Echinops_telfairi Locus WDR43
snOPY snoRNA Orthological Gene Database
Echinops_telfairi WDR43
Echinops_telfairi
WDR43
GeneScaffold_6798
SNORD92, SNORD53
50954..51040, 61388..61463
83421
ACACGGTCCTCTTCATGACAATGTGGGCAAGAGCCATATTCATTGGCAACAGATAAAGA
AATAAAAATAACAGGCTGAGAAGAATGCAAACGTTCTGAGGTGTGCTTTTTATAAGTTAC
TCCTTGCTCGGCATTGGAGGATTAAGCAAGTTTTCACCAGGGCTGCAGCCCTTCTTACTC
TAGTTCCTTCTGGCACCAATACACACCCAAACCCGGTCGCATTACCTTTGGATATGAAAT
GGTAGGCCCTCTTTTCATCAGTAACACATAGTCTTCCAATGCCGGTCTCCTTAGCATGAA
CTGCTTACCGGAGGAACTCACGAGCAACTGACCCGGGAACTTCCCCACGATCTCGCTGAA
CGGGACTAACCCCCAGTTACTATTTAAATGTCCGCTGTTACTCAACCTAAACAATTTCTT
ATAATGCCTTTCTCTCTTGCCAGTCTCCGCTAAAATCAGCTCCCCAGCCTGAAAGGGGGC
CTCCCTGGAAGTGGAACAGGAAAAAGAGTCGGCAAGCTTGGGGATCTCAGTAGCGGGCTG
GGAGTGACCCTCGGGTGCTTGGGATGCGGGATCCGAGTGGCGCCGGTCGCCGTTCGAGTC
CTCGCGATCACCAAGGGGTGACACCCCCCGCGGCGCCAGTGGCCTGAGGCTCTCCAAAGA
GGAAAGACATCTAATCCCAATGGCGGGGCGCGAAGCAAGCACCGGAGGCGACCCTGAGCG
CAGAGATTTCCTTCGCACGGCCTGGTGTCGTCCGGCTCCATCCCGCACGTCTCTAGGCGA
GGACCGGATGGAAAGTGACTGCGTTCCCCCAAAAGGTTCTCGCCCAAGGCTACGTAGAAG
CCCAAAGCCCAGTGGCTTCCGAAGGGGCTGCAGCTGAAGCAACACTGAACACCGGCGCCC
AGCGGGCAGCATGGTACTCCGCGCCGGCGCCGGCGCAGGCTGGTGACGTAGGACCGGAGG
CGGCCCTTCCTACTGCCGACGCCGCCCGGCGTCGTGACGCAGGCCCTCTGACGCGGAGCC
TGGCGACGGCGCATGCTTGCTGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CCTTGTTTTGATTGGAGTTGTTGAGAGCACCCTCAGGAGACTGAGTCAGATGTATTACTA
AGAGGACTGGCTGCACCCACCCGCTGCTCACACAGACATGCTGAACATGTGCTGTTTGGA
ATCAGCCTGTGCCTGTAAGAAGTGGAACCCGAGTATCAATAGCTTTTGACATCCTTGTGT
GCATGTATGTAGAGTTTTGTTGTAAAGGCAAGATTGGGATAGTGCCTGGAGGGGAAATTG
TGGTCACGGAAGAAAGAATTCAGTGACATGAAACAATATGCATGTGAACTGTTGAATGGA
AAACTGATTTTGCTCTATAAACTTTCACCTAATTCACCTAATTCAATAAAAGGTTAAAAA
GAGAGGAAGGATGGTGGTCAAGGGAGAAACAGCAACATGTTTATAAATGAGAATAATCAA
GGTGAAAGGTGAAAAATGAAAGGGAGAGGAAATTAATATCTTTTGGGAGTGATATCTGTG
GTAGTTATATAGTTACATAATCTGGTGTCAATTTCAGGATTAAGAATATAGGGATGGAGT
CTAGCCTGTCAATCAGAATATAGCCAATGAGGCCTCTGTGTGGGCATGGCCTTCTCCTGA
GGATTCTGGGAACTCTGGTATTTCCTCCTTGGAGGCGGGAGTCTTTCTCTCTCTCTCTCT
TTCTCTCTTGGCTCGTTCCCTTGGAGACCCTCTACTGACAAGGCTGACTCCCTGTGAGAC
ATTATGGACAATGAGCCTGATGGAGCCTGAGGAACCACGTGGCGATCCCTGCCAGCACTG
AGATGCTCACACCACCACTGGATCCACAAGAAGAGGGGTCAAAAGACTGATATTCTTGAG
TATCAGAGGGTCAAAATGAACCAGGACATTATTCATTGGGTCAGATTGTCCATGCTCAAA
GATGGCTTCAGTCAGAAATTCAGCTCTTCTTCTACTTCTAAGCTTTATTCCTTATCTGCA
AATATATTTTACACAAAACATTAAAATATGAATAGTGTCAAAGCCATAGGGCTGTGGTGA
GTACATGAACTCATGAATTATAAATGAATTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGTGTACTTTGGGCAGGCCCAGAGAAAGACCCAGAC
CCCTGGAGAAGGACAGCGTGCTCGGTAAAGTAGAGGGACACGGGAAAAGAGGAAGCACTT
CGACAAGATGGCTTGAGATCGTGGCTGCATTGATGGGCTCGAACATCAGTAAGTCAGTCC
CCAAACACTCCCTTGCTCAAGGAGTCCTCCTTAGCCTGTTTCTCTCTCTGTTAACTGTGC
TTATTAAATATCTGGTAAAGCTGTTCACCCCACCACCATTTCTCTAAGCCAGTCAGTCAC
CAGCATCTCTGCCTGCATCTTTAAACATCTGCTTAACCTCCAAATCATCCATCACACAGC
CTTCAAATACTCCAAGATGCAAAAATTACCATGCCACCCGTTTGAGGACCGTGCAGGGCC
CGGCACTGTTTTGTTCTGTTGTAGGGTCTCTGTGAGTCGGAACCGATTCGATTGCATCTC
ACAACAAGTTCGGTGAAATATTACGAAGACACTGAAAACCGTCTATTTGAAGCAATGACA
CAAAACAGCCAGATGAAATCAGAGGAGCTAGCCATTCCCCCTAGTATGTTTATCGTAACT
ATTCCGATGGGCCAAACTGTGATCATGGCTGTGCAAGAATCTAGTATGGAAGAGAACAGG
GAAAGAACGGTTCCAGTCATGGAATTCTGCGTAAATATTTCTTTCAGTCCCGTTAGGAGT
CCCCCACTCCCACCCCACGAAAGGAACAGGCCTGCCTCTGGATTCCAGGATCCAGTTCTC
CCTCCCAGAACGCGTTAGCGTTCGGGCCCGCAGGGCCACCGTCCCCGGGGTGGCCCCGCC
CGACGTCCGCTTGCGTCGCTCAGAGCCACTCCTTCGGCTCCTGGCGCTCCCCCCGCCCCA
TTTCCTCCCGCAGGCCCCGCCCCGCGCCGGTGCGCCTGCGCACGGGCGAACACGTGGCTG
CCGCGGAGGAGAGCTGCAATGGCGGCGGGCGGCGGAGGTAGCGGCGACCCCCTGTCCCGG
TCGGGGGTGCCCTGCGCCTTCTCGCCACAGAGCCAGGCCTACTTTGCTTTGGCCTCTACA
GACGGTCACCTGCGAGTGTGGGAGACGGGCAACAATCGGCTGCACCAGGAGTACGTGCCT
TCCGCGCACCTCAGCGGTACCTGTACCTGCCTGGCCTGGGCGCCGGCGCGGCTGCTAGCC
AAGGTAAAGCGAACGGGACGGCGCGGGGCGGGCGCCCGCCCGGGCTGGGCCCAGGCGCCC
CTGGGCTCGGCGGCGCGCCGGCCGACCTCGCGCGTGGCTCGCGCAGGCTCGGGGCGAGAA
GGCTCGGGGCGGGACGGCGGCGCGGACAGGGCCCGGGCCGCCAGCCCCGTGTGCGGCCTG
GTGGGTGTCCAGCGGGAGAGGGCGCGGCCCGATCCAGGGACTGGATCTTAGGGACCGGAG
CTCAGCGGATGGGCCCCTTGCAGTTTGCGGTCCACTGTCCCCTGGACGTGTCGCCATATT
CGCCAGGAGCCCCGGCCCACCCCAGCGCCGCTTCCTCCTGTCTGGCCTCGCGTATCATCT
TGCACGCATCAGAGCTCGAGCTGTTGACAGTTCCTCCCCTTGGGGGTGTTTGACGCGTCC
CCGCTCCCGACCGCCTTCATCAGCTTTGCCCTAGGTACCCACCTGCGTTACACTGGCCAC
TTCCTTTGCCCCGAAGCTTTCACCCCTCTCCCCGTCTGAGTGCTGGGCTCACCGCGTGTT
CTCTTCCACGGTTCAGATAGTGGTGACTCTTGAAACCCTGGGCTTTCCCGGTGTCTCTGT
ATTCTCAGCCTTCTTGAACCTCCCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTGGGGAAACAGGAAAATACTGCTTTTCGGGGTCCTT
AGTGTCTTAAAACGAGGCCAGTGTACGTGAATGGCCCTAGCCATGTAGTTAAGTGCTTAA
TAGATGAAGCGAGTTGTTAAATGAATGCATGAATCTGGCCTAAGGCCCAATGTATCTCCA
CAATTCTGCATGCCTAAAATGTAAGCCAGTTTGCCACCTTGCACACAGGTGAATGAAAGT
CCTGCTCTCAGTGGAGAAAAACGGAGTTGCTGCTGCATTTCCTGGGTAATGGGCTAAGGC
ACCGCTTTATCCATGCTGGACAATCAGATGGCTGCCTTTTGCTCTTGGCTTCAGAATGAC
AATATTTTCATGTCTCTCACAATAGTTTTAGAGAGTTTTTTGCACAGTTAACTGAGCATA
TCTGAAGGAGCTTGCAGGAAGACCAGAAAATAATCTCAGGCAATGTAAAGAGAGACTGAC
AGACTAGATAGGTGCTATTTGCAGAGCCCCTTGCAACTTAAGTTTTAAGATACCTTCATC
TCATTGAAGCCCATTTTTTAATTTTTCCCTGAGTCTGAGCAGATGAGGCATGAAAGGAAA
GTCATTTTGAAACCCATGCTACTAGTCCCTACCACTTACCTTGAAGTTTAAAAACTGGAG
AGATCCAAAACAGCATTGAACAGAAACATACCTGGACTGTGCTACCTCCCTAAAGGGTGG
AGAGGAGCCCATGTGGCGTAGGGGTCACACATTGGGCTGCTAACCACAAGGTCAGCAGTT
TGGGATTATATCTGTAAATTTAGGCTGAGATGTTCAGTGACAGTGACTGAACGACCCCTG
CTGTTTGCCTGCCCCCCCCCCTCCCCCCGGCTGTTTCTCCTGCTTTGGAGCAACAGTCCT
TGCACATGTAGTGTGCTGTTTCTCTGTCACTTTAGTTGTGCTGAGCCACATTGCTCGGTA
CTTGGAGCACCTGGCTTTTCAGACATTAGACTGGACTGAAATGGGAAAATCTGAGCTGAG
TAGCCCCACTCCCATCCTTTAGCTCTCAGTGCCGCTGAGTTCATTACGACTCATAGCCAC
CCTATTGGGCAGGGCAGAACAGCCCCTGTGGGTTTCCGAGACTGAAAACTCTTTGCAGGA
GTAGAAAGCCTGCTCTTTCCTCCCGCTTAGTGACTGGTGGTTTTGAACTTCTGACCTTAT
GGTTAGCAGCCCAACTCGTAACCACTTGCCACCCGGGTTCCCACACCACCCTTTAGAGAG
GTAGCATAATCCAGATGTGGTTTTCTTCATTGCTGTCTTGAAATCTCTCCATCATTTCAA
CTCGAAAAGAGGAAAGTACGGTTTGCCTTGGTTTCCCTCGGCAGAAGTGGAAGCTGCTGT
GTATTGGGATGTAACTGTTCTGACATAACTTCTACGTCTACAAATATCTACAAGGCAGTC
TGTTCTCCTGTTATCTGTGAAACGGAAGTGCCAGACTAAGTGGCAGCAAGAGAAGACCAC
TCCTGGGGCCTCAGAGTCAGAACTGACTTGAAGAGAGAGAACTCTCCTTTTTGTTGTTTT
TTAAATTTTGTTAAAGAGAGGCCGTACAGTGGGACCTCCAAGAGACTAATTGTGCTGTGA
TATAGAAAACTTTGGCATATGGCAATGAGTTTGGTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGGACCCCAAATAGCCATGAGTTGAAAAAAAAAGACTTTTT
TTTAAAATAAAGAAATTATGGGTACATTGTAGTTTTTGTTGTTTTTTAACAAGAATTTTG
GTAATTTTACTGTCATCAAGAACTTGAAATAATAGAAATACCGTGCTTTTATGCATACAG
GCATATCAGCTCTGCAGATGCATGCTAAAGGAAAACTGATATTTCCAAAATTCAGGAGTC
TGATTCAGTTTAATTTTTAGGGCTTGATCTGTTTGTTCATAAAATTAAGGTTGCCCCACT
CCCACCCCTTTCCCCTTGCTGTTCCTACAGAATCTTCGGAAGAGGAGTCTGATGATGAAA
TAGCAGAGAAAGAGTCTGATGTGAGTAATTATTTGTGCCCTGACACACAAAGCTGTCTTT
ATCTTCCCCTTCTCTGTAAGAAAGCTGTCTTTTTCTTCTTTTTTTTAATCATTTTATTAG
GGGCTCACACAACTCTTATCACAATCCATACATACATCAATTGTGTAAAGCGCATTTGTA
CATTCATTGCCCTCATCATTCTCAAAACATTTTCTCTCCACTTAAGCCCCCAGCATTAGG
TCCTCATTTTCCCCCTCCTCCCCGCTCCGCCCTCCCTCATGAGCCCTTGATAGTTTATAA
ATTGTTATTTTGTCATATCATGCCCTGTCTGACGGCTCCCTTCACCCACTTTTCGGTTGT
CTGTCCCCCAGGGAGGAGGTCACATATAGTTCCTTGTAATCGGTTCCCTCTTTCCTACCC
ACTCACCCTCTACCCTCCCTGTTTTTCCACTCACACCACTGGTCCTATAGGGCTCATCCA
TCCTGGATTCCCTGTATTTTCAGTTCCTATCTGTACCAGTGTACCTCCTCTGGTCTAGCC
AGACTTGCAAGGTCGGATTTGAGTTATGGTAGTGGAAGCGGGGAGGAAACATTTAGGAAC
TAGAGGAAAGTTGTATTTTTCATCGTTGCTACATCACACCCTGACTGGCTCATCTCCTCC
CCGAGACCCCTCTTCAAGGGGATCTCCAGTGGCCTACTAATGGGCTTTGGATCTCCACTC
CGCACTGCCCCCATCATTCACTATGGTAAGATTTTTTGTTCTGATGATGCCTTACACCTG
ATCCCGTCGACACCTCGTGGTTGCATAGGCTGGTGCGCTTCTTCCATGTGGGCTTTGTTG
CTTCTGAGCTTGATGGCCGCTTGATTACCTTCAGGCCTTTAGGACCCCAGACGCTATACT
TTTTGATAGCCGGGCACCATCCAGGAAAGCTGTCTTCTTGAACACTTTTCTTGCTTACTA
TTTCTACCAGGATAACTGGGATGAAGATGAGGAAGGGAAAAGAAGTGAGGAAGATGAAAA
TGCTGATGATGACAACGAGGAGGAAGTTGGAGGTGCTGAAGAGGAAAACGGTGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGCTTTCTAAGCTTTAATGTGCATCTGCAGTGTGCAGCTCTGATTCGG
TCGGTGGTTGGGGCCTGAGAGTCTGTTGTTCTGACTAGTTCTGGGTGCTGCAGATGCAGG
AATGACTACACTGAGGTGCAAGGCTTCTCAGCCTGAGTGGCAGGGAGAAGTGGCGGTGGT
GGGATATTGGCTCTCTGCTGTCATTCTCAGGGCTGAATGGGGGGAAGCTTGTTAGCTTTC
TCCAGGTTGGGTGGGGGCCATGTCTTGAGTTTATGCCTCATCGTGAGTCAAAATGCACTG
CTATAAAACCATAGAGCTCTCTTAAATAAAAAATATCAAAATATGAAGCCATTGCTTTTT
GATGTCTGTCTAGGTCTTTATGCTCTTGAGAATGCTGCTTCCGTTTTCCAGCGCTTCCCC
AGAGCACCCTGCACGTGTTGTCTTCACCACGTCAGTACGGCAGTCTTGGCGTCCTTCAGG
ATGCTGTTCTCTTTCATTATTCTTTGGGGACATTGCGTTTGGGGAGCAAAAAGAAGGCTA
ACGGCACGATCAGGGTGGATGGGATAAAATTTTCCAACAAAGTGTTCGTAGGACAGACCT
TGAAACCCTCACTTTTGTTGAATCTTCATAAGCTTCGTAGTGAGTCCTTGGGTTTGCCTT
GTGTCCTGCACGGAAATCTAGATTACCCTGCGTAAAGCCATAAACAGTCTCTGAGTTGAT
CTCTGCCTTGAATCACAGAAGTTTTATGGAATTAAGTCTGGTCATTCACACACATCCCCT
TTGTTATTTGTAATGGTCTTACAAGGCCTTACCCTGAGTAAATAAAAGTTTCCAAATGGT
CTAAAATGCTAGTTCTTTTTAGTCATTTATTAATTCTTAGTATATAGTATGAGATAGAAA
TACAGTATTTTCTCCTCATTTCCAAATGACTAATTTGACATGCCAATGAAACTGACAAAA
CACTTTTTTTTCTTTCCTCTATGATGAATGCCTTTTAGTAATACATTTCCTCCTCTTATT
TCTTGATTTTCTAAGTGGATGGACTCCCTGTTCATAGCAATAATAGTGTGTGCAACAAAC
GGCAAAACTCACGTGTCTAGTTAGGTTTAAGATAATTGAACAAGGATTATCTTTGTCACA
TGAATTTGGCCCTATTAGATGGGAATTTGGGCCTTTGATTTGAGGCTAGAAATGGTCATT
TTGGACTATAACTTCAGAAATGATATATGTTGCCCACCTACAGTAAAATGTAGGCTGTGT
GTTGAGGATAGGAAAGCTTTCAAGGGATCAGCCAGCCAGACGGTTTTCCGGGCATCAGTG
AAGCCTGTGCCAGAGGTCACCTGTAGCATCTATTTCTCATGTAGTCCTGTCACCTCTGCC
CATCCATTTCCTCTGACCCCTCGAGGGTCTTCACCCTGTGCCTGCTGAAAGGAGAGCTCT
GTGTTGTCAGGGTTCGTTACACTGTACAAATGTAACAATGGAGTGTGGCATAAGAACCTT
TGATGGGGGTTGAAGACCTCGTTTGTTTGTTACTTGGTTTGTTACCTCTGAGTGAAGATT
TCCCTCATTGAGATTTTTGTTTCTCTTCACAATACAGCAAATGGAAAGGTGATAACAGCA
GTGTCAGTTCCCTGTGTATCAGCCCAGATGGAAAGATGTTGCTTTCTGCTGGTCGAACAA
TCAAGCTGTGGGTTTTGGAGACCAAAGAAGTTTACAGAGTGAGTGAATCAAATTCATTGC
AGGCATAGGAGGGAGAATCCCCGTCACAGAGAGTAAATAAGGAGAGAGGCTGACTTCTGA
GCCATGGAATATTGCTTGAAATGTTTGGTAGAACTAAAGCCCCAAACTTACAAGTTGTTT
TATTGATGTTCCACAGCCTAGCTGTGCCCCATCTCACATTCATTAGAAAAACCAACAGAA
TAAATGAGATTTGAATTAGAAATCTTTTACTTGGCTTTGATTTGTAGTCACTTGCATCCA
ACGTTTTGTCTACTTCACAATATGTAAATAAGGTTTATTGTGAGTTGCTTCCCACTCCTG
ATGACCCTCATGTGTGCAGAGTAGAACACCATGGGATCTTCAAGGCAGTGAGCTCCAGAA
GCAGATCGCCAGGCCTGCCCTCTGAGGTGCCATGTTCACAATGGGTGGGCTTGGAGCTGC
GCGGTTTGCCTCATCTTGGTGTGGTGTGCACTTTTTGTGGAAAAACTGGTTTCACTGGGG
GCTTACTAAGCTTACGGTGCTGTGATGATGCCTTAAAATTGTGGTTTCAACTCACTGAGA
GTAAATGAAGACTTACAATTCCTTGGCTGTGTCTGAGCACCCAAAGTATCCCTTGACAAA
TACACAGAAGTAAGTGAATCTCGATCTCAAAATTGGCAAGAAATTGTTGGAGGGCGGTAG
AGTCAGCGGGATTCATGAGGATTCATGATTCATGACTTTTTAGTGTTTTCATATGGGTTT
TTTAAAAAGGAAGAGGAGCATATTAAATCATCTTTGTTTAGAATACAAACCTCTTACTCT
CAGTTTGGAGTTCTACTTTGAGATGCAAAGCATACATCTTTTAGGGATACAAATGGACTT
AACTTCCTGTTTTGCATGCGTCCTCTTCTAAATGGAATTTAACTTTCTCTAGCACTTCAC
AGGCCATGCGACACCAGTCTCGTCACTTATGTTCACTACTATCAGACCTCCTAATGAGAG
CCAACCCTTTGATGGAATTACAGGTCTTTATTTCTTATCTGGAGCAGTCCATGACCGGTT
ACTGAATGTCTGGGTATGTAGTCTTTCTTTTTTTATTTGGGAGATCGTTTTGCCTTGGTG
ACTGTGGAACATGGTTATTATATATAAATTATGAGGAGCTAAGTGTCACAACAAGTTGAG
CTAACCGGAAAGGTTGGCCAGTTCAAGCCCACGAGCCCACTCTGTAGGAACAAGATGAGC
TATCTGCCTTCTGTAAAGATTTAGTCTCTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNATGCCGTGAATGGAACCAACTCTGACTGCGAGTTTGGGTGTTTCTTACA
AAGTATGAGTCTGAAACTTAATATTTGTACTTAACGCTGGGTTTATTTTAATTTCTAATA
CAGAAATTACCTTGCCTAAGAACATCTTTTTTTGCAGTAGAATTGTATGTTTTTGTGCCT
GGCTAATTTTAAAATAGGTTGTTTTCCCCTGTCTTTCTTTCTCTTTTTTTTTTTGGTAGG
AGAGCATTTGATTTTGTTGAAAAGATTTGATTTTATGCCACCTTGGGATGAAGCAGTGAT
GTCCATCTACTGATAGGTTACATTTTCTGGTGTGTCTGAGAATTCCCAGCACCCCTTTTT
GGGGTGAGAGTTGCTGTTACTGATTCTCATTTAAGCTTTTTTTTTTAAGTTGTGATTTTG
AGTGTTAAAGACCCATCACAAAGGTTTTAAATTTATGAAAAGAAAACAAATTTTTCTGAC
ATCATCTCATGGTGAAGTAGTAGACTTTGAAAAAAACCATGCTGATTGATTTAAAAGTAT
TTTCATTTTTTCTTGGCTAAATCGTAGGAGCGTAGTGGCTGAATGATGGGTGATATGTAT
ACATGTTTTTGAAGAAATTGCCAAACTTTTTCAAAGTTCTGCCATTTCATGTTCTCTTCA
GCAGTGGATGAGGTTGCTGATTACTCCACATCCTCAACAATACGTGGTGATCAGTGAATG
TTAGCTACTTCAATATGGGTGCATTTTCATGTTGAGAATCGGCTATGTGCTTATTTTGCA
AGTTGAGAATTCTGTATATATTCTGAACTAGAAGGTATATGCTTTACAAATACTTTCACC
GAGGCTGTGCTTTGCCTAATTCTCTTTAACAGCTAAGTGTCTTTTGACGAGTGGAAGGCT
TAAATTTTGATAAGTATGGACCGTGTTCAGAAAACTTGCCTGACCCAAGGTTACAAGGGT
TTTCTCGCGCATTTTATTAGTTTGGGGTTTTACCTTTAGTTCTGCGGCCTGTTTTGTGCT
CATCTTTGTATGTAGTGTGCGAGAAATGGATTGAAGGTCTTGATTTTGTATTGGGGATAT
GCCATTGCCCTGGCACAATTTCTAAAAGAGAAGAAAATCAAGTTCTCAAAATCTCACCTT
GATATTTTGGTAGATATTGGCAAACTAATTTGAAAATTAAATGGAAATGCAAAGGACACG
GACTACCCCAAGCACCTTTAAAGATCAATAAAGCTGGGATTCTAACACTGCCTCTTTTGA
AGGTCACACAAACTACAGTAATTAGTACTGGTATTGGCATCAAGATGGATACTAGATCAC
TAGGAATAAACAAGAGGATGTTGTTCATTCTTTAAATCTGCCACAAATTAATATTTCATT
TTACTCTGAATTATATCACTTGGTCCATTTTACTCCAGACTATATCGTATGGTGGTTGTG
ACTTGAAAACTTACTTAATTTTGTCTTTTGCCAACTTACTGGTAATCTAATGTGATGATC
CCTTAGATGCTTTTTTCCCCTCTCTTTTCAGAAAATCTGTTTCATTACCTGATTGTTGAT
TTGTTATCTAGGCAGGTCCGGTCAGAGAACAAAGAAAAGAGCGCAGTGATGTCTTTTACA
GTTACAGATGAACCGGTCTATATTGACCTGACTTTGTCAGAAAACAAAGAAGAGGTAAAT
GACTCCATTGTTATGGAGAACCTATTTTTAGATCTTATGCTTTTTTTTCTTTGTAAAATA
TCAGGACTTTTTTATTAGACTTATTTTTATCTTGTTCCAATGTTTTCCTTTTCTCTTAAT
GTTAGCAGTTTTATTGATCTCTGGTTCACATAGCAAACAACACAATGGCTTAAGCATGTT
AAAGAGTTTAAAATACATTAAATTAAAAACATTTTAATTAAAACAGGAAAAAAACTAACA
GTAATGAAATAAAACAAAACACTAATTAAAAAGAAAGCAGAAAATAATAAAAACTAGAGC
ACATTTAAAATGGATCAAATGGGAGAACAAATGATAAGATGTTAAATTGTAAACGAATTA
CATTTGCATTACTCCACTTTCTAATATTCTTTCTCTGAGAACAAGGTTATTCACTTCCCT
GGTCAGAGGGGATTCGCCAGACGCAGTGGTTCTCAACCTTCCTGATGCCGAGACCCTTTC
ATGCAGGTCCTCGTGTGGTGGTGACTCACCGCCCCCCCCCAACCATAACATTATTTTCTT
TGCTATTTCATAACTGTAATTTTGCTACTGTTATGAATCAGGCAACCCCTGTGTGAAAGG
GTTGTTCGACCTCCACAGGGGTAAACTTCAAGACTTTTAATGGTAGAACGGCTCATTGGG
AAAGAAGGAACATGAGGGATTGTTAACAGCAAAGTATAGCCTTTACTTTAAATAAAGTAA
TACTTTTGTGTCTTGGCGGAGGTTTACACAGCAGTTTTAGTTCCCACTCAACAGTTAGCA
CACAAAGTAATCGATGATATTGGCTGTATTCTTCACCATGCCCGGACATTTATGTTGATT
CCGTCCTGCATGGTCCATGTTCATTCATCTCATTGTCCTGCCCCCTCACATTCTTTGTTT
TCATTGTCCACCATTAGGGCTTGTATAGTTTGATTTTTTTTTTAAAGGGCTGCATATGCA
TAGGTGATTCTCTTTACTTTTTTGAGCCAATTTGTTATTTAGCTAAAAGGTAGGGCTACT
AGATTTGGTTTAAGCTTTAAGGAATATCTCAGGGCAATAGTCTTTGGGGAGTCTTCCAAC
TGGTTGAATAAGTCTTTTCAGAATTTTTGTTCCACATCTCTCTCCATTCTTCCAGTGCGG
GCCATCAGTGGTGGGCCTGTGAGACTGGTCTGCAGTGGTGGCTGAGAGGAGGCGAGGCTG
TGTTCTGTGAAGACACGCGTCCTGTACATCGGTTTCTTGGGTCTCAGGTCTCATTCTGTT
GGTTTTGCTCCAGATGAGCTCCTACCAGTAGTGACATCTCAGATGGCTGAACAGAAAATC
TGTTTAAACAAAGCATTGCTAACTGGCAACATTCTTTTTGGAAAGGGAAAATTTAATTCC
AAAGACATTACATTTTGAGACTGCATATGAATAAAAGTTATTAGAGTAGGCATTTATTGT
TAGAAATTTTTTGAATGGTTCTTCTGTTAGTGGCCTTTTTTTTGTTACAAAGTTTTGTAT
GTCCTAAGGTTTATTTACAGTTTATTCTAGTCACATGTTTCTTTTTTCATGTAAAAATGA
ATTTTATTATACCATATTGTCAGCATTTAGCAAGCCTTATATTTTTGAAGTGCTTCATGT
TCATGTTTCTGTTTGATTAAAGCTTGTTCAAAGTTTTTGCTTTTGGGTTCTGATTTAAAC
AGAATCCTAGTCATTCAGTGAAAGCTAAGCATTTCACTTTGAACACAATCAGGGTGTTGA
AATGCGTGTTTTATAAACCTCTAATAGAGATGAGTTAGGGCGTTTTCATTGTGTTTATTA
TTTGCCACCATAATTAAGTTCGGGTATTTTAGAAGTATTTTAATTATGTTTGATTATTTA
AACTCCCAAATACAAATAATTTCTTATGATAAAAATCATCCCCTTTGAAGTAGTAGCATT
TTCCTTTGGACAGTTGATTGGGTTGTTGCTTTCTCTCTTTCTGGCTTAAATCATCAGTAA
TCAAATATGGTAAAGGACAACATCTCACCCATCAGAACGTTTAGATGTTCTTAAGATATT
GAAATAGGAATAATGGAATCTGCTTCTTAGAAAGCCAAGCTGTAGTTTTGGTATATGAAA
AAGTCTAGCCAGAACAATCATTTAAAATGCCAAATTATCTTGATTTGGGTGTTGATTTTT
CTTAAAAGTTTTATATTTGGGTGGGATTGTTGGCTTTGAAGCAGCGGTTCTCAGCATGGG
GGTCGAGTCATCTTGGGGGGTGGAGTCAAATGACCCTTTCACAGGGGTCGCCTAAGACCA
TAGGAAAACACATATTTCCGATTGTCTTAGGAACCGAGACACAGTCCTTTATCTGTCTCC
AGGTGGGTCTGCCCACCTGCAGATACGCCCACATACAAGTACCTGGCGTGAAGACTGTTA
CCCATGCTACACCATGCTTCAAGACAAAATTTCATTTATTTGTAATTAGAAATATTTCAC
AATATATAACTACATATTGCTTTTGTGATTAATCACTGCTGTAGTTATGTTCAGTTTGTA
ACAGTACATCCTGCATGTCAGATATTTACATGACAATTCATAACAATAGCAAAGTACAGT
GATGAAGTAGCAATGAAAATAATATTATGGTTGGGGGTCACCACCACATGAGGAACTGTA
TGAAAGGGTCATGACCTTAGGAAGGTGGAGAACCACTGCCTTAGAGGATGCAGAAGGGGA
AGTTGAAAACTTCATGAGGAAAATCTCAGCGTTCTTACCTTTAAATCTATCAATAAATTC
TTTAAGGGGTTTTCCTACTGCATTAAAGTATTTTTATCCCACTATTCCTGTTGCTCCTAA
CATATTGGCTCCTTCTGGATTCTCCTACTGTGTTTTATAACTAGAACAGATACAGCAACT
TTTGGGATGTGCTAAATTTTCATTTAAACATTCCTTATATAGGCTTTGGGACTTTAAAAA
TGAACTGGAGATGGAGCTTGTTGGTGTGTGAGGTTGACAACAGTGTGGTTCAGAGGAGGG
GCCAGACAATGAGACTAATAGCGTTGGCATTACATGGGGCTGAGGACTGTTGGCCCTAGC
CAGTGGCACTTTTATCAGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTTGCTTTAGTTACAAGAGTTGTCCATTTTTGTCAATTTTTCTCTGGCTATTTAAAGCTG
AGGCGGGGGGGGGGGGGAGTGAGGTTGTTGTTGTTTTTTTTAAGTTAGATTGGAGATCAT
ATTGTATGTTGGCCATGTAACGGGCTTGATAATTTGTCTTAGAGTAATTAGCTACATTTT
TCTTTCAGCCTGTCAAGTTAGCTGTTGTTTGCAGAGATGGTCAAGTTCATCTATTTGAGC
ACATATTAAATGGGTAAGTAGGAAATTTTTCTAAAAGTTATTTCCTTAATCCTGCTTCAG
TAACAGTGTGCATTCTGTTACTTTGCAGATAGGTGGTTCTGAAAGCAGCCTTAGGGCAGG
CGTTTCTTCATATATTGGGGCTGGGAGAGTGGCTTCCTGCGAAGCGTGCCTCGGTAGTCT
GGCTGTTCTGCCGATGAAGCACAAGAACGTGACTGAGCTGAGCTTCCCATGTGGCCGTTG
GTACTGCGTGTGCTTCTCTTTGATCATGCTCTAAGTGCCTTTGCCACACGTGCGCCCACT
AGTGAAGCATAGCAGTGATGTTTGTGTGAGGATAGAGAGATGCTATGAAGTAGAGAGCAG
GGGTCAGCAACTGGCCTCACCTACAGACCCCCAGCGACTCCCGAAACCTGAAATATTTGT
TACCCGGCCTTTTTAAGGGGCGTTTGTCCACCCCAACCATGTCCTGTAAACACTTCGTTT
TTGAGACTTTTAAAATGCTTTCAACCTTTTCTTGTTGATCGGTGTCCTTTTAAAGTCCTA
GTATAAGCATTTTATGTAAATATAAACTAATTAGAGAAGTCTCGACTATACGCATTTAAA
AATATTCAGGATGTATGGGAAGAATTGATTGGTAATTCAATCATCAATGAGTCACCATTG
CATTGAGTAATACTTTCTTAGAGATAATGGTTAACCATTTTGGGGTGAACCGCATGCCGC
CCTTGATTAACGTTCACGCATGGGAATCCACATTGGAGGGTCCTGTTGAAGATGGGGGTC
TTCAAAATTGGTTCATGGTAAGGAGACTCGGGTGTTTTTCCCTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGA
GAGAGAGACTAAGGCCCCAAATCTGGTGTATTTCACACTTAGAACGCATCTCGGTTTGGA
CTAGCCTCATTGCCAGTGTTCAGTAGCACCTGTGCCCAGTGGGTACCATTTTGGCCCCAC
AGGTATGACAGAAATAACTGAATTATATCCAAATACACAAAAGGAAACCTCATTAACACT
AGGTTTTCAGACATTTCTGATATACCTATCTGTGTGGACATGTGTCAAATTGACACGTGA
GCAAAACTGCGCATTTTCTTTGTAAAACAACCCAACTTGTTTAAACACAGCATAATCATA
CATGATTAACTTATAAATGAAACTGTGCTACTGTATATTTATATAAAGCTTATAATACTT
AATGTTCTACAACATTTGATGTACTGGGTCCAACATGTGGGCCGGGATGCTTGCGTTGGC
CAGTATGACAATCTGCGTTGTTTGTCTTGACTTTGGATGTTTACTTTCTAAGAACATTGT
AACTACACTTATATTTGTTACTGAAATAATGCTTTCATGAATGGAATGGGACCTGTTTTC
TAGAATTAATATCAATTTTTGTTTGCATCAAATTGACATGCATTCGTAGAGATAGGTATA
CCACACAGAGAATTTGGAGATTAGAAAGCTTAGGAAAAAAAATGAATTTGTGTGTGTGTG
TATTTTAATGGATAAAAGCATAAATGGCAGGAGGCAAATGTTAACGATTTCTGTAATTTT
CGTTGTTGAAATCGAAATGTCTCAGAATGCCATGTCCTGTAAACTTAGTGCTACTGCAAG
AACCCTTCACAGTAGCACCTACTGAATTTTCTAAGTGGTAGTGTGATCCAAGTGCAAAGA
TTTAATGTTTTTTATTACAACCCTTACAGACTTCCATTGAGTTTTGAAAATGTTCAAAAA
CAGGTGGTTTCTTAATTATGTAGAGATAGTTATATTGAGTGAGAACTGTGACTAGATGAT
TAAACTTTTATTCAGATTTTTAAATTAATATACATGGTTTACTAAAAATGAGAAACATGT
AAGCTGTGAAATATCAGGCTCCACGTGGTTCATTACTAATGCCACTGTTTTATATTTCTC
TTGGCGATAACTGGTTGATCATACAAATGGGCTTCAGAATATTTGTGGGAAAATGGGAAT
TAAAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCTGCAGGCTCTAGTTGAATCTTTGCAACCATAACGT
CCTATGTCTTCTGTGAACTCTGTTCTCCCCCCTGGTTTCCCTCTTCGGTGCAATTGTGAG
CTTTAAAATGTTACAGACGTTTCAGATGATCCGTTTTTAAAACAAATTGCCCAATTCAGT
GACAATCTTTAATTCATGCTATATTGAGTAGATTGGGTTTTCCACTAGAAAAAGCTCTCC
AAAGGTGTTAGTTTTCTCGCTGTGGATAAATCTAGGAAGGGACAAGCCGTAATTTCTTTT
TGCACACCCCCTGACTTCTTATTAACAGGTGAGAACACCGGTGATGAATTCTGAAGCAAA
AGTTCTGGTGCCTGGAATTCCTGGTCATCGTGCAGCTCCCAAGCCTGTTAAGCCACAAAC
TGAGGAATTACAGAGCAAAAGGAAACTGGGGGGAAATGAGGTAATACAATGGCGTGGCAC
GTTTATTTGAGCTTAAAATTTAAGGTGACTGGGAGATTGTGGCAAATGTGTTGAGCCAGG
ATCAAAACGTTGGAACCTTTTGTCCCTGTTAGTGTAGGTTTTGGAATTCCAGATTATGCC
TCTTAAAGACTTGGTTTGGCCACTGTTGAGAAGGCAGAACTTGGACTACAGCTGAAGAGG
GCGCTTGTGGGCCACATGTTCATTGTTGCTGCATGACAGACCTGTCATGGAGTAAAAGAA
GCCAGGACTTGCCATGATGACTTCCAGTGGGTTTCGCATATTGCTGAGCTCCAATGATGA
CTCTTCTCTTGGCTGTCTGAGCAGTCCAGGCTGGTTTACTGCTTGCCACGTTTTGAAAGT
GGCTGTCATTGTCATCTCTTAAAGCATTTTTTTTTCTTAAAGCATGTTTAACCTTCCCTG
CCCCGCCTGTTTTGAAAACATTCCTGTCCTTGTCTATTGAAAAATCCTTTTTTAATCAAC
TATTCACACTGCCTTTGTTTTTCTTAGAAAGCTAGAATTTTAGTTGTTTAGATGGTGATA
TTTCAGTCATGCTCAGTTTTTGGTAGATTAGTTCTTTAGCTGATTTTAATTGTCTTTTTT
GTGGGGGAAGGCTGGTCAGGGACAATACTGCTGTTCTTAAGATACGGAATTAAACACGAA
GCGCCACCTTTCTTTAGCTTGCTCTACCTCTAGCCCCCTCTTTTCTTCCTGGGCTTTTAT
AAGTTACGATAACTCAAAGTTGGGAGTGACCAAAGCACATGTACATTTTTTTCTGTTTAA
TAAGGGCTCATGGAACATGGTTTGTTAGGCGTTCTTTGACCAGTTATGAGCCTCAAATGA
TTGAATTTTTATATAGGAAATTAAATTATACTTATTTCAAATAATTATCAGGGAAAACTT
GCTTGTATAAGACAATACTAGCTCATGGTAGTTTGCTACTTAATTGGTAGAGAGAAAAAT
AGTTGTATGTTTTACAAATTGTTTTGGGAACATGACCATTTTTGTCTTTCAATATTAATT
TCTTTCCCTTTAATAGATTAGTGTAATGCGGGAAGCTCCTGGGATGACAGTCCTTGTGCT
TCAGTAATTGTCCCAGGTTCTTGGAAGCCTCATTTGAATCTTCATATATAGAGTTATTTT
ATTTTTCATGAATTACATTTTCAAATCACGTGCTTCTTAGGCAGCTGGTATTTTCCCTTC
CCTGGAATCTGCAGGCTTACGTTGCAGATGTTGCATCTTGTCCCAGCTGTGACTCACGGT
GGTCCCACTCTAGTGGGATGAGGAAAAGTGGGAGGGTGTGCTTTTTAAGAATATGGCGTA
ATATTCTGAATGAACTACTGTAGGTCTTAAGTGTCTAACTAGTCTACTGGGTTCTAGGGT
CCAGTTAATGTTAACCAGGTCTTTTCTGTTCTGTAGGTTAGCATTGAAGAACGCTTGGGA
GCAATGGATATTGATTCTAAAAAGGGAAAAGATGACCTTCCACAGACGAATAGCTTCCCA
GTTCTTCTAACGCAAGGTTTAGAAAGTAACGATTTTGAAATGTTAAATGTAAGTATTACA
GCAGCTTTACACGTAGAGAAAGGTGATTCGTTTTTCTTAGAAAGTGCTTAGTGTCATCAC
ATCCATAGCCATGTTGGTAATGCCTGTCCTGACTTCAGTGTTTCATGACTGTCGTAAACT
CTCTCTCACTGGTGGCACCATGCACTCAGTCGTCAACCTCCGCCGGGATTGTGTCGGGTT
ATTGACCCTGGAATACATTTTCTCATAGAAATCGTGTCCTGAGTGGTTATAAGGTTCTTA
ATCCACAAAAGCTTTTATAAACCATAATGTAGCTGAATTATGTTACTCAGCATTCTAGGG
CACAATTTATATTTTTTTCTGTAGGAAAATGCGTTCCTGAGTTTTTACTCTGGATTCCCG
AAATTTATATTCTCCAGGCCACCAGTGGGGGCAGTGAGGTGGAACCTTGGCAATGGGTAG
GAGGTTTGGGGGAGTAATCAAGAGGATTGGGGGTGATGTTCTGAAATACTTAGAAGTAAA
AGTCATAGAAATTTTGTCTTAAGAACAGGTATTTGTGATATCTTTAAGTTGGTGACCACT
TGCATAAATTAACTAATGCTGTACTTAAAAATTCGAGAAGTTGTTAGCATATCAAATGTT
TCCATTAAAAAATGGATTTAAGTACTGCCTAGATCAGATTAAAAGAATCTATATTTATTA
GGTGCATTTATTTATGCTAGTGGCTATTGTGCCACTAGTATAGATGGTGACTTTAACATG
ATGCTTCACCTATGAAGAGTGGTCCAAGTGGGAATATTTCCTATTGGTGTATAAGGTGAT
TTTGCAAAATGGAAAAGGAAACTAAAAGGTCTAAGAAACTTAAAACTTAATGTGTGTGTG
TGTGTGTGTGTGTGTGTGTGTGTTCCAGCAAGTCGATCGTGATTTACTGATGCTTTAGAA
ACCGTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTATGCTAGT
GGCCTATGTGCCACTAGTATAGATGGTGACTGTAACATGATGCTTCACCTATGAAGAGTG
GTCCAAGTGAGAAGATTTCCTATTGGTGTATAAGGTGATTTTGCAAAATGGAAAAGGAAA
CTAAAAGGTCTAAGAAACTTAAAACTTAATGTGTGTGGCCAGCGGGGGGTGGCAGTGGCC
CTTCCTGTTGGGCTGGAGTGTACATATGTTAATAGTGCAAACCCAATGCCACATTTTTAT
AATTGTGATTAAACTTTATTGTACAAAAAAAAAAAAACTTAATGTGTGTGTGTGTGTGTG
TTCCAGCAAGTCGATCGTGATTTACTGATGCTTTAGAAACCGTCTTGAGGCTGGGTGAGC
AAGAAAGAAGTGCTCGGAAGCACCGGGCAGTGTTTCTGTAATGCCGCAATGCAGCCCATG
TGCCGTCATTGCCATTTGACGCTTTCTTCCTTTGGAGATTTGAGTGGCTGTTACCAATGT
TTTTTCTTATCTAGCTTTAAGAAAAAATTTTAAGACATTTACAAAAACAGAGTAGCACAA
TCGCTCCTATAAACTAACCATCCAAATCCACCAGGTATCAGCACTGGCCGTTCTGGTTCA
CCTCACCTGTCTGTACCTGCCCTTTTAGCCACACCCAAAGGCATCAAATAGTTTTTATTT
TTGCTTCCCTCAAAAGAGCAGCCAAGTAAAGAGCACCCATTGTATTTGAATGGTGTGCCT
CTTAAGTGTTTTATTTTGAAGGGAATTGATTAACCCTGTAGAAATTCTACATTCTGGGTT
TTACCTACTGCATCTCTGTGGTGTTGCTTACCATGTCCCCTGTCCATCGTAATGCCTGCA
CACCGGTAGTTAAAAATCTAGCAACTTGAAGAAATCCAGTTAGAATCTTTCGGGTAAGGG
GTTAAATGTGCACTTGTGTCTGATGTCTGGCATAGGCTTTTATGATGATTGATCCTTGTC
TAGATTGATAATTTTGAGTGTACAAAATGGTCTTTGTTGTCACTCCAAAGTACATTGTGT
TCAGGAAATGGAGGAGTCAAAAATGCTTCCTTCTTGCCTCTCTCTTAATTTACTAGCTTT
CAGAAAACTGGTTTCTTGACATCCACCAAAGAATCCCAATGACTTTTCCTTCCTGCTTAT
CATTGTGGACACAGATTTAAACATCTTATTTCATGTGTTTTCACTTTATCAATATCAATG
GATTTTAAGCATAAGAATTAACAAAAATAATTTTGTCTAAAATTAAGCCCCTTCTGTTTT
AGAAGTTGGTTCACATTGAAAAAGAATGGAGGAGTGAAGTTTAAATCTATTGTATTTAGC
AGTTAATTGAGCATATTTACTAATGTGGTACTCTACAGATTGAAAAATATTTATATATTC
ATTTATGTATTCTTTTTTTTCATTTAATAAAGTGTATTTCGGTCTAAGAAATCCCACATG
GAAGAGCTTTGCAGAAGTTTTTTTTTTTTCTTCTCCATCACGTAATAATAATCGGTACTC
TGGAGCTCATTCGTAGAATCAAGCACTCAGAGTCATGGCATTGACATAGCCAAAGTTGTT
TACAGCCTAATCACCTTCGGGGGAAAGGACATGTATTGGAGAATTCAGTGTGGTTTCACC
ATCTTTGACTGTGGGACCCGATGGAGAGCACGTCGTGTCTGTGCATGGTTTTCTTCATGC
TGATGGTATCCTGGTGGGAGCCGTGGTGGTTGAGTGTTGGGCCCCGAACCGGAATGTCTG
CTCTTCAAAACCACCAGCCACCGCACTGGAGAAAGACGGGGCTTTCCTGTCCTGCAGTGA
AGAGTAATCTGGGGGAGGCGGCATGAGAGCGGATGGTGATGGTGTATGTGCAACTCTTTT
TAGAAGCACTTTCACTATGGAAGTGTCGGATATGTGAATATTCTATCAAGAAAACTACTA
AAACAAGAAACCAAACTTGACCTATGGTTACCAAGGGTTAAGGAGAAAGAGTTTTTGCTC
AGTGGGCATTGAGTTAATGGAGATAGATATCACTAACGGTGGTCTAATACAATGAGTGTA
ATCAGTAACACTGCATTGTACACGTAGAAGCTGGTGAATTGGTGAATGTTTTGTTGCGTG
TTATGCCTAAGTTGAAAAATAATTACATGACTAGTAATGAGAGTACGGGGAAAAAGAAAT
GTTCTAAAATAGACGGTGGTAAAGATCGTACAACTCTTCTTGATGGAGTAGAACGATTGA
ATTGTATGACGTGGATGAAGTGCCAATAAAATGTTTTTTTAAAAAGCTATAACCTTGGAA
ACTCACAGGCCAGCAACTTAAATTCCCTAGAGGGTCAGGATAGTCAGAGTGACCCGATGG
CAGTGAGTTTGGGTTTGGAGTTATGTAGGACTGTCATTAAGGAGTTAGGGGTGAGTAGTA
TGTTGTAGTGATTAAGTAAAAGTAATAGGGAACTAGCTGAGTGCTAAAACTGCTGTGTTG
CTGCAAAAAACATAAAACTTACAATGAAGAATCTAAAATATTGCCCTTAAAAAAACAACA
AAACCTCACCCACTTTTCAGTGATTACCTATGAAAAGGATTTTTGGTTGCTTAAGAAATG
ATGTGTTTCTTAATTATGGATGTGATACTTTTTAAAGATGTGACTTTTGAGAAGGTGTTG
GTGTAAAGCTACTTTTGCAAGCAAATTTATAGGAAATTCTGAAAGACTGAGGGATTGTTA
ATGTAGGTTAGACGCTAGCACTCCATTGTTACTCTTCAGTCCTCATATCTGAGCCCTGCA
CCTGCCCTTCACCACCACCACCACACAGCTCTCGGCACTGCACTCGGGGAGGCTCTCTAG
GAGGAACCTGAGGAAGCCTAAATCTTCACAAGTATTTAAGGGGAAGGAGACTTGGGGTGG
AGTGAGCTCATGGTTCTGGAGATATGGAAGGGCTGTTGTTTTATGCCCATTCCACCTGTA
GATGAAGTGTGGGGGCGCAGGGGGCGGTGAGCAGCCTTGCTGGAGGTAGCTTCTCAGCCT
CAGGATCCAGCAGGTCGACCTTGTCCCCCTTTCTTCCCACTTGAGTCTGAGGCTCATGTG
GCACTTATAGCTTCATTCCTAAATGTTTTGATTCAAATGCTTAATTGTCTGATCTTTCAA
ATGGTGAAAGTGTTCCAAAGTTGACAGTTTCGTTTAAAAAAGGTTTGTCGGTTCTTAAGT
GTGATATTGCTATGTTGGGTCCACACCTGTGCAGACACATCTCTTGTCATAAAATGAAGA
TTTGGGAACTTTTGTTTTCTCAGGTGTCTAGACCCACCTGCGTCTAAAATGTCTTAGAGA
TAGTCTTTTGCATTTTAAATAAACATTTGACTCACGAAACACCCAACTTTAGAGAGGAGC
ACCCTGTGTGTTGCAGTAGAGTTTTGATAACTGAGGGAGGTACTTGTCTGGTGGCCACGA
GACAGTGGTCTCCCTCAGATCCAGCCCCGCAGCCTTTGCTTGAATTAGGTTGGTGCTTAA
TTGTTTTTACAGGTTTGTTTTCCTATATTGGCCTTGGCTTCTAAGTATGCTCATCTGGTT
TTCATTTTCTTTTCCCACAGAAAGTTCTTCAAACTAAGAATGTAAACCTAATAAAGAAGA
CGGTGTTAAGGATGCCCTTGCATGCTGTCGTTCCATTGTTGCAAGAGGTAACAGTGCTCT
CCTCCTTTTAAGGCCCTGTTGCTGTCACAGGAGCCCTGGTGGCACAGTGGTTAAGAGCTA
GGCTGCCAACCTATGGCTTGGCGGTTCAAGTCCACCAGCTGCTCCCTGGACAAAAGACAT
GGCTTCAGTAAAGAGTTACAGCTTTGGAAACACAGTTCTACTCTGTCCTTTAAGGTCAGG
ATGAGTTGGAATCACCTTGACAGCAGTGGGCAATACTGTGAATTTGGGGGAAAGCAATAT
TTAGACAGTTGGATTTGTAATAGTTGGGTAAGTTTAAGAAACAAAACATTGCTACTAGAC
TCCAGTTCACACTTGCACAGTTTGATCCCAAACCAAATGTGCCGACTGCCGTCTCTGGGA
GCCGTGGGTGATCGCAGACAATCTCTCAGCAATGTTAGACCCGTCTTGAGCTGGCTAGAG
TTGGGGGTTCTCCGTGGTGTTAAAACAGAAAAGTCTGCTCAGAAGGTTAGGGCAACTGTT
GTTTCTTGGGGGGAGGGAGGAGGCACTGGGGGCGGGTTTCCAATTGGGTATCTTGATAGT
TTTCTTGAAATGCACGGAACCATCACCGTAGGGAACTCTTAGGAAGACATTTTAAGCAAA
TGGAAAGCTGCATCGGGGAGAGAGGACCAGGGAAACGGTCCTGAGTATTGTTTCCAAACA
AACAATTACCTTGTGTTCCTGGAGGCGAGCAGGGGCGGCTGATGAAACTGTCAGGAGACC
TTGCTCCGCTCACCCGACAGCTCTGCCCTGCGCTCAGAGCCCCCCAGCACCCGTTGGAGG
GCAGTGAAAAGGAACGGGTGGAAGGACCTGGGCAGATGTGGTCGATAGTGAGAAACGACA
GGTTCACATTGTGAGCATGTTTAAAATAAAGGTTTCTATGATTTTATAACTTGGCCCTGT
ATCTGGGGAGTCAGGACATTTAGAGAAGAAATGACTAGGCGTTTGGAGTTTTGAGGCCGT
GCAATCTGGAGTTGGAGAGGGCATTAAGGTTAGGTTTACCAGCACCTACTTGAGCGACTC
ATTCTTCTTACTGACGGGCGGTATCCTGGCTTTGCGTAGGTAGCTCTAGCAGTGCGGAGG
AAGGAGTAGGTGACAGTTAGACAAGAACAGGACACACAGTGTGAGCATGCGTGCCCAGGA
GCCCTGTGTGTAGTTGGTGGTGGCCTGTGGGGGACCATCCCCCGGGGTGTCAAGGAATGT
GAGCACTGTGTTAGGTGTTTAATCCAAATAATTCACCCGATCTAAGCAATAACTCTGTCA
CTGAGATGTGCTATGTCTGAAGTCATGTAATTCATAATTATTAATTACTTTAAGGAAAAT
ATCCTTTACCTTTGAAAATTTTAAATGTGTGCGTTGTTTGGCAAGCTTATCCTGTAAGGG
TTTTTACAGCTTGTTAAAAGTAGCCTTAAAGATAAAACATTCTTTGTGATTAGAGATTAT
ACTTGGATTTTATTTGTTATAAAATACTGAAGTATTTTGTGAGGATAACTTTGGTATTAA
TCTGGGTGGTTTTGCATTATTAATAGATGGAACCTCTATAATTAACAAAGAGAGTGTTCT
GCAGTAGGAGAGCCCAAGTGTTTTGGATTTTTCCCGGAGCCCTGGTAGCATAGTAGCGAC
CTACCTGTTGGGCTGCTAACCCCAAGGTGAGCAGTTCAAAACCACCAACTGCTCTGTGGT
AGGAAGATGCAGCTTTTTACTCCTATAAGGATGAACTTTATGGGGGTAAAATGGGGGGTT
CCTGAAACCCCCAGGGGCAGTTCTGCGCCACTTGGTGACTATTTGGAGTCCGCATCTACT
AGTTGGCAGTTATGTGTAACATGTTTGTAGCATGTTGTCCACTCAAATTTTGCCTAGCTT
TTCTGTACATTATAAAGATTAGATAAGATTCACATCATAAAACTATCCTTTAAAACCTTA
CAGTTTGGTGGGTTTTGTTTCTTTCACAAAGCTGGGCTATCACCACACCCAAAATAAAGC
CCTTACACTGGAGCAGTTTCTCCCAACTTTCCACTCACTCAGGACGAGCTGTGACCACTT
TTTGGACATTTCTTAGAACTTCTCATCTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTTTTATTTTTTTCTTGGTAATGAGGATCTTTAAA
TGAATTTAATGACGTAGTCTTAACCATAGCACACTAAATTTTCATAGAACTTGCTGGTCC
CTGGCTTCTGCTTAAGGCACTGTAAGGGAATACTTTAGCTAAAAGAGAAATTTTGGGTTT
GTGTGCCCTCCCCTGCACCCCCACTAATTTGGTAAGATCCCAAACTTGTGGTACAGTACT
GTCTATACCTACACTGTACAGCTTTGTCTCTCCTCCGGCTTGCCCTGGTATGCTCCGTTC
ATCGGCCTTGGACGCATGCAGAGGAAGAAGGCCAAAGGACTCATGAATTAGGCCAGGTTT
ACATCTCTTCGATGTGTATTGCCTTTTATTACTGCTATTTGTGTCTGAGGTCGAATAGAT
GATAGGCTTTACTAAAATGCAAAATTATTTGAGCCCAGTTTGTTGCTTTGAAGAGTCTTA
TTTTGAAGCGAGTGGATTTTGTTCTTGAAATGACTTGCTTTAGCGGGAAGGATTTTTATC
CTGCATCCCTTCCTTCAGCCCTGCCTTCTCCCCCAAGGCTAGTGTAGCGCACGTCACAAG
TAGACTCCGTGAGGGGTGGGGGTGGTCCCATTCACAGTAGTTGATTTGTTGTAGGCATCT
TCAGAGTACCGTGGGTGGATTGTCCCTGTGCCTGTCTGAGGTTTTCGAATTTATAACTCA
GTTGTCTTTAATCTTGAGAGAGTAAGTACAAGTTTACTTGAATTGTTTTCTTTTTTCCAG
TGCTGTTGTAATGGTTCAGTGGCTAAAGTGTGTGCTAACGGTCCATGCTTCATACCTATC
CACAGTAAGTCTTTACAGTTAGAATTGCTGATAGCAATACTTTGATTTTGCTAATAATTA
ACAAACCCTCCTTGCTCCATTTGCCCTTTCAACTATCAAATGGCTTCCTCTTGACATTCT
AGTTTTCTCCGGGTTCAGTGATGTGAGCCTTTTTATCATGTCAAAATTGTTATCTTTTAA
GAGTTTTTCTGGTTTTATTTTTTTATGGTTTGTATATAGGTTTGTGTGAAAAGAAATATA
TTCTATAGGAGGATTTGATAAACTAAAAAAAGAAGTTTACACATTGATATATTTGCCTTT
AGGGATATATATTTTTTGTACATAAAACCTTTACAGCAAAATTGTTTTTGCGTTATATGA
GGGAACTTCAAAAAGTTTATGGGAAAAAATCAGCTATATTTTAATTCCATTTTTCTATGA
AATATATGAAGCGCCCCTTGTATGTCTCCATTGGCTTGCCTTACACAGCTTCAGGTTGTA
AAAATTTGTATACATGTGTGCTTCTCTTGCCAATCCGTACCTTGTTCCAGGAGTTTAAAG
GGCATTTTAGAGGTTACATAAATGATCTAAATGAAGTATTTATTACCTTGCTTTCTGGAA
GCAAGAAGACTTGAGATACTTAACGGATGGAGGTGAAAAACAATTGTAGCCTTTGGTTCA
GATTACACTTCAACATAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
ATCTGGACAATGAATAAGGTAGATGAAGACAGTTTGTTGCCTTGAGATATATGGTATTGG
TGAAGAATATTGACTATACCATAGATTGCCATAAGAACCACAAATCTGGCCTGGAAGTAG
AACTGTCCGCATGCTCCTTATAAGTGAGCATGGCAAGACTTCATTTATCTCACGCACTTT
GGACATGTTGTCAGAAGGACCCAGGCGCTTTGTAAAGGAGATGGCCACTCAGGATAGAAA
GAGGAAGACCCTATGTTGTAATCAGTTGACACAGTGGGTTGGAACATGACGAATGTGAGG
ATGGGGCAGGACTGGGCAGTGTTCCATTCTGTTGTACATAGGGTCCCTGTGGGTTAGAAC
CAACTCCGTTACACCCAACAATAAGCTGTCATTTTGTTGCGGTGGCTTTCAAGCACAGTT
ATTTCTGCAAGTGGACAAGATGGAGCGTTAAGTCTTAAATACCAAAAGACCAAATTTACA
CGTCACAGTAGGACTTGGGATCTCCGATACATCATTACATCAGCTGTGTTTTAAGCAAGA
GTGAAAATGGCAGAATTTGTTTATTTTATTGATTATCTACCCCGATTATATTGTACAAGA
GGGTACCCCAAAAACCCAGGATCCCCCCCTTCCCCCCCAAGCTATGTATTTAAATTTTTT
TTTTACAAAATGACCTGATCACCTTCAAAGTACTCTCCATTACACTTCATACATTTGTCA
AATCTGGGATTCCATTCTTGGAAATGCTTCAAACTCAACTGTTTGGGTGGCTGACAGCAC
CTCCCTCAGTTTTTTTCTTCACTTCTTCTACATTGTCAATCACTGTCTTTTCATGTCCCT
CTTCATTCCGAGATAGGTGAGTTGTGTGGGGCAAGAGAGTCATGCTTTGTATTTTGCCAA
AAACAGGCACACTGAGATGGCTGTGTGAGCAGGAACATTGTCATGGTGGCAAAACCAGTC
CCCTATCTGCCACAAATCAGGCCTTTTTTGTCACACTGTTAGACCAGGTTGACTAGAGAA
ACAAATCTATAGACATGCATATACCGTATATACTCAAGTATAAGCTGACCCAAATATCAG
CCGAGGCACCGAATTTTACCACAAAAACTACATTAAAAAATGTGCTGAAAAACTCGGCTT
ATACATGACTATATATGATACATGTAAGAGATAACTTTATATCAAGAAGTAATTATGCAT
CAATAAAATAGCCCTGTCCAAGTCAAGTCCATAAGTCCGATATTAGCCCATAAGTCTGCT
ATTAGCCCATGAATTTCTCTTCAGACTCACACAGCACATGCTGTGATGCTGAATTCAGGA
AATCACAGGCTGTTGGGGGAGGAAGGGGGGGAGGGGTGTTCCTGTGGAGCCAGTGGCTCC
AGGGCTCTGGCTGGCCATCAGTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNAATCTCATCCTGTCGAATTCTGGTCAGCTCAGTGTGG
GCCTGTCTCACCCTTACCAGGGTGCCCATTGGTCACCTCACCTTTGGACCATGGGCCCCA
TCACAAATTCTCAACAACCCATTACCCTCTTGGGAAAGGTCATGAACTTCGGGCCAGCCA
ACCCGCTCTCGTCTTCTCTAGGCCCTGTGAACCAGGTCCACTGACGTCAGTGGCCAGACT
CAACCTGTCTCTATTCTACTCAACAAGTGGATCCAGATGGTCATCTAGCAAGCATTTCAG
GCTGCCCGTCGGCTCCCTTTAACGTTCAGTCCTAGAGAGGAGAGTTTATTCGTGGCTACA
AGTGTTTCCAGCTCTGGGCACAAACCCCTAGTTCAGAATTCAAAGGCCAAGAGTTCCTTT
TTTCTGCAGTCTGTCAACAACCCCTCAGAATGCAAATGTTCTGAGGACTCCAAAGTACTG
GACGGGCCTTATCTGTTAGAACCTTTCTTTGTAGGTGTGTCCTAAGTCATTTAAAGATTC
AAATTGATGGTCGGAAACAGCTTACAAACTCTCTACTTCCCAGTAGTCATTTCTATCAAT
CATATTAATAACCAATAGGCAGAAGAAAACAGTATAAACTTAGTAGAGAGCCAGATCCTA
AACTCTGTCTTAAAGCAGTCAAGTTCCCTTATCTGTCTTAATCTTATCTAAACGAGTCCA
TTTGTACGAAATAGGAGGGAGGGCCTTAGGCCTGACTGCATCAAGCCAGGGCCTATCTTT
CTCAGTCATTTTGACCTACTCAGCTATTTGCACTAAGCATAATCGCTGAGAGATTCAAGA
GGTAATTTGGCCCCAGTTGAAAATATACATTGACATTCATTTTTGCCATTTCAAACAGGA
ATAACAAAATAATCAAAACGTAACCATATTCTTTCCGGAGAAGAACCCAGTGAACTACAT
GGCCATATCTGACCTCGGGCTAGCCAAAGAAGGAAAACTGAGGTGGAGGTCCAACAAGCA
GCCACTCTCCATCTTTAGGGTTTGTTTTTAAGTCCTCCATTCCTGGTATCATAATATGTT
AGTCCAGGCTGACTAGAGAAACAAATCCACACACAGTGAACCCTCGTTTATCGCGGTTAA
TCGGTTCTAGACCCTACCGTGATAAATGAAATTCCGCGAAGTAGGATTCCTTATTTGTAA
ATCAAATATTTTCATAGTTAGAGCATAGAGGACATGAAAAAACACCCTTTAGTCACCATT
ACACTCGTATTACCCAATTTATTAAACGAAAAAGGGAAAATACAGTAAAACATTTTGGAC
GTTACAATTATCATTTATTATTTATTATATTATGGCATCTAGTTTACAGTATTACATATT
TCACATACAGTATTATTATACATAGTTCTTACAAATACTGTAATCAATAGCCTATGAAAT
GACTTAAGGGATGTACTCTACAGGTGGGTCGCCGTCTTTTTCCTCTGAAGGAGCGGGTGT
AGGCAGTGCGTTTCTGGGTACACGTTTAAGAAACATTGTGATTCGCAGTTGCCGACGTTG
TCTCTTCATTTCAGTGAAAAGGTTTCTGTAGGGTTCCATTGCCCCATCGAGTGCATTCCG
GAACCGTAATGCACGATTCATTTCATGGATCCCATTCTTCGATCGTGTCCTGAACTTCTT
TGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATGGCATGCAA
CCTCCACGATTTTCTTGCCATCTTTGATCATATCCAAAAGTTTTACCTTTTCCTGGATGG
TGAGCATCTTCCTCTGGCGCTTATTTTTATTGTCAGAAGGCTTAGAAGAAGCAGCTCGTT
TAGGAGCCATCATAGGGCTTAGATAAAATTTCTTAAAAATCTCAATTACAGTACACTGTA
CAAAAGCAAAAATGCATCCGATACGTAGCGATGCAGACAGAAGCGTGTACAGTATGAGCC
AATCTGGCAGTAATGACAGAGCATGCGCTGTTACGCAAAAACCGCGATAGAGTGAAGCCA
CGGAAGTCGAAGCGCGAAGTGGCGAGGGTTCACTGTACACACACACGAGAGAACTTTATA
TCAAGAAGTAATTATGCATCAATAAAACAGCCCAGCTCAGTCCAGATCAAGTCCATAAGT
CTGACAGTAGCCCGTAAGTCCGATATTACCCCACGAATTCCTCTTGAGACTCAAACGTGG
CACATGTGATGATGCCGAATGCAGGAAACCAGACTGGTGGGTGGAAAGGCCCGTGGGTCC
ACTGGCTCCAGGGCTGTGGCTGCCATCAGCACATAGCTCCGTGTAGCTTGTCAACAGTAG
TCTGAAGCAGTTTGTGTGTCCCACCTCCAGGGAGACAGAGAGGAAGTCCCAGAATCCTCA
TGAGAAGGCCATACCCACCAGACGGGATCACCAGGCTGGAACCTGATTGACAGGCTAGCC
GCCACCCCTTCATTCTTATTTCTCAAGTTGATAGGAAATTGTGTAACTACCACACGCTGT
TACACAATCTTTTCAGAACCTTTAAATAGAAAGTTTGATTCTCACAGCAGTCTTACCTGG
TGGGAAAAACTCCCAAGTCCATAATTTCTTCCCTTCTGGAAGTTGGTATGAGATGTGGCT
AGGCGTGGCTGAGCGTGATCTGTCTTATCTGCAGACCTGTATCATGTGGTGTAACTTGCA
AATGCTTTTCCCCCTGCAGTTGCCTGACCTGGTCTCTGAGCTGAGGACACTCTACCAGTT
ACTGGACAGCAGAGTCAAAACTTTTCAGAAACTCTCCCACCTTCATGGAAAACTTATCCT
TCTCATTACACAAGTGAGTAAAGACTTCGTTTTTCCTGGGTGTGAGAAGAATGAAGAGCT
CTTTTACTCAAATGTTGAGAGCTCCCTGTTTCAGTGAAAATTGGTAAACCAAGATTCATT
GTTTACCTTGGAGATTAGTATTGGTATAGTATGAAAACTTGCCTATTTTGGCTGTTAATG
CAGTCAGGTTATGGTTGAGCCCATGATATGATGGATAAGTCAAAACCTAAGCAAAAGCCA
TTTCCGGGTTCCTAACAAACCTATAGGCCACATGGTGTCTTCCCCGCGTAGCTCGCCTGC
ATGCAATCTTCATAGAAATAGGCTCGGCCACGTCTTTCTTCTGTGGGGTGCCTGGAAGGC
TCAAACCACTGACCTTGTGGTTAGTAGCTGAGTGTTTAAAGCTGTACCACTATGGCTCTT
TGAAAAACAAGTTACTCTGCGATTTATATAGTTAACTTTGGGCACAGGAAAACAGTAACT
GCTTCATGGGGCTTCCTAACTTTTACAGAGAAATTCTGTTTTGTGTTTCAAGAATTCAGT
TGTTTGCTGTGTATTTGGTCCATGTTGTATTAAATCCATGCTTTACAGTGGAAGAGGGTG
AGCTTGGTTGTGGCAGAGGTATAGGGGAGGTAGATGTAGTGATTGTGATACTTAATGTTT
TTCATAATGTATTTTATCATCCTTTAGGTTACAGCATCAGAAAAATCAAAAGGAATGTCT
TGTCCTGAGCAGAAGGCAAAAGTGGTATATGAAGAAGGTAAAGGCTGCTGGGAGACTTTG
GTCTCGAATTAGAGCACTGGGCTTTTCCACAGTGACGCAATTCTTTATTTTGTGAAAGTC
TCAAAGGGGGGAAGATTATTGCATTGCCACACTTCTTATTAAGCAGACAAACTTGTGGTT
TAAAATACACACACAGACAAGCGCCACCCCCGCCCGCCTCACCCGGGAATCCGGGAATCC
GGGCTGACCCCAGCTGCGAGAGGTGGGTAGACCCGCACCCGCTGAGAGGGGATCTTGTCG
TTCTCCTCGCCGCCGCTAGGGGGTCGACTGGGAGTCCCGTTCCGGGGACCCACGGGACGC
GTGCACATGCGCGTTAGGGTGCGTAGGGTGGACCAGCGCTCGCTCCCTCTTCTCTGATGT
TTTGGGTTGGTTTGGGGCTTCCGTTCTCGCATCTTACCACTGTCTCGAAGTGTTTTTCTA
TTGATTTCGTCACTACTTCATTCAGACACTAACGTGGGCGCTGCTTGGTGGGGTGGGGTG
GGGGCGGTGTCAAACACACATGTCGGTCCACCAGTAGTCCGTTTGGTCCGTTCAAGTAGA
AAGGAGGCCCAAATTCAATAGAGGACCAGCCAGTGCGAGGGGCAGAGGAAGGAACACTGA
AGAGATGCGTTCTTAAAGAACTCAATAGGAATCTTTATTTACCAAACCTGATGTTAAAAG
AAAGGAAATGGGAAAGTTGAATAGCTTTAAGTTTGGTTTAATCAAGAGTCCTCTGGACAA
AAGCTCCCAGGTGCAGTGGTTTTATAGCTGGATCTGCAGTTCCAAAGAACGGATCGTTTT
TGTTGCATTAGCATAGATGTTACATACGCTAAATACATACAGCCTTGTTAATAAAACCAA
GCAAGGGTAATCCGGGAAAGAATCTCCTCACATCATAAGCAACAAGTCAAAAGGAGCAGC
ATATAAATAAAATAATATTCAGTACTACCAAGTAGAATTTAAAGATTAGCAGATGTTGCA
GCATCAACTACCGCAATCTACACAACTTATGGATTTGAGACTTTAACGTTAATAAACCTA
TTTCACACAGTGAGAAGATAAAGCCATTTCATTGAAAGTCAGAAATAAGACAGTTTATTT
TTATTGCTCCAGTTCCTCATTGTTATGTGGAAAAGGAAAAACCCACACATTTTAGGAGAT
GGAATGTCACGGGTGTTGTAGTTATCCATAGGAAAGTACAAGAGAATCTGCGATCACAGA
GAGTGTTACACAGACAGCCAGCTTTCCTGGATGCCAGCAGCACCGTGCAGAAGTCAGTGA
CAAGTAAAGGAACTCTGGCTATGCAGTAGTTACTGCTCGCTCACCTGCCAACTGAAGGGT
CAGCAGTTCTAACCCACCAGTGACTCTGCGGGAGAAAAGACCCAGTGATCTACTTCAATT
CAGATTGCAGCCCCCTGGAGCGGTTCGACTCTGTTATGTACGGCTGCTGGTCAGAATCAA
CTGGGTAGCACATGCAACAAGTCAGGACATGTATCAGGAAAGAACAGTGTCGTGCACAGC
AGCCCCTCCAGCTGAAGTTCTTAGGAACTCACCTGAAGAATGAAACAAGACCTCTGTGGG
CTTTTCCCACTGTGTGAAAGCAGAGCATTCCTGTTTCTAAGTGGAGAGGGACTTCAGTGA
GACAGTTACCATGGATTTCTACAGGAAATTTTCAATGTCCATTCTTCCATGGGTCACTAC
TAAACATAGTCTCTAAAGAAGTATGCTCTGGGGACCCAGGATGAACCTTTTCCCTGATAG
CCTCCCCTTTCAAAGACAGTTTGCAAGTATACGAAGGAGTGCTGCTCTCTCGGGAAAGTT
TTTTGTTTTAGGGAATATTCATTAAAGCGTGTCACTTCCCTTAACGATAGTTTTTTGGGT
TTTGTTTTAATTTTAAAAATTAACTTCAATTTTAATTTTAAAAATAGTACTGATAGATTT
AACCCTCATAAATGGAATTCTCTGGGACTCTTGATTTTTGGAGTGTGTAGTGGTTCTGAG
AGCAGAATGTTTGAGAATCACTTCGGAGATGTGCTAGGTAAGGAGTGTCTCTCTAGATGT
GCCTCTTTTGGGAGGCATAGATTTGTGCACCAGCAAAGGTAGGACAAATTCAACAGATTG
CTTTTTTTTCCCCGGGAGAAATGGGCCCAGAGATGTTTGCTTTCTCTTTATGTAGTGATG
TATTAGGAAAAGTATGAGAGGAATGTTTAGACCAATAAGGTGCATGACAACAACACAGGC
GTTAGTTATATTTTTTAAGCCCTTAGTATTTTGCCAATCAATAATTCATTCTGTCCTATC
TCAAAAAACAGTAGGAATAATATGGTACATTTTTGGAGAACATCAAGTCAGTTCCTTTTG
TCCAAACTATGATCTCAACTCAGTCTGTCGTAATGATCTTGGGCGTCATCTGTCTCAGGT
CTTCAGCACCTGTCTTCAGCACCAGGTGCTGTCTCCTGCTGCACTCTAAGGATTTGGGTA
GTGGCTCTTTTAGTGTCTTGTAATTTCTATACATGCCTTTAAATGGGAAATCAGGGCTAA
AGATGGTTAGGTTTAAAGTTGGTCATTTTAAAAAGTGCATTCCTGTTGGTACAGTTTCAT
ACTGCTGTGCACCCAGAGCAGCTCTGGGCCTGCCCCTCCAGCATTGATGCTCTGAGCCTG
CCCCTCCAGTGGTGATGGTCTGGGACTGCCCCTCCAGTGGTGATGCTGTGGGTTCCTGCC
GTGGTGCCTAGGAGTGTGGGGTGTCACACAGCGGCGCGGTTCAATGTTTCAGTACAAATG
AAGGAACCTCCTACAATCAGTACTGTGTTGTGGGTTAAAATTGGGAGGCCAGTTGATCCA
TTTCCAAGCCAGCATTTTCTTGTAGAGCTTTTTCTCTTCAACTAGGTCTTTGTGGTGACC
CAAATAGCTTGATTGAAAAAAAAAATTTTTTTTTTAAATAAAGAATTTTGGTACTTGTAG
TTTTTGTTGTTTTTTAAAAAGAATTTTGGTAATTTTACTGTCATCAAGAACTTGAAATAA
TAGAAATACCGTGCTTTTATGCATACAGGCATATCAGCTCTGCAGATGCATGCTAAAGGA
AAACTGATATTTCCAAAATTCAGGAGTCTGATTCAGTTTAATTTTTAGGGCTTGATCTGT
TTGTTCATAAAATTAAGGTTGCCCCACTCCCACCCCTTTCCCCTTGCTGTTCCTACAGAA
TCTTCGGAAGAGGAGTCTGATGATGAAATAGCAGAGAAAGAGTCTGATGTGAGTAATTAT
TTGTGCCCTGACACACAAAGCTGTCTTTATCTTCGCCTTCTCTGTAAGGAAAGCTGTCTT
TTTCTTCTTTTTTTTAAATCATTTTATTAGGGGCTCACACAACTCTTATCACAGTCCATA
CATACATCAATTGTGTAAAGCGCATTTGTACATTCATTGCCCTCATCATTCTCAAAACAT
TTGCTCTCCACTTAAGCCCCGGCATTACGTCCTCATTTTCCCCCTCCTCCCCTCTCCCCC
CTCCCTCATGAGCCCTTGATAGTTTATAAATGGTTATTTTGTCATATCTTGCCCTGTCTG
ACGGCTCCCTTCACCCACTTTTCGGTTGTCTGTCCCCCAGGGAGGAGGTCACATATAGTT
CCTTGTAATCAGTTCCCTCTTTCCTACCCACTCACCCTCTACCCTCCCTGTTTCGCCACT
CACACCACTGGTCCTGTAGGGCTCATCCGCCCTGGATTCCCTGTATTTTCAGTTCCTATC
TGTACCAGTGTACCTCCTCTGGTCTAGCCAGACTTGCAAGGTCGGATTCGAGTTATGGTA
GTGGAAGCGGGGAGGAAACATTTAGGAACTAGAGGAAAGTTGTATTTTTCATCGTTGCTA
CATCACACCCTGACTGGCTCATCTCCTCCCCGAGACCCCTCTGCAAGGGGATCTCCAGTG
GCCTACTAATGGGCTTTGGGTCTCCACTCCGCACTGCCCCCATCATTCACTATGGTAAGA
TTTTTTGTTCTGATGATGCCTTACACCTGATCCCGTCGACACCTCGTGGTTGCATAGGCT
GGTGCGCTTCTTCCATGTGGGTTTTGTTGCTTCTTAGCTTGATGGCCGCTTGATTACCTT
CAGGCCTTTAGGACCCCAGACGCTATACTTTTTGATAGCCGGGCACCATCCAGGAAAGCT
GTCTTCTTGAACACTTTTCTTGCTTACTATTTCTACCAGGATAACTGGGATGAAGATGAG
GAAGGGAAAGGAAGTGAGGAAGATGAAAATGCTGATGATGACAACGAGGAGGAAGTTGGA
GGTGCTGAAGAGGAAAACGGTGAGGACAGAGATGGGGCCAGTGAGAAGGAATTAAATGGA
GACTCTGACTTAGAGCCCGACAACGAAAGCGAAGAAGAATGAAGGTTGAAAACAGCCACT
CAAGCTGCGTGAACTCTGACTCACCTTGCCCAGTGCGGCCACGCTCTCCTGGGGAGGTCG
TCTCTGTGACAGGATGCGCGGGACCGTTGCACATTTCCAAATCCTCCGTGGTGGTCCCTG
TGCCCACCCAGTGTCCTGACCACCCCAGACTTAACTGTGTACATAGAGCGTTCCACTCAA
ATGTTAATAAACTTTACACAGCAAATAGACACATTATCTGCAATGTGCTGACATGAGTGT
CCAGTATATGGTTATATATTTTTATAATATGATATCCTGGTGTGTGATCGGTTACACCAA
GAGTTGACGTAAGTGAAGATCGAGAACGCTCCTGTCGCGTTCAAGGACGGCACCTGGGAT
GGAGGCAGCTCTGTCTCAGGTTGGCGTCCGTCTTCAAATCCCGATGTATCGCAGTACTAG
TAAATGCGCTTTTTAAAATTTGGTACATTTTTATACAATGAGAGGGATCACTGAAAACAA
ATCGGAGTAAAGAATAACTATAATTGGGGAGGGAAAAAAAGGGTACTGTAACCCTTGCTT
AGTCTATGTAGCTGTAATCTGACCCGAGTCGGGGAGAGTACTCGGAGAACTGCCCCACAA
CAGCCACCTGCTTGTTTACACTGTCGTGGGGAAAACAACTTTTTTTTAAAGTATAACGAA
AAAAAATTATGGTGATTGAGAAACTGCAGAATTAGCCATATTGAGGGTTTTTCTGGACTG
CAGACTGCCTCTGGACTCGTCAGTGTATATAGATTAGATGTGCACGTTACCTGCACCTTT
TTTCAACATTCAGTTACAGCTGCTTTTGAAGAGGTTCTCCCTTTCATTTAAGATACTAAT
GGAGCAAAGAACAGTTTATTTTTTTCCTCTTTACTTTTAGATATTAATGATAATCTTGTT
GGAATTTTTTTCCAAAGAAAATATTTTTATAATTCAGTAATTTAATGTTTTCCTTGCTTC
TCATTACCCATTCTTGGCAGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 1018..1035, 1145..1159, 4573..4626, 4629..4862, 48273..48410, 48511..48632, 50317..50437, 51352..51490, 51492..51496, 53355..53453, 56828..56892, 57803..57974, 59912..59998, 60988..61119, 62556..62687, 67280..67366, 69733..69764, 70800..70863, 77179..77292, 77967..78036, 81238..81287, 82239..82421
1001..1015, 1018..1035, 1145..1159, 4573..4626, 4629..4862, 48273..48410, 48511..48632, 50317..50437, 51352..51490, 51492..51496, 53355..53453, 56828..56892, 57803..57974, 59912..59998, 60988..61119, 62556..62687, 67280..67366, 69733..69764, 70800..70863, 77179..77292, 77967..78036, 81238..81287, 82239..82418
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved