Echinops_telfairi Locus ENSETEG00000017076
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000017076
Echinops_telfairi
ENSETEG00000017076
GeneScaffold_1695
SNORD32, SNORD35, SNORD35
2825..2905, 3921..4007, 4615..4700
5866
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCGAGCCGGTTCGCCTCTTCCCCAGGCGATCCCGCCTCTAGT
GGGCGGTGTAGGAGACGCTGCGCATGCGCGCCACACCCCGACCAATGAGAAAGCCGGAGA
GCTGTTTGCGCCGCCCATGTGACATCACTTCCGGCGCCCCTGGCTGAGGGGATAAGAAAC
CCTGCGCCAGCGCTTCCTCCTTTCCCAGGCGGCTGCCGAAGATGGCGGAGGGGCAGGTTC
GGGCTCCGCGCGGGTCGGGGTGGGTTCCAGCCCGGGATGGGGTTTCGAAGTGTGTGCATT
CCCGTGTGGGCTGTGGGACGCGGCGCCTATAATGGCGTAGGAGACGGGACACTTGGCGTG
AGGAGGGTTCGTCACGCGGAAGCGGGATTCGTGCTGTGCGTAGGCCCGGGGCGGGTGGGC
CCATGGTGGGCCCCGCTTCCCTGGCGGTGATGGGGGCGGCTTCCGGGGGAGAGAGGTAGC
CAGGGGCTTGGGGCCGAGCAGGCGCCGGGAGGAGATGAGGGAGCCCGCGGGAGGTCGGGC
TGCCGCGGGGACGTGAAGCCGAGCGGGACCGGGGCCCCGAGTGCAGGTCGCAGCCTTCCT
GGGTGGCAGGCTTGGCTGTCACTTCCGGCACGAGGTCTGCTCCTGAGAGGCGGGCTTCTA
GGACAGCATTTGCTTTTCTTAAAGTTTTCCCCCAAGCTGGCGGGTCGCATCCAGTTTCGG
CGCGTATTCAGTACGCTTCGCTTTTGCATTCCGCGCTCTTAGAGCCTAATGGCGTGCAGT
GGGTTACGAATCTAGTGGGAAGCCTCCGGGTTGCTTCTGTGAGATTCACAGCTGGGAAAC
GCTGCTACTCCATGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGAGTCTGGCTTTTATTTTAGGTTAGCAGCTAATCGCTTAAGCCACTGTACAATCA
GTGCTCCTTAAATATACAGTTGTTTGTATCAAATAATGAGAGGTGGGACAAGGCTTTGCT
AAGTGATTGGAAAATGGTTCGCCAGTGGCTACATTTCTTCGGAGCTATTTAATGGCCCCA
GATATCCACAGCCCTGGCCTTCAGCCATCAGGGGGGTTATATTGCTGTGCAGTGCACAGT
AGAGCATCTTTGAAAGGAATCGATGGCTGTCCAGGTGCTAGAGCTTCTCTCGGGTTGGCT
AGGCGGGGGTTCCAACAATTGAAGCCAGATAATGATACCTGCCCCCTGGGAGCAACCAAG
AGGGAGGGGGTATTTTTTGCATGAGAGTGATAGTACGATTTAGCATTTTTCTCATCTCCG
AAGTGGGGCCGGGAACAGACGAGTGGTGTCAATACTGGCATCAGAAAGGACTGTTGTGGG
GGTGTGGTGAGTTGGCAAGGCAGGTGGAGGTTGCCGAGCCTGCTAACCGAGTTCTCCATC
CTCAGGTCCTGGTGCTCGATGGCCGTGGCCATCTCCTGGGCCGGCTGGCGGCCATTGTGG
CCAAGCAAGTGCTGCTGGGTGAGTACTCTGTCCACCCTGCCTGCGGGCTAGTACCCGTAC
CTGTCTGGTCAGTGATGAGCAAAAATCACCATCTTTCGTTTGAGTCTCACGACCATGAGA
CCAACCCATGCACCGCTCTGAGACCTGCCTGGCATTTGCTCCAGGAGCAGCAAGCCAGCT
CTGTTGGGTGCCGTGACCTGGCCAGAGTGCCCCCCTTCCCTCCCCACCCAGGGCCTGGGC
AGGTGGGGAACTAGGAGGCGCTGCCAGGTTGGTTTGATAACCACTTCCCCTCTCCTGGGT
TGCTTCCCATTAGGCCGCAAGGTGGTGGTGGTGCGCTGTGAGGGCATCAACATTTCTGGA
AACTTCTACAGAAACAAGTGTAAGTGAGGACTGGGAGGCAAGCAGCCCGTGGGGGGTTGG
GTTTGGGGTTTTGGTCTGAGACTTGCTAGATCTCCTTGGCCCCTCCTCACACATGCACCA
CTCCTCCCACAGTGAAGTACCTGGCCTTCCTCCGCAAGCGCATGAACACCAACCCCTCCC
GAGGCCCCTACCACTTCCGGGCCCCTAGCCGCATCTTCTGGCGAACCGTGCGAGGTGAGT
TGGGCCCGGGCTATGCTCAGTCAGACGTGGGTAGGTGGCCAGTGATGAGGACTTCTCCCA
CTCAAGTTCGAGTTTCTGACAATGAGATAACCTCACATGCACTACCATCTGAGGCCACTC
TGCCCCTACCCTGCGAGGGATTGAAGCTGGTGACATCCCCTTAGCTCTGCCCTTTTGTTG
CCCACAGGCATGCTGCCCCACAAGACCAAGAGGGGCCAGGCTGCCCTGGACCGGCTCAAA
GTGTTTGATGGGATCCCACCCCCCTATGATAAGGTGAGTTGGTCCATACCCCACTCAGCA
CCCAGGGGCCCAGGCGTCTGTGATGTTCCTTAAATCTACCTACATTGTTTGAACCCCATG
AGAAGAGCTTTGGCTGAGACGCTGGCCCATCCTCTCAGCTGGTCCTCCCCTGTGAACCCC
ACTCTAAGCCCTATCTTTCCCCACAGAAAAAGCGGATGGTGGTCCCTGCTGCCCTCAAGG
TGGTGCGACTGAAGCCCACACGCAAGGTGAGTGCTCGGGACTGGGCTGTGCATCTGACTG
GAGATAGGGGCTCCCGGTCCTGGCAGGTGATGGATTACTCTCACGATGGTCTGCGGATGC
CCGAGCGGGCAATGCCGAAAGTGCCAATGGCTCAGCTGATGCCAGGAACTGGGGCCAGAG
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCAG
CTCATGGTAAGTGAGGACATGGCTAGGAGAGTGTCACACTCTTTGACACGACACTGGCAG
GTGATGTTCTTTTCTCACGATGGTCTTCGTATGCCCCTGGGGTTCTGCCGACACTGCCCA
AGGCAATGCTGATGCCAGTGGCTGGGGTGGGGAACCTTTCATTGGGCTAGGGTGGTCACT
TCAACTCCCACTGACCACCATTGGTTTGTCTCCCCTACAGAGGCTGCGGAAACAGGCCGA
GAAGAACCTGGAGACAAAGATCAACAAGTACACAGAGGTTCTAAAGACCCATGGACTCCT
GGTCTGAGCCCAATAAAGACTTAGTCCTTCACTGGCCTAGCTTGCCCTTCCTCCATCGCC
ATTCTGGGACATGGGGACACCCTCAGTCACAGCAGGGCTCAGGTGGCACAGAGTAGTAGA
GTGCCCAGATCAAGCTCAGGCCCACAGCACCCGTCTGTGAGGTCTTTCCGTGAAGTCTGC
AGCTATTGGCTGGAAAGCTTTTACACAAACAGCTGGAGCAGCCAGGCACTACCACAGCCA
GCATCTGCCAGACCTGAGCTAGAAGACAGGGAGAGAACAAACAAGCATGTTGGGCATTGG
CTGTAAATACTGGTTCAGCACTGTACTCTGCAGCCAGTGAAACAGGCCTGGAGCTTGTGC
TGTGCCAGGTGCTCCTGGGGTAGAGACGAGTGGGATTCGTATGTGCAGGGCCACAGCACC
GCCCTCACTGCTTTCCTGGTCTGTAATTTAAAACTAATAAATTACCTGGTGAACCAAGGT
GGTGTCTTGCACTATGTCCGCTCCAGAGAGCAAGGGGGAGGTGTCTTGAAGGCTGCAGCC
TGACAGGAAAGCATACTACATGGTGTTGTCTGGTGGCGACAGGAGCATCTTTCCAGTAGA
GCTGTAGCTGCCTGTTTCTGACTTAGCTGCAAAGTGTGGGCTTGCCAGTGTTTTAGCCAA
TTCACCCCATCGCGTAATGCCACTGGATCAAGGAGTAAGGGCCACAGACGGTGATGGGAA
GTGTGTAGATTCATCCCTCCAAGGCCCCCCACCTTAAAAATTGGAAATAGCAAACCACCC
ATCCCCTTGCTACACATTCACAAACTCCATCCAGTCTGCACACTAAGCACAGCCCTGTGT
TTCAGGTACCATGACTACAGAAGAAAGCCTCTTGGAACTGCTGCTGGGCTTGTGGCTTAG
CAACTCCAGGGGTGCTCCATACACTACCTGGACAACTTAAGATACCTTGACCTCAAACTC
CAGTTCTTGGATAGAGACCAAGAACCCGTCCAGTANNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 2705..2777, 3073..3138, 3252..3353, 3547..3632, 3806..3865, 4443..4565, 4780..4866
1001..1015, 2705..2777, 3073..3138, 3252..3353, 3547..3632, 3806..3865, 4443..4565, 4780..4863
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved