Echinops_telfairi Locus RPL3
snOPY snoRNA Orthological Gene Database
Echinops_telfairi RPL3
Echinops_telfairi
RPL3
GeneScaffold_1308
SNORD43
1368..1433
6510
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCGGTGCAACTTGTTCCTCCTCACCGAGACGACAGAGAAGTCACGAAGGGCTTTGC
AATAGAGAGCCACCGCACCTCGTTGGTGGAAGCGAGTTCCCACCTGAAGCGAACCCTGTG
CACGAGAGGACACAGAGCCCGGGCCCGCGCGATCGCCTCCATCCATCGTGACAGCCCCCG
TGCCAAGCCCACAACAGTGAGTGACTGCAGCTGACATTAAAGAAAAGCAAGACGGCCACT
TCGCTCTGGCACGAAAGCGCGTTTTCTTAGATTTGGCCGCTGCCGAGCGCCGTCAGAGGG
TTGCCTCGTAAACTCTCCGCCCGGCTTCCCGGCAGCCTGTCAAAGTTTGAGCCCAGCCGC
TCCTCGTCGAAACTCGCAAGTCGCCTCCGAAGCGAACGTTGGGGTCAGAAGGCAAAGGAG
ACCTCGAGGCGCATGCGCAGGGGTGGCGCCCGCGCCCGCCGTCCGCCCTGACGTCCGCCG
CGGGAGCGCGCTCGTACGCCGGAAGGGGCGGGACCACGCGGAGCTTTATAAACCGGGCGG
CTAGCGCCGGCCTGTCTCTACCAGCGGAGATCGACGGCGTGATGGTACGTTTCACGGCGG
CTCTCTTGCTGCCGCGGCGGCCGCGTTTTCGAATCCGCGACGAATCGTCGCCATCTCGGC
TCGACTGGCGCCCGGGCCCGGGTTTAGAGTCACGGAGAGCTTGCCGGGTCCCGAAGGCAG
CTCTATTTTCTCAAAATGACCGGCGGCCGCGTGGACGATGGGACAGGGGACTTGCGGGAC
AGTTGGGCCCGACGTTCCGCACCCGCCCCCAGGCTAAGTGTACATCCGGGTTCTAGCTGT
CAGTACGGCCTGGAGTTAAGAATCGGGCTTGGTGTCGGGGAAGGGGGCGGATGGGCGCAC
GCAGACGGGGCGAGGGTGGCTCGGAGAGCCCGCTGGGATCGCAGAAGTCACAAGTGATGA
GCCTATTGACGGGCGGACAGAGGACTCTGTGCTGATTGTCAATATTCTGATCTGGCTCTG
TCGCGTCCCAGTGGCTTTACTCCGCCTTTAATAAGGACACCTAAAGTGTTCCCGGTGGGA
AACCCAGGGCCGTGGCTCCTTAAGCCCCCGCCCCGTTACGTTGGTTAGAAAAGGCAAAAA
CTGGGTGCCGTAGAGTCGATGCCGACAAAGCACGGGAGAACTGCACCCCTCCCACGTGGG
TTCCGGGAGACCACGGAGGAGAAAGCCCGCCTTCCGTGTCGGTCCTGTGGAACCACGTGG
GCTTCTGGCTCAGCGACACGAGCCCGAAGGCTGGCTAGGGAAGGGTTCGTTTGGTGCCGG
AGGATCAGGATGGGGCGCGCGTGTGGGGTTCAGCTTGGGCCCTGGGCGGTCGCATCGGGG
TGCTAACGGCAGGCTTTCTCTTGCAGTCCCACAGGAAGTTCTCGGCGCCCCGGCACGGGT
CCCTGGGCTTCCTGCCACGGAAGCGCAGCAGCCGGCACCGCGGGAAGGTGAAGAGCTTCC
CCAAGGATGACGCCTCCAAGCCGGTCCACCTTACGGCCTTCCTGGGCTACAAGGCCGGCA
TGACCCACATTGTGCGCGAGGTCGACAGGCCAGGCTCCAGTACGTTCAGCTCCGGGGCGG
CTGGGAGGCGGGTGTGTGCTCACGATCGATGAGAGAAGGGAGAAGGCTGGCTCCGACTGG
GCAAACTGGGCCTGTCCGAGGACTGATGGTGGGAATTGGGGATCGTGAAGGTCTCAGTGT
TGAGAAGTGTGCAACCCCAAGATGGTGGTTGGACTAGAAACATCCACTATTAAATATTGA
TGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAAGGCTTTCACCAAGTACTGCAAGAAGTGGCAGGATGACGAGGGCA
AGAAGCAGCTGGATAAGGACTTCAGCAGCATGAAGAAGTATTGCCAGGTCATCCGCGTCA
TCGCCCACACCCAGGTGAGCGTTCGAGCCATGATGTGAAGCCCCTGAGCTCAAGAGCAAG
ATGAGCAAGGCTGCTGGAGTCCTGGTCCTGGAGAGGTCAGTGAGCAACACGATGCAGCAG
TTGTCCTTCTGGGGCCACTGGTCTGAGGGCACCTGTCCTGTTCTCTTGGTGCTAGGGCTT
TTTGTGGCCAGCAGAGGGCACTGCTCCTGTCTGCTCTGAGCCAGGGACCTGATTTTTAGA
TGAAAGTTACTGACAGTATTGTGACATGATCCCCGCCTGGGAGGCTGCTCTTTGAACCAG
CCTTATTGGGAGCCACACCTATTTGTTGGTGCCCCCTTAGAATGGGCACCTTCTCCCTGT
CTGGCTCTGAGACTCCACCACCAGGCTTGCAGGGCCACAGGCTGTTCCCCGGCTGCATCC
CTGTGTTCAGTGGCCTTTGACTGCTGCACAAGGTTGTCCTCCCAAAGCAATGTCTAGTTA
GGTTCTCAAGCCACGTGTGCCACCAGAGGAGCATGGGCCAGACAGGTCAGATGGTGCCAG
GATCTGCAGTCTGGGTGTTGGGATGGGCACCAGGTGTGAGCCCTGGACGAAAGATGGCAC
CTGGGCCCTTGTGGAATGTGGCAGTGGGCCCGGATTTGAGCATCCCCTTCTTGCCTGCAG
ATGCGCCTGCTCCCTCTGCGCCAGAAGAAGGCGCACCTGATGGAGATCCAGGTGAACGGG
GGCTCTGTGGCTGAGAAGCTGGACTGGGCCCGAGAGAAGCTGGAGCAGCAGGTGCCAGTG
AACCAGGTGTTCGGGCAGGATGAAATGATCGATGTCATTGGGGTGACCAAAGGCAAAGGC
TACAAAGGTGAGGCCCTGGCTGCACCCAAGTTCACTGTGGGTTCCTTAATTGTGAGGCCG
GGCTGTTCCGTGATGAGACCCTGGAATGAGCGCTGGGCACGGCGCCCGAGCCAGACTGCG
GAAACGTTCCTTGCTGCCTTCCTTCTGAGAACAGCCCTGGCTATGGGGCAGGGGCCGCCA
CTGGACACCGTGGCTGTTGAGAGACTTGTCTTTGGGTGGTCCTCTTGCCTTGGGATGTCT
GAAGTTCTGGGCCTTGGCTCAGGCTGGTTACTAGGCAGGTGGAAGGCTCCTTGCCTAAGC
CTCTTGGGCCCAGATAGGATGTATCTTGTCTCTGTAGGTGTGGAGTTGCTGAGTAGGTAG
CGGGGAGAGGGTGGCAGTATGTAGCCTACTGGCCAAATCTGCATTCTGGTGGGGGATGTC
TGTTAGGTAATAACTGTGAATTCCCTTCACATGCTCATCACCATATAGGGGGCTGTTCAT
GGCTGGGGAGGTGCACTGCAGACCCCTGACGGGGCAGACCCCCAGTAACAGTGTTGTATC
TGTTCCAGGGGTCACCAGTCGTTGGCACACCAAGAAGCTGCCCCGAAAGACCCACCGAGG
CCTGCGCAAGGTGGCGTGTATCGGGGCCTGGCATCCTGCCCGCGTGGCCCTTCTCGGTGG
GCCCGCGCTGGGCAGAAAGGCTACCACTACCGCACAGAGATCAACAAGATGGTCAGCACA
GTGGCACTCTGGTTCTGCACACTGCTGACCTGCGGGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1826..2018, 2947..3115, 3838..3973, 4620..4806, 5348..5446, 5448..5457, 5459..5510
1001..1003, 1826..2018, 2947..3115, 3838..3973, 4620..4806, 5348..5446, 5448..5457, 5459..5510
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved