGGTAGCAGGCTCTAGAAACAGGTGGATTTTCTAGGGTTGGCTCCTAAA
GCGACTGGTCACCTGCATTGTTTCTCGACCCCCTCCCTATGCGCGCGCAGATGATGGAAA
CAAAATCACTATTTGGAGAAAAGAATGACACGAACAAAGGAACCACTGATGCGCCAAGGG
CCGACGGGCAGGGCAGGAGGATGGGAAGGGGGTGGTGCTGACCGTCTAGGTCTGAGGCTT
CCTTCTGTCACAGGCCTGACGGTGAGAAGAAGGCATATGTTCGACTGGCTCCTGACTATG
ACGCTTTAGATGTTGCCAACAAAGTAAGTTTCCTCTTAAACAGATTCAGTGCCCACCTCC
TGGGTGCAGATGATGCCTGCTAGTGACAAAGCCTGATAACGACACGTGGTGCTGAGTCCT
GGCTGACTGATGGCACCTGCCTATCCAGAACAAGCTCTCAACCCTCACCTTAAGATTTCA
ACTTCACATTGCAGCTCTTGGTTAAAAAGTTCCCTTTTCTTTTTCAGATTGGAATCATCT
AAAGTGAGCCCAGCTGGCTAATGCTAAATATAAACTTTTTCAAGATATACTCTTCTTGTC
TTTGTCTTGTGTTCTGAGTGGACTGGGAGGGGAGCCTTGTGATAGCACACACCTAGTTGC
AGGGTTTGGGTGTGACTGTCATCCTGATTGCAGGGGTTGGCAAGCTGCAGCGCATGAGCC
ATGTGGCTCTGAGGTAAAAATGGAAGATGTAAATAAATTTGAAAATGAAAACTTTTCAAT
TAAGGTTATTGACAAAATAGTGATTTCATTTGTTGTCTCCCAAATAAATCATTTAGGTCG
TGAAGGATAGGCTCTTCTGTCTCAAACGTTTGCTGGCCCCGTCCCTTATGGGAATAGTAC
TACCTGAAGCAGCTCCTGGTGTTTTGTAACCCAGTTTAGGTTGCCTTAAGACCAGAACTT
GCCTGAATTAGTTCGACTGTAGAAGGAAAAGAACAGGACACCTTATATGACCCCCCTTTA
AAAAAAAATCTCTGGGAGACACAAGCCAACCAGTTTAGAGGTGGGTGGGGGTACAATTTC
AAAAGTGTTTGTTAGCATCAGATGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1025, 1620..1787, 1789..1981, 3253..3322, 3527..3541
1001..1025, 1620..1787, 1789..1981, 3253..3322, 3527..3538
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved