Echinops_telfairi Locus ENSETEG00000000337
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000000337
Echinops_telfairi
ENSETEG00000000337
GeneScaffold_6601
SNORD16, SNORD18, SNORD16, SNORD18, SNORD18
2291..2389, 2804..2876, 3174..3272, 3655..3726, 4581..4651
5905
CCTGTCAGAGGGTAGGCCAAAGGATGAAATAAGAAGAAGGACACAAGTTTTCACTGTTT
GAGAGACGTTCCCTCTCACACTCAGGGTAGGAGTGTCATACGAAAAAAAATCGCCTTCTG
GGAAATTTTCCAGGGACCTGTATAAATAGCGAAGAGTTATTTTTTCGGAAGAGAGATAGC
CATTAAGGCCTTGCGAAAAACAACCCCGGTATGGGGTGCCCGTGGCGGCTACTAAAACTA
AGTTCACCCGGTCCCCAACCCTCAGATTTCAGAGGAGCTGATAGAGCCCTTAAAGCCCCA
CTAAGAGGCGCCAGAGGTTTTTGGGCAATGGAACAAGGGTTATTTGCGATTCTAGAACAC
GGGCCTCCAGTAGGGCCCCCGCCTCCCTGCGGGAGGGGAGCGTACAGGTCTTCAGCCGCC
CGGTTCTTTGGGGACCACTTTTTCCAGCGTTTTGAGGGCGGGATCCAAACAGATCAATGG
AACTGGGCGCCTAAACCTCCAACTTCGGGGGTGGGGCCCCCCCCCTCCCGGGATTATTTT
TCCCCCCCCCCCCCCCGGCGCCCCGCCTCGAACAAGTTCGGCTTCTCCACAAAGTTAAAG
TTTTGTTTTAGTGCACCCTGAGATTTTTCAATAATTTTTTTATTTCTCTCAGGAAAAAAA
AAAATAAATAAATAAACGTCGTGATCCGAGGCAAGACATTTAGTCTCGCGAGATTTGACC
ACGCCCCGCTGTGAATTACTCCGCCAAAAGGAGTCCCTCTTTTCTAAACAGTATTACAGG
CTTCAGAAGGCAAAGAGCACCATAATTTGACTCATATAAAGACCAACACGCGGGTTGAAC
TTCATACAGTGTGCTTGGGATGTGGTTTGCTTCCCTGGGCTCGGGCTGGGGCGGAGCAGG
GTGGTGCGAGATGAAGGTTACATATAGAGCAGGAGTACTACGTCCTTCCTTTTCCTGTGG
GAGCCGCCGGGGCGAGAGGAGCGTGGCCTTCTCTCTTCAGCATGGTGAGTGAACGTCCGT
CTGCTTGGTTTTCCCAGCTTGGTCCCGGAGCCCAGCCGGGAAGGGTTTGGTGTTCAAGAC
AGAGTTACGGGGAGAGAGCGAGGGGAGACGGACTGATGCCGAAAGGCCGTCGCTTTCTCA
AGGCTGTGTGGCGGACGGCGGCCATCTTAGCGGCAACGTGGGCATCCCGGCCCGCAGCTC
TGGGGCGCCAGCGCGGGGGCTGCCGATCGTTCCGGAAGGCACAGGGCCCATTGGGATTCT
TGTCCTTGGCGCACAGAGAACTCGGGTTGTGTTGAAAAGACAGTCCTTGAGCTTAGTTTA
GAACTAGTTGGAGCCCAAGAATCGGGACATGGGTCTGCAGGGGAGGTAGAATCTGGGCCT
TGTATTCTAATGTGCTAGCTTATTAAGGATGTTTCGTGCCATCCGGAAGTTAACGCTTTT
GAAAAATGACCTGGGTCTCTGCCTTTCTCGTAGGTTTACTTGAATGATTTGGTGGGGGTT
GCCCACGTTAAAAATCGCTCCGTGCATTTTGTGCGCTGGGGAGGTTCAGTGAGGAAAATG
GACAGAGAACCGTTTTTAGGGTACCTGAATTGTAATGGAATTGGACAGAACACTGAGTGC
TCTCAACTTAAAGAACCAGCAGGCAGTTGGCAATATTTTAGCAGCCTAGAAGTTCAGGGA
AGTGCCCTGAGTAAGGCCAATGATCTTGAGGGGGAAGCCTTGTGCTAGGTGATGGTTCTG
AGAGTAGGGGTGAGGAAATCGGGAAGGCCATGTGCGTGACAAGGAATCACAGGTAAAAAG
CAGCCAGTGTGGGCCTGTAGACCACTTCTGGACCTTCCCATCTGAGAGTGTAAACTCTTA
GGGAGTCGAGCAGAGAACCCTAACATGACTGATTTTTTTTTTAAAGTCATTAGTGTAGTA
AACTTTGGAAGGTGTGTGCAGAAGGGAAGGGGTGAAGGCAGACACGGGATTTTGGATGAG
TAGAGCCTTGGTAGGCAAGACTGCAGAGAGGATGTGGTGACATCAAGCAGTTTTCCATTT
TTTACAGTGGTGGTGTCAGCATCGTGCTGCATAAGAACTTGGGTGATAGACCATCGGAAA
GTAATGAGACCGGGTTTAAGTTGTCGTGTGTAAATAAGCAGGTTGGACCTGATGCTGTTA
TGTTAAAAGAGTTTGGGAATAGTTGTATCCAAGATACTAAATGTATTCTTGGTCAATACT
GCCCTGGGCAGTAATCTGGAGGGTGTATGTTTTAAAGGGGAAAGGGTGGGCTTGCATTCA
AAGGTTTTGCTTGCAATGATGTCGTAATTTGCGTCTGACTCTGTTCTCAGCGACAGTTGC
CTGCTGTCACTAGGCTGGTACAGAGGGTTGACGAAAATTCTTACTGAGCAAGACATACTG
GGTTTTAATTCTTAAACCTAAAAAGTGAGCTGTTGGATTACTGTCCATCAGCCTGTTCTG
GTGTCTTGATGAGGGCCTTGCTTCTACTGCCCTTGCCTTCTCCCAGCTCTTCTACCCATT
TTGTTGGCACATGAGGTGCATGCTTCCACTGTTTGCCACTATAACGAACCTTTTCTGTTT
CCCAAGGCGTGTGCTCGTCCACTGATATCAGTGTACTCTGAAAAGGGCGAATCATCTGGC
AAAAATGTTACTTTGCCAGCTGTGTTCAAGGCTCCCATCCGACCGGATATCGTGAATTTT
GTTCACACCAACCTGCGCAAGAACAACAGGCAGCCCTATGCTGTCAGCGAATTGGCAGGT
AAGATGTAGGTGTAGATGTCCAAGGGTTGGTGTTGGCTGCTACTCAGTAGTGATGAGCTT
ACACTTCATTGGTCCGTGTTTCTGAAACACATGATTGTTCCTGGGTGTTCTGATGCTGTT
TGCCCACCCTGTGTATTAGTCATAGATGATAGCTTTGAGTGGCTAAAATTTATATTTCTT
ATCTCTTGCAGGTCATCAGACCAGTGCTGAGTCTTGGGGTACTGGCCGAGCCGTGGCGAG
AATTCCTAGAGTCCGGGGTGGTGGGACACACCGTTCTGGCCAAGGTGCTTTTGGAAATGT
ATCCTTGTGGAATTTAGCCAACAGACCCTTACTGGGCATAACAGTGTCCATGTTAACAGA
CGGTTCAGCACAGGTTTGGAATCTGGGGATGGTTACTTCTACGGCAGTTCTTTTTGCAAT
GATGGCGTAATTTGCGTCTGACTCTGTTCTCAGCGACAGTTGCCTGCTGTCACTAGGCTG
GTACAGAAGGTTGACGGAAATTCTTACTGAGCAAGACATACATGGGTTGTTGTTTTTTAA
CCTTAAATCTTGAGGTATGTGATTCTTAACCGGGAAAAATAGATGTGTCGTGGAGGTCGC
ATGTTTGCACCAACCAAAACCTGGCGCCGTTGGCATCGGAGAGTGAACACCACTCAGAAG
CGCTACGCCATCTGTTCGGCCCTGGCTGCCTCTGCCTTGCCCGCCCTCGTCATGTCTAAA
GGTTTGTGATAGTGGGCTTCGTAGGAGTTGGGCAAAACTTTTCCTGTGCGTTTTTGTGAC
TGCCTTGTTCTGTGAGTTGCCTAATTTACCTCAACAAAACAGAGACTACAGCAGATAACA
GTGACCTGGTCCGTCATTACAACATTTCTACTTAAACCCCATGTTTATTTTGCTGCTGAA
ATGATGAAATGCCACTTCGTTGGTCCGTGTTTCTGAAACACATGATCTTAGTGGAAGTTC
TGAATTTAACAAGGTTTTCGCGTGTGCTTATGTGCAGAGTTATATAAAAGTAACCCTGTC
ATAAAATGGTTTCTTAATTTTTTCAAAAGGTTTCAGGGTAACCCAGTGTTGAAATTGGCT
TTGCCCAGGTCATCGCATTGAGGAAGTTCCTGAACTTCCTTTGGTGGTCGAAGACAAAGT
AGAAGGCTACAAGAAGACCAAAGAGGCAGTCTTGCTTCTTAAGAAATTGAAGGCCTGGAA
TGATATCAAGAAGGTAGGCTGGTAGGGTGCGGGGGTCAATATAATGGCTCAATTGCTATA
GCTCATCTTAAAGGGCTATGTGGGGGTGCTCTAAAATTGATGTGGAGGTGACTACAATTC
TTGATATGACTGAAATATTGAATTACATGGTATGTAAGTCACATGCCATTAAAGCAGGGT
GGAAGGTAGGGCTCGAGGGGACACATTGACGGTTTTAGTGATCCTTTGTTTTCCCATCTC
TAACTTAACGTGATTCATTGAATAAGGGCAAGAGTTCTGAAGCCAAAAGTGATTGGGGCT
TAAAGTCCTGTGAGTGACCTTTGGCAAGTACTTTGTTTTTAGCTGTAAGAACTGAGCCAT
GTCCAACTACCAAAGGGTGGTGTGGTCTTTCATCAAGAATAACAAAAATCCTTTTGCCTT
CGGTTAGGGTCTATTGCCCTCTCTAGGAGAATCGAGGAGCGGGCAAGGGGCAAAATTGAA
GAATACCGTTCGGGCGGATACCCAGCCGCCAGGGGGACCATTGCATTATCTACAACGAAG
ACAATGGCATCGTCAAGGCCTTCAGGAACATCCCCGGTAAGTCTAGTTTCACTTGTCCGT
ATAGGCTGTCTGGCTCAATTACTGTCGTGATGAGATTCCACTTTATGGTCCGTGTTTCTG
AAACACATGATAATTGTGGATGTTCTGATTCTGGGCTGAATGCGGGGCCTTCATTGATGA
CTGAAGTGTCATAAATTAGATTGATTCGGGTTTAGCTGCTAATTAAGAGGATTCTTCTTT
CCCTTTGAAAGGAATTACTCTGCTCAATGTCAGCAAACTGAACATTTTGAAACTTGCTCC
TGGTGGGCATGTGGGGCGTTTCTGCATTTGGACTGAAGGTGCCTTTCACAAGTTGGATGA
GCTGTATGGCACCTGGAGGAAGGCCGCCTCCCTGAAGAGTAACTACAAGTGAGTTTTTAC
TGTTGGTGCTGTGGGTATTTGCATTCAGAACTGGTTTGCGTCTGACCTCATAGTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 2586..2757, 2951..3057, 3342..3480, 3848..3972, 4388..4394, 4399..4411, 4414..4428, 4430..4449, 4457..4465, 4470..4535, 4751..4905
1001..1003, 2586..2757, 2951..3057, 3342..3480, 3848..3972, 4388..4394, 4399..4411, 4414..4428, 4430..4449, 4457..4465, 4470..4535, 4751..4905
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved