Echinops_telfairi Locus ENSETEG00000019286
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000019286
Echinops_telfairi
ENSETEG00000019286
GeneScaffold_3421
SNORD105
1745..1831
4581
GAGGAAGAATGTTCAGCTCAGTCGATTAGGAGGTGTTCTCTTCTCCCCCAAGGTTTTGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGAAA
TAAAATTACTAAGACGCGTCTGTCGGCTACAGTAGCATGAATTTCATAGCGGGTATGGCG
AGGCTCAATTCCTCCTGACCGAGGTGCTTACAGAATGGGAGAGAAAGACAAAAACGACCG
CCGATAAAAGGGGTCAACTAGAAGCGGAGGAGACAATGAAGGAGCTGTTCTTAGAGGCTG
AACAGGTGTCTCTCCCAAAGCCTCAGAAGGACCCAGTACAGGTCTCATACAGCCACCGTC
TTGCTTCCGAAACCGTAAGATGATCCATCTCTGTCGGCTACTGCCACAATAAATAAAGGG
ATGACTTCAATGGGAGGAAGGGTGGTATCTGACATTGGTTGGGCAAAAACTGTGCGAGAA
CGTAACCTCACGAAATTATAATTTAACATTTACACTTTAACAGAAATGCAACTTTCTGAC
TTCACTGGGGGGGAAGAAAATAATCAATCGGCCTCGTTGGAGGCAAAGAGCCAAGCCGGT
ATTCGAACCTGAGGTTGCGGGAGCCTGGTTCCGCTCCCGGTCGCTAAGCGGCAAAGCCCC
GCCCTGGTTTCCATAGAAACAGGCCCGCCCGCCGGTCGACGTCACCAGGGGCGCCGCCTC
CTGTGGCCGCCGGCGCCGGAAGTGAGCTTGGCGGCACCGGAAGTGAGCTTGGCGGCGCCG
GAAGCGCCCGTTCCCGGCGGCCTCGTGGGGCAGACGGCGGCATGGGGCAGCCGAAGCGGG
TGAGGCGCGGCGGCCGGGGAGGCGCGGGGCACCGAGGGGCGCCTGGCGGAGGCCGCGGCG
CTCACCCCTCGCCTCTTGCCCCCGCAGTCCCGGCACCAGAAGCGCGCGCGCGCCCAGGCG
CAGCTCCGCAACCTCGAGGCCTATGCCGCGCAGCCGCATTCGTTCGTGTTCGCTCGGGGT
CGCGCTGGTCGCGGCGTCCGGCAGCTGAGCCTGGACCTGCGGCGGGTCATGGAGCCGCTC
ACCGCCACTCGCCTGCAGGTCGGCACCTACCCTAGGCCCTGGCTTCCGGGCAAAGGGCCG
GGCGCCCTCCAGTCTCCCGGGGTTGGAGGCAGGACCCCCTTTCTGGGGACCATCATCCCC
GCCACGCTCGCAGAAAACCCACCGTGGGTCTTGACTGCGTCGGGCGGCGAGGCGTGGGCC
CTCGGGGTAGAAACGTGGCTCTCAAAGTTCTGGAGCAAGCGCTTGAGGTTCCTAGTAAGC
AAGTGGCAAAGGCGGTTCTAGGGGCCAGGAGCATCCCTCTCTCCTGGGCTTGTTGAAAGA
GCTGCATGGGGCCGCTCTCAGCCTAAACCTACCCTTGTTGCTCTGTAAGGTCCGAAAAAA
GAACTCGCTGAAGGACTGCGTTGCGGTAGCCGGGCCCCTTGGGGTCACACATTTCTTGAT
CTTCAGCAAGACGGAGACCAACATCTACTTTGTGAGTGCTGTGTGTGAGTGACCCCCTCC
CCCGGCTCCCCGCTCTCATGATGAGCCCATGTGCCTCTGAGCTGCCGTGATTCAGGCTTC
AAAGTAAACGCTCTGAAGAAATGGAGCCGAGCTTCACCGCCCCCAGCGCGCCGGCCTGCC
AGACAGCACCCTCTTCCCCTCACAATCTCCTTTGTTCTGCAGAAGCTGATTCGACTTCCA
GGAGGTCCCACCTTGACCTTCCGGATCAATCAGGTGAGGGCTGAGGTCTGGGTAGGCTGG
GGGAGGGCGGGTGGCCCCAGTTGACAGGCCCCTCACGGTAGCCTGCCCTGGTCCCACAGT
ACACACTGGTGCGAGACGTGGTCTCCTCACTGCGCCGGCACCGCATGCACGAACAGCAGT
TTGCCCACCCTCCCCTCCTGGTGCTCAACAGCTTCGGCCCCCACGGCATGCACGTGAAGC
TCTTGGCCACCATGTTCCAGAACCTGTTTCCCTCCATCAACGTGCACAAGGTGGGCCATG
GTGGCAGGTGGCCGTGGGCGGGAAGTCAGGGTATCAACACCATTGGCACTTGGCTGGGTC
ACTCAGGCCTCACCTCTGGCATTGTGGCCGAAAGCGGGCCCTCCAGGGTCCACTGAGTGT
GGAGGTCAGAGCCACCCATGGGTTCCTGACAGATGGGAAAAGGTGCTAGTAGCTCCCTGG
TGTGATGAGAGACTCATGCCACCTGAGGTTAGATAGAGGTTGGGTCCCAGGGAGACTAGT
GGTGGTCGATAGTCGGACCCAGATTTCTAGCCCGTGCCCCAACTGACTGTGTCANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTCATTAACTTCATCCCAGA
CTCTCAGGAAGCTGGATCTCCGCCACTAGTAAGTGCTGGAGGTCATGGGCGCCCGTGAAA
TCTGGGCACGTGAGATGTGGCTGATAACAGTATTATGGGTGAGACTCTGTGATTGCTCAA
TCTCAAAGTAAACGCCCGGACAATCCCTGGAAGAGTTTGAGAGGTCTGACCGTCCTCCTC
ACAACCCCTAATGTCCTACTCTGCATGCTCCGGCCCCACAGCAGCATCAAGGTGGTTCCT
GTGGGCGCCAGTCGTGGGATGAAAAAGCTTCTCCAAGAGAAGTTCCCCAACATGAGTCGG
CTGCAGGACATCAGCGAGCTGCTGGCCACGTGAGGAAGGCATGGATGGGGGCCTCGTTCC
TAGGGTTGTCCTGGGGGCCTGGCATGCTCAGCTAAGCACTGAATGTCCCCTGAACAGGGG
CGCCGGGCTGTCAGAGAGCGAGGCAGAGCCTGATGGCGAGCACAACATCACCGAGCTGCC
CCAGGCCATCGCTGGCCGCGGCAACATGCGGGCCCAGCAGAGCGCAGTGAGGCTCACAGA
GGTGAGGCCAGGCTGGAAGAGCCTCAGAGAGGAGTGACTGACGGGACCACCTGGGGAAGC
ACTGACCCCTCCCCTCCCCCCCAGATCGGCCCTCGGATGACGCTGCAGCTCATCAAGATA
CAGGAGGGTGTTGGCGAGGGCAACGTGCTGTTCCACAGTTTCGGTGAGGAAGGTGGGGGA
GGCGGGTCACGGGCTATCTGAGACGGGTGTCTGAGGCCATTTAAGGTGGCGGAGGCTCGA
GGATCTTAGCAAGCATCTTCTTCCTACTCAGTGCACAAGACAGAGGAGGAGCTGCAGGCT
ATGCTGGCGGCCAAGGAGGAGCGGCTGCGACTCAAGGCACAGAGGCAGGACCAGCAGGCC
CAGAATGTGCAGCGAAAGCGGGAGCAGCGAGAGGCTCACAAGTGAGGCCCGGGCAGGGGG
GTGGGCTGGTGGGGGGGCGGCGGGCAGGGCAGCACTGCTGACAGCCCCGGGCCTCTCCAG
GAAGAGGAGCCTGGCAGGTATGAAGAGGACACGCACAGAGGCTGATGGGGACAGCGACGC
TGAGGACCCGGGCGCCCCTCCGGAGGCAGAAGGAGCCAGTCGGCTGGAGGAGGAGGAGGA
GGATGAAGCTGAGTATTTCCGCCAGGCAGTCGGCGAGGAACCTGACGCAGGTGTGTGTCA
TTGCAGCTGGTGCCCAGGGGGTGTGCCAGGGCTCCAGGGCACCAATCTGCCTCTCCTTTC
AGACATGTTTCCTGGGCTGACCAGGCGCAGACGGCCTGCTCGACCTCCAAGCAAAAAGCA
ACGGGTAAAGGACCGGAAGCCGGAGCGAGGAGGTGACCGGAGGCCTCCAAGGCCCAAGGG
CCAGTTGCGAAGAGGTCAAGCCAAGGCTGGTCCCCCCCGGGCTGCCCGAGGTCGTGCCCA
GGGCCGAGTGCGGCTGCCTAAGAGAGCAGCTCGAGCCTGAGCCCCCAGCAAAGCTGGGCA
CCCCAGACGGGCCCAGAGGCTGCTCTGGGCTCGGGTGCAGCCTGCTGCTATTCCTTTTAT
AAAGGAGCCATCTCCCCACTCCCACAATAAAGGATCCACACCCTTGAGTCTCTCTGGTTG
AGCTGGGGGGTTGGCAGCCCAGAGTGGCTTCTGTCAGGGCAGCACCTGGAAGTCTGGCCC
ATCTTTAGCCTGATCCTGGGGGCGTGAAGGGCTCATTCCACAGGTAGCGGTAGCAGCCTG
TCTAAGGCTTGATCCACTCCTGTTCGCCGAGGTAAACAATGAGGAAGGAGGCGGGGGTGG
GGCCCAGGACCAACCAGCCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 1107..1277, 1609..1710, 1902..1952, 2039..2209, 2710..2768, 2770..2787, 2981..3088, 3177..3300, 3384..3462, 3571..3700, 3780..3869, 3872..3884, 3886..3949, 4022..4068, 4071..4073, 4075..4206, 4208..4216, 4219..4233
1001..1018, 1107..1277, 1609..1710, 1902..1952, 2039..2209, 2710..2768, 2770..2787, 2981..3088, 3177..3300, 3384..3462, 3571..3700, 3780..3869, 3872..3884, 3886..3949, 4022..4068, 4071..4073, 4075..4206, 4208..4216, 4219..4233
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved