Echinops_telfairi Locus ATP5B
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ATP5B
Echinops_telfairi
ATP5B
GeneScaffold_757
SNORD59
2888..2958
7461
CTCACTCCTTACCCTCCTCCTCCCCACTCCCTCCCCAAGTTTTGGCAATTCCTTTTTTT
TTTAAATCATCTTATTGGGAGCTCGTACAGATCTTATCACAATCCACACAAACATCCATT
GCGTCAAGCACATATGTACATATATAAACATTTTCTTTCTACTTTAGTCCTTGGTATCAG
CTGAGACTTTAATTCTCTATGGGAGTTTAAACTGCCTTTCTCCCGCGGAGCAGATGGTGG
TTTTGACAGAACGGTAAATTACCCCTCTGCGTACCCCAATACTACCTTAATTAGGGCCCA
TCACAATTTTACTGCATTCTTTGTTCACCTCTCTGTGAAAGGTCTTGAGACTTTTTGTCT
CCTCAGTGCCTAGCACACATCTGTGAAATGGCTGGTTATGTTAGTTCTCTTCATTACATA
GGTTGAAGTAATAAAAACCCTGTCGGAGTCTAGAAATTGCTAAACTGCCGGGAAGTGTCC
AACCCTAGTACTGTACTCTGAAAGGAAAACCGTTGTTTGACGGACGGACGAGAGGCGCTG
GATTAGGCAAGGTCACCCTCAGGGCTGCCTCCTGGCGCTCCCCGCGCCGCCCTCCCCGCC
CCAGGAACCGATAACCCAGCTCAAGGTCCTAGGCGCCCGGGAAAGCCCAAGGACAGGCAA
AGGCACCACGTGCTCCCAGCAGGAACTCGGCCCCTTTACCACACGTAGTTCCGCCACGGA
CTCGCTCCAACGGACGTCCCCACGGTCCAATGACGCTTCGAGGCTCCAGGGGTTGGGCCC
AACGCGACAGGATCCAATGAAAACAAAGAATTTCAGATTGGCATTAGTTCTAGCCAACGG
ACGAGAAGAGGGCGATTCCTCAACCTATAACAGCAGCGCTGAGCGTGATGAGCAGCAAGC
TCCGCCAATGGGGAAGCCTGCAGCCGCGCAGGCCTCGCCCGGCTGCAGAGGAGTTGGCGG
CGGCGGGAGCTGCGGCGCTCAGTCTCCACCCGGACTCCGCCATGTTGGGGCTTGCGGGTC
GTGTGGCCGCTGCCTCGGCCTCCGGGGCCTTGCGGGGACTCAGCCCTTCAGCGTCGCTGC
CCCAAGCCCAGTTTTTGCTGCGGGCCGCCCCGGCGGCGCTCCAGCCCGGTAAGTGCCTCC
TTCGAGAAGCCAGGTTCATTTCACGCTATGACCTTGAGCCGGAGGCCTAAGGAGTCCACG
GTGCTAGCTGGACGCCCGGGGCAGCACCCTGCCCTTTAATGGCGGGAGAACAAAAGCAAG
ACGCCCTGGAGAGTTTTTTGCGATCCAGTTCCGCCCCATGTTAACGAAGGGGGCCGCCGT
GTGACCGAATAGTGTAGGCAGGTGTATTGATTGACCTTCCCCCGACATGGTCCCCGATTT
CTCGAATTACGGGATTCTGTGCACTCGAATTGGAAGGCTGTGCACGCGCTTTCCGGGTTC
CTGCGTGGCTCCCCCTTGGGCACGCCTTCCGTCTAGGCCGAAGCCACCTCTTGGTCACAA
GTCAGGGGCTTGTGATGACCTTTAATTGCCCTGACCCCCAACGCCTTCCCATGTCTTCTG
TTCATTAGGGCAGAGACTATGCGGCGCAAACTTCACCTTCACCAAAGGCAGGCACCGCCA
CCGGGCGCATCGTGGCGGTCATCGGTGCCGTGGTGGGATGTCCAGTTTGATGAGGGCCTA
CCCCCCATCCTAAACGCCCTGGAAGTGCAAGGCCGAGACACCAGGCTGGTTTTGGAGGTG
GCCCAGCATTTGGGTAAGTAGAATTGTTGAGATTTGTAAAGAGCTTGTGGAGCCCATATC
CTAGATCAGCTGCCTGCCTTCTGTGATGATTTTATCAAAGTGACTTTCGTTCCTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTCATGCCAATTAACACTAACTT
AAATGTACTGCAACCAGCTTGTCGTCGTGTGTAACATCAGTACCTTCACTAACAGGTGAG
AGCACAGTAAGGACCATTGCTATGGATGGTACTGAAGGCCTGGTCAGAGGCCAGAAAGTT
CTGGACTCTGGGGCACCCATCAAAATTCCTGTTGGTCCAGAGACCTTAGGCAGAATCATG
AATGTCATTGGAGAACCTATTGATGAGAGAGGACCCATCAAAACCAAACAGTGAGTATCC
CACTTCTGGATCTCTGCATAAAGAGATTGCTTTTATCGTACAGTTTTATGCATTTGGGTA
CATTATACATCATGGTTCAGCACAATTTCCCTGCAGAGACTACCAACATTGCTGGGATAC
TCATTTATTATAAGTCCCACTGTACTGAACTTAGGATGCTGGAAGTTCTGGTTTGATGGT
TTTAGTGCCAATGGCATAGGTTATGTGTGTGGGTGGGGGGTGTCTCTGGAACTGACAAAT
CTTTCATGGAAGTTGCCAGGGAGTGGAAGTACTGCTGAGAATGAGGTGTGCTTGGTTGCA
GAAGGTCAGGTTAGATACCAATGACAACTTGTCTAGCATGTTGGAAGTGGAGGGGGCATG
TGAAAGTGAGCAAAGGGATGGACTTCAGGAACCTTTGTGACTAGTCAGCAGTCAACTTAG
CACAAACAAAGCAAATGAGACTGATCTGATCCACTTCCACTTTACAGATTTGCTCCTATT
CATGCCGAGGCACCTGAGTTCATGGAGATGAGTGTTGAGCAGGAAATTCTGGTTACTGGT
ATCAAGGTTGTGGATCTGCTGGCTCCCTATGCCAAGGGTGGCAAAATCGGTATGTTATCG
ATGGGGACATTTTTCCATATCCATGGTGAGAGGGAACCATTTTCCTGTGGGTGGGTATTA
AGATCTGCCCTCATTGATGAGTAGCTTCTGACTTTCGTTCTTCTGAGTTTGCTGAAGCCA
GATGCCATTTCTGAGAAGGGAAAAAGGTGGGGGAAATCATGTGGGTTTTTTTTTTTTTTT
TTTTGTCTGTTTGGAATTTGCTTATGTGGGAATGCAGATCTCTTACATACATGTTTTTCA
CTTTCTCTCAGGGCTTTTTGGTGGTGCTGGAGTTGGCAAGACGGTGCTGATCATGGAATT
AATCAACAATGTCGCCAAAGCCCATGGCGGTTACTCAGTGTTTGCCGGTGTTGGTGAAAG
GACCCGGGAGGGCAATGACTTGTACCATGAAATGATTGAGTCTGGTGTGATCAACTTGAA
GGATACTACCTCTAAGGTGAACACAGCCGGTGTACACATAGTTGTGTCAAGAGACCTGTG
CAGTTCACTGTGTGCCAGCTGGAGCCATGTTTTATGTCCCAGGCCTGTAAAGGAAATGCT
AGTGCCCTTCTTCATGAATGCTCATAGAGGTTTTTGACAGTAGATTACATTTCCAGACTC
CCTTTTTGGTAGACAGCCAATTCATTTGCAAGTTAATTTGGGGCCACATTTAGGTTCTGA
GGTTGGGATGGGGTTTTGTCTTCGATAACCCTGTTTTGAGCTTTTCATTTAATGTACATA
TTGTCTAAAGAATTTTCCCTCACTAATGTAGAAGACATTGCTTTTGTGTTTTGAATCACC
TAATAGGGAAAAGATACTGAGGCAAAAAAGTGCCACACTTTAGAAGGACCTTCCTGGTGC
TGGTTCTTCTCTTGGGGACCCTTGGGCATCTGGCTGCCATGCTGCCCTATCATGGTTTTT
GACTCCCACAGGTCGCGCTGGTGTACGGGCAAATGAATGAACCACCTGGTGCTAGGGCCC
GCGTGGCTTTGACTGGACTGACTGTGGCGGAATACTTCAGAGACCAAGAAGGTCAAGATG
TACTGCTGTTTATTGATAACATCTTTCGCTTCACCCAGGCTGGCTCAGAGGTACGATGGA
AGGCTTGAGTGTACCTGGCTCCTTTGATCAATGAAATAGTGCAGGTGATGATAAAGGTTT
CTTCATCTTTTCCTAAGGTGTCTGCCTTATTGGGCAGAATCCCTTCTGCTGTGGGTTACC
AGCCTACCCTGGCTACTGATATGGGTACCATGCAGGAAAGAATCACCACCACCCAGAAGG
GATCGATCACCTCTGTGCAGGTAAAAGCTAGTAAATAGATGAAGGTCTAAGGTATAAAAA
TGTTTAGGGATGGAGCAAACAAACCTGGTTGTTTACATCTCAATGGGGCCTTAACGAGGG
GGTTCATGAACTCTCCAAAATACTCTATATGGGTAGGTCAAAGACGCTATAAGGTTAAGA
AATACTCATGAAGTAGTTGAAGGCATGGGTATAAATATAGACTGCAAAACTTTTTTCCAG
CCTAGACACTTTGGAGCTGCATAGAAACAGCTATCTTAATGCACTACACATTTTCAAAGG
TGTAGGCAGTTATAAAAATGTTGCTTAAACGAGGCTAATTTAGAGTGACTATCCATGATT
CATTTTCATAGTGAATTAAGGTTTCTTTTCCTTTAAAATTTTTTTTAGTTCTAAAAGTGG
GTACCATTACAGGAGAGCTAAAATGTAGGGCGAAGAAAAGGAATGGCAAGGAGAATTTGT
CCATCAGAGCCTGGAGAGGGGCCAGGTAGATGGGTGGAGGTGATGAGCATTAGAAAATGG
AGTGGGGTGGCTTAAGTGGAATGACTTTGCTTCTTGCTGCTCATCAGGCTATCTATGTGC
CTGCTGATGACTTGACTGACCCGGCTCCTGCCACTACCTTTGCCCATTTGGATGCTACCA
CTGTGCTATCTCGTGCTATCGCCGAGCTGGGCATCTATCCAGCTGTGGATCCTCTTGATT
CCACCTCTCGAATCATGGATCCCAACATTGTTGGCAGTGAACATTATGATGTTGCCCGTG
GGGTGCAGAAGATCCTGCAGGTGAGCATTGCTTTGTGAGATTAGTCATCACGCTAAGGGA
ATTTGGAGGGCTGTGGTAGTACTTGGAGAAGGACGACGGCTTTCTACTTCTGTAGAGTTC
CAGTCTGGGTTGCTCAGGGGGCCAGTTCCACCCTGTGTGATTGGTTCAGTGTGTCAGCAT
CAACACACTGGCAATGAGTGTTTCAGTCATACTCGGTGTTTCCCAGTGACATCTCTGATT
TGCTTAGGGAATGGTAAAGTGCTTAGTCTTTGGAATCCAGTTTCCCCAACAGTGCTAGGC
TAAAGGTCCTCTGGCTCTTGAGATTGTCATTTCCCCCCTCTTGAATTGAGGTAAAGTGCT
AAAAAAAAAAGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCCTCCAGGACATCATTGCTATCCTGGGTATGGATGAACTTTCTGAGGAAGACAAGTTGA
CTGTGTCCCGGGCACGGAAAATCCAGCGTTTCTTGTCTCAGCCATTCCAAGTTGCTGAGG
TCTTCACTGGCCATATGGGGAAGCTGGTGCCGCTGAAGGAGACCATCAAAGGGTTCCAGC
AGATTTTAGCCGGTGAGATTTTGAGCTCAAAGCAGAACCATAAATGGCAGAGAAGTTGAA
ACAAATCTCTTGTGAATTTTTTCTCTGTTCTCATTCCAATAACCATTAGGAAATATATGA
GGGGGCCATCCTCAGAAAGTTCCTTGGATAAGTGGGATTAAAAGAGGATGTGGTTTTCCA
GGAATTTTTAAAATCCACCCCCCCTTTTAAAAGAAACATGTAGTTTACTATTAGTTTTAA
CAGTTTTATTGGTATGTAATTCACATTGATTTAATATTTCAACATTTGAAGAAGTTATAT
ATTCATCACTTTTTCAAACATTTTCTTTATTCTTGTACTATTATTAGCTCTCCATTTCTC
CCGAACTTCCCCTCCCATGCCCCTGCGAAGGAACCATGAATTCCCCTTTTAATTCCATTT
TTCCATGAACTTTTGGAAGCCCCTACATGATAAAAACTTTCCCATCAATTTTATTTGAAA
ACACATTCACTTCTGAAAGTGTTAAATTCCTTAGCTCCTTGTGGATTTGATTTGTGGGGC
GAATTCATTCAGGGTTTTGATGATGTGTGACGTCCTCTCCTGACTATTAGCTTCAACTGA
TGAGGCATATGCAGGATGGACATCCTTTCGCTTCTAACTGTGTATGTCATGTTTTGTTTC
CATCTAGGTGAATATGACCATCTCCCCGAGCAGGCCTTCTATATGGTGGGACCTATTGAG
GAGGCTGTGGCAAAAGCTGACAAACTGGCTGAAGAGCATTCTTAAAGGGCTCCTTTGAGC
CAACGGACCCCTGTGCACTCTCATCCCCCCCCAAGCCAAAATCTTGTTTTCTGTACAGGC
CACACAAGAGCCTTATTTGAAGATGTGTTCTGTCTAAAAAATATTTAAGGTTTCCAATAA
AATGTACTTCCCTCATCTGCCTGCTTTTCTGGGGGGAGAACACTAGATGTTGAAGGCATT
TCCTTTTAAAAGCAAATTGATTTTCTTGTCAGATAATCCTGCTTCCTAGTTAATATGCAG
TTGGGAAGAAATGGGGGGGATTTAGGGCTTTTATTTTTAAGGAAGGTGACCGAGATCAAT
AATTATGTAAGACTTGAGTGAAAAGCACCTCCATATGAGCATGTATTTTAGTGAGACATT
AATTTCTCCAGAAAGTGCTTCCACTTAGATTTTGGGCAAGTCTAGACTTCTTGAGTAGAT
GCTTATGAGTCGCCCACCCGTTTATGTCATGCTATGCCCTAACCTGAACTCCACTGATGT
TCCCACATCAAAGTTAAGGAAGGCTACGTGGGCATTAAGTTTCAGGTGAGCTGGGTTTGG
GCTAAGTGAATGGAAATAAAGCCCCCTGAAAGGTGCACAGAGACCCCCAAATCAGTTTTT
TAAAACAAGGTTGCAGTAAGTGCCACCAGGGTTCAGGAGCCTTGGTACTGTGGGTTAACC
TCTTAACCCAAAAGTCGTGGCTTCAGCTGCCAGTGGCTCTGAGAGGAAGCACCATCCTGC
TGCTTAAAAGATTGATCACCTTGGAAACCCCATGGGGCCGTTGTATTCTGACCTAGAGGG
TCCTGAAGTAGACGTGGGTTCTTCGGAGCTCAGGCTCATTTTACTGCCCTCTGGAGGGAG
GACTAGAGGCAGTTGCCAGAGCTCTGATCTCACCATTTTGAAATCCATGAAGGCCATTTG
CTGGGAAGTGGTTCTCGGCTAATGACTGTTTACAAATCAACCAGGGCTTTTGTCCGAAGG
AGGGGTTTGCAACTGGAAGCTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1127, 1568..1568, 1570..1655, 1657..1752, 2035..2209, 2687..2808, 3071..3255, 3731..3889, 3977..4099, 4667..4879, 5510..5711, 6367..6461
1001..1127, 1568..1568, 1570..1655, 1657..1752, 2035..2209, 2687..2808, 3071..3255, 3731..3889, 3977..4099, 4667..4879, 5510..5711, 6367..6461
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved