Echinops_telfairi Locus CPEB2
snOPY snoRNA Orthological Gene Database
Echinops_telfairi CPEB2
Echinops_telfairi
CPEB2
GeneScaffold_4003
SNORA42
48280..48414
108618
TATAGTAACTGCATGTTCCATGCTTCCTTTTGCTAAACCTCAGTCCAAGTTATTAAAAA
AGAAATCCTTAATTTAAAATCTTCAGAGTATTGGGTGGGGGGGGGGGGGTCCTCTAATGA
CAGTCTTCTGGTGGATTTTTCAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACATCAAG
CATTGCCAGTGTCCACCTTGGCTAATGTTTACAATGTGGTTTGGAATTTTCCGAAGGCCT
AAATACTTAACTCACGTGACTGGGAAATGTTAGTTAATGAAGAACCCTGTATTTAGTCTT
GTACCTAGCAGATTGTGGTTGCTTTAAGATCCCTCAACTTAAATACATCTATTTAAAGTG
TGTGTCCCTCTACCCCCCACCCCCCACTCCAAATACTTATCATGCCTATAGTTTCCCCTG
GAAAAGGATGGTTGGGGGTGATTCTTAATTTTAGTAGTTGCCACAAAGTGTCTGCTTGGC
CCTCATAATTTATGGCCAACAAGACAGTGAAAATGTACCCACAGCACTGAATACATGTTT
GCAATGTAGCAAGATCGCAAGCCTTTATTTACTTGTTTGCAAACTAGGCAAGGTGTATCT
CGTAGCCTTGGTGGATTTCACTTGGGTATTCTCAGTTCTTCGTTTATATCTGGATAGAGT
GAAATGCCCGTGCTTTAAACGGCGGCTGTGTGTTTCTTCAGCCTCTTCTGAAGCAGTCTC
CTTGGAGCACCCATCAGAGCAGTGGCTGGGGCACTGGAAGTATGTCCTGGGGAGCAATGC
ATGGCAGAGATCACCGGCGCACTGGAAACATGGGAATTCCGGGAACTCTGAGTCAGATTT
CACCCTTGAAGAAACCGTTCTCTGGTAATGTCATAGCACCACCGAAGTTCACTCGCTCGA
CACCTTCGCTGGCTCCAAAATCTTGGATCGAAGATAACGTGTTCCGAACAGACAACAATA
GTAACACACTCTTACCCTTACAGGTAAGAATGGTATGTAAATGAGGACTTCAAAAATGGC
AATCTTTAAAAAGAACTGCTTGGGGTGGAGGGTGGTAGTCTTCCTATGTAAAAGTTAGGA
AATGAAAGAAATGTTCCACTTTTTCAATGTAGAATGTAGTTTTTCAAAAGATGTAACTGA
GCAATATGGAAACATTTCTCTACTAGCACAATAGAGATTCAGCTTCCTAAGGGGGAGAGA
AAACCTGCCATGATTCTTGGTAGAGAAGGCCGCTTCTTAATGCTCAATGTCTTCTGTAGT
CCACCAAGCTGCAGCTCGCGTATGAGCTAGCTAGACCCAAAGTGCCACCATTGTGATGGT
GCATAGATTTGTCTCTGATCAGATGTACGTGTATTAGAAAATGCCACAGCTGTGATGATG
GGCCCTCATTTTTTTAAACATCAAATTTGTATTTATCTCAGCTGCTTCAGTGATTGTTTT
CTAAATATGGCCCCATACTGAATGTGCTTAGATTTTCATTAGGCCTTGTATGTTATTGAT
GTTGCCAGTTAATGAACTTTCCTGATGGCTATTTCAAAAGCCTTCTATTTGTTTTTTTGC
TCTAAAACCATTAGAGGACAAGACAAAAGATACAAGATAGCAGGAATTTGTTTTGTTGCT
GTTGTTGTTCCTTTTTCGGTTGTGGGTGGATATTGGGAAGAGAACTGCTCCTTTCTGATG
TAAACTTCTATGCTATTGAAGGTGAGATCTAGTTTGCAGTTGCCAGCTTGGGGCTCAGAG
TCACTCCAAGATAGTTGGTGCACTGCAGCTGGGACATCCAGAATAGACCAGGTAGGCTGC
ACAGCGTGTATTTTTCAGGGTTTTTGGCTAGGAGCATAGTATGTCTTATTAGGATTTCTT
ATTTGTTCTCCACCTCTGCCTGTCTAAGCAGATGTCAGGACATGAAAGCAGTCTGCTTAC
TATTTTGTTTGTTTGTTTTAAGGGTTATTTGGTTTTATGAGACGACTTAATATAAAATGC
TTCATTTCCCAATTGAAACGTAATTTGTCACCATTTTATGCTTTCCAAACCATCTATTAC
ATTTGGTTTTAGAAAAGTGAATTCAATACAACTGGGGTTTGTAAGAGCACCTGACTTTAA
ACATCAGTGGAGCTGAACAGATTTTATCTCCTTTTAGAATGAGTTGCGATGAGGGCTCAA
AGTCACATCACCTTCACGTTCCATCCGAGTTTTACAGGCATCTGTAGTACAGCTTTGTCA
TGACAGGAGCTACATTTGACACAGATATTTCTAGTCAAGCCCTGTCTTAGTTGTGATTTT
CCCCCCCACCTTTATAAAGAACGGCAGTGCTTAATATTGATGTCATTCTAAGTCTCTATT
GCTGCTCTTTGATTATCATCTTCTCAAGCATCGGTTTCCTCGGAAGAGCCCTGGTGGCGC
AGTGGGTGACAAGTTGGGCTGCTGACTGACTACAAGGTTAGCAGTTTGAACCCACCAGTC
GCTCCATGGGGAAAAGAGGAGACTGTCTGCTCCCACAAAGAGTGACAGGCCCAGAGCCAG
TCAGAAAGCTGGGAGTCGATCAAATTGTCTTCCAGGCCTTTGTGGCTGGCACACAGTGAT
TTCCAGCAGAGGCATTTAAGTAGGCCCTGGTCCCTATAATGAAGAAAGTTATAGAGCAAA
TAGAAAGCCCAGTCCTCACACATCAGGGCTCTTTCTTAGAGACTCCTAGCAGGATGGATC
TGGAAGTCTTGTGAAGAATGGGGTGATGTTCCATGTAGCTGTCGAAGTCCTTCGTTAGTT
AATGGAGCTGGATCCACAAATACACAGACTGTATGCAAATGACTGATGGCACTCCTATAT
AGCATTGAGGCTTTACATTAGCGTCAACTCAATGAGGTTTTGAGAAGTAGCATTGTAATC
TAAATAAACTAGCTTTTAAAATAATTTCCCAGAGGTGGTGATGTTTAGGTAAGTACTGTC
TGTTTGCTACAGTAGTGCTCTCAGGATCTCCCTTTAGACTTGCTGATAAGATCCAAAGCT
TACTGGCTTCGCCTTTGTGGCCCAGTTAGGCCACGTCAGGAGCATTTTTGTGGTTGCACT
GTTGTGTTGTTTGAGTCCAGTGCCTGGGTGTCTAGGAAGTGGCACGTCAGGAGGGAAGTA
TTATAAATATGTTGATAGTAGAGATGTCTGTGGAGAGTACGTGTATAGGAAGAACACTCA
GAAGAAGAAAGCAAGCACACTAACTTGCATAGAGTCCACCGGGTTCGGGAAAATTAAGTT
ATTGAAATGATTTCAGATGGGGGGGGGGGCAGCACAGGACAAAGGCTTAGCCCTCCTGTC
CCAACTGCAGCCCAAGCCACATGTCCTTTTCCCTATTTTATCTGCATGCAAACTGGCACT
TCAAGCTGATACATTTTAGGAAGGATTTTGATGCTTACAGACACATATTTACACACCACA
CACACGTCTCTGGGTACTACACATGGTTACTCACTCCTAGCAGGGATCTTGGTGGTTCAT
ATCCACCCTTTTTAGGAAAGCCCTGCAGTATGCCTCCTCAAGGTCAGAGCCTTGGAGACC
ATGGTCTGTGGTGGTGCTGCTATGGCCACTGTGAGTCAGGATCTCCACAGCCCAAGTCAG
GATCCTTACGCACATGTACTGCCCACACGCATGCACTTCTGTAGACACTGGCGTTGCTGT
GGACTCTGTCTGCTTGGACCTAAGTGTGATGTGACCAACTTGAAGTGACCTGAGACCTGG
ATGAGGGAGGATGTGGCAGCTCTCATGTCTGGATGACCAGTTGCTTATCTCTGAGTAAGA
GAACTGGGCCATCTGAGGCCTGGGAGCAGCTCTTTGACTTGGTCTGGTCTATTTGGTCTT
TTGGCCTTTCTTTTTGTTTTCTCCTTTCCCTGCCCCCTCACCCTGCCTCCTATTATTTTT
AAAATGCAAGGGTCTTGGTTTCTTGGGTTGAAGGAGTGAACAGCGGTCCAAGGACATGCC
CCCTCAGGGTAATTGTTAGGAATAAATTGTTCTCTCTTTCCATAAAAGGCTGAGGTATTT
GAAGCAGAGGTTCTTCAAAACACAGTAGCAACTACAAACTGGGGTTGCTATCATAGACTG
TGGAGTCATTCCCCACTATTTGGTAACAGAGAAATTACAGAAAATACTTCAGCTCTTCAA
AAAGTTGAGCACATTACATTTCTGAACTTTTTCAAAGTTATATAAGGATATTTTGATTAC
GAATACATTTTTGCTAACAAATACATTATTTAAAAACCCGTGGTTTCTTATGTCTTTAGT
CTCAAGCTGATTAGGCCTTAAAATCCTCATTTCTAGTATTAACACCCAGATTTTTAAACC
TGGTCTCCCAGGGCCAACAGTTGAACATAAAATTAAATTCAATCAATAGGAAAGATACAG
ATTTGTTAGTCTGGTTTTATTTTAATTGGATTTGACGTTTTTGGTGTTGATATTTTTCTT
AAATGAGCTGTTTCTGGGGTGTGTTTTTTTTTTTTCAGGGAAAGATGTCAGATTTAAAAC
TGTTGTAATAACTCAAGTATAAATTGCTATGTACATTTCTGGCGTAATATTGTGTATTTC
TTTCTTAGTATCTTTAAGACGAGGAATTACGTTAAAACACTGCTAGCTAGTTGTCCTTGT
AAGAAATCATCCTTGAAAGCTAAAATTCTTATGTAACCTTCAGGTGGAATTTTCAAGTGG
ATGCACTATAATTAGTCATTAATACTCACTCGGGATGTCCTTAAATCGGAGACTAAATGG
ACTTTTAACTGAGAGGATTACTACTAGCACACCGCTTTCCTGTATGCCGAGCAGAGCAGG
GGCATGCCTTCAGAGCAGTAATAGGATATGCAGAGCCCATAGGATACATGCGCCCCCTGC
CTTCTAGCCCAGAGAAGGTCAGCATGTTGAATGCTGAGTTCTGCCTGCAGTGCGGGAGTG
TGTCCACGTTGCCTACCGTGAATTAACTGAAGCTGCCTCCCTCCAATCTCCAACAGCCAC
GCTATTATGGTAAATGATCACTTAGGCCATCCCCCTTATAAAAGTAACTTGAAGTCTATT
CATTTCACCCAAAAAGGCAATCTAGATCAACCATTGTAGAGAAGAATTCGACACCAGATT
GTAGTAGATCAACTCCAGTCCTCCACCTAAAAAAGTATTCCTCACACTGGTTCTTGGCTG
TTGGGAGGCATCAAACTGTTGAAGAGCACACAAAAACAACCTGCTGCTATTGAGTTGATT
CCAACTCCTGCCTCACGTTCACCAGCTCATCCACCTGAACATGAGATGAAATGCCATAGA
GGGGGTTCTTGTACACGTAGTGTAGCCGATGGATACGTTCTTCCTACACTTCCCCTCTCA
CTTTCTGTTCTTTACTGGTGTCCGCTACATTCTCACCACAAGTATCCATGTGTTTTCATT
TTCTTTGGGTATAGAATAGCTTTAGCTTAGCCTTAAAAAAAATACATTGTTACCTTTAGA
GTGACTTTGTTGAGGTTCAGAAAGAATGCCCTGGGCATGGTCGTGTTTAAATTAGCTGTG
GAGTGGATTGGGGAAGCCTTTGAGAAGCCGAGAGACCAGATGAGGTGAATCAAGGGCCGA
CGTGAAACAACCAGAGAATGATGTAAGAACGTGTGAGATTAAGGGCTACATTGTGTAACA
GCAGCGTAGCACACAATCTGCTGCTATTTCAACATGGTGCAAAACCTGTGATCGGGAAAG
CATAATCAGTATTTACTTAAGACGTGGAACAATATTAGCACAGCTCTTCGCTATTTTAAA
GTGAAAGAACTCAACACAGACATTAAAAATAGAACAGAAGCTGCTCTTTCTGCTTCACCA
AATGCACACCTGCTTAGGTATCTGAATGTAAGACCCACAGGGTTTGTTCCATAGCACCCA
CTCCCACCCTGTGTTTCTTGAATCCTTGTTTCCTTTTCAAAAGTAAAAAGGTGGATACTG
TGGAAATGCAACAGAGTTTTGAATATGTCAAAGTCAGAAGCAATCACCTATCGAAAAGCC
ACCTTTGAATGCCTTTTGTTGCACTCATTCTAAAAGTCAGGTGCTGACCTTATGAATTAT
TCTTTAGCATAGGTATCCTCTGGGCTCTTTGACCAACCTCTTCAAGATTTGGATTTTTTG
TTTGTTTCCTTTCTTGGTCTTTGAACCTTTCTAGCGCTTTAGGGAAGCTTTCATGGGTGA
TTCTGGCAACTGATGGGGTTTAAGAAAAACAAAATAATTTGACTATCAGATGGCATGTTT
TCTCCAGACCCATCTCTTTCTGATCCCCTTTTTTGCCTGCTTGTGTGGTGGGCTTCTGTC
ATATCTGGCCTGACGCTGTTTAGTTGACCCTGTCCCAAATCATTCTCAAGTCTCAGAAGA
GGTGAAGTATACATTGTTCATGACGGTGGGGCCAGCCCCTCCACAAGGGAAAGGTGAGGC
AACCTACTCCTTAAGACAGCGGTTCTCAACCTGTGGGTCGTGACCCCTTTGGGGGTACAA
TGACCCTTTCACAGGGGTAGCCCGATTTACAACTAGCAAAACTACAGTGATGAAGTAGCA
ATGAAAATAATTTTATGGTTGGGGGGTCACCCCAACATGAGGAACTATTAAAGGGTGGTG
GCATGAGGAAGCTTGAGGATTTGAGGGCTTACAGTTCAGACTCCTACCGAGCAGTTCTGC
ACTGCCCGTAGCCTTTCTCTGAGGGGGGGTTGGCTCAGCCACTGTGCCAACTGTGCTCAC
AGAGCGATTCTTATTTCTGAAAAAACCTCTTGGCAGTTTTGGGTAGAAATGAGTTTGGTT
TCATTGCCGTGCTCGGCCGTTATTTACTGGTGCTAATCAATATTGCTGTGTTTATAATTA
CTTTTGAAATCGCCTCAGGATTTCTCTTTCGCTTTTAAACCAATGTGGAATTTTCATTTT
GTGTCACCACCCTGCCGGCCCGTTTGTGGGGGCTGTGATGACCTTGGTGTTGTTGTGCCA
CCAGTTTGCCTAAACAGCAGCAGGCTCTCACCAGTGGCGGACAGGTTTCAGCAGAACTTT
TACAAAGTACTAGGAAGAATGGACCTGGCTATTGGCCTATGAAAATTAGCTGAGGAAACT
TGTTGAGTCTAAAACATTGAATCCGCCTCCATCCCTTGCTCTTAGCTGGTAAAGATCTAA
CAACCCTAATTTAAACTTTAAAATAAATGGGTGAGCATACTCACATTCCTGGGAAATCTT
ATGCTTTTCTCTTCAGGTTCATAAAGGGCTGGTTGGGTCTGGTCTCTGGATGGGGGAATC
CCTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCT
GTTTTGCCGTTTTCCTATATGTAAACAGATAGAAGTTTGCTTTCTTCACATATGATGGCT
TTGTCACCCTTCAGAGGGATTAGTGTTCTCGGGGTCAAATCTGTTCGTGAGATGACTTCT
AATTCAGGTGTGAGCTACTCAAGAATGTGGTGGACTTCTTTGAATTTTTTTCAGCTTCAA
TGTGAACTTGTCTATGAGCAACAGTAGTCTCTCGACAGTCAACTGCTTGTTCTGACTGAT
GGGGAGCTTCTCTGTGGGGTTTGCTGTAGACACAAAGTCACTTTGATTCTTGTCCATACT
GACCAGTGAAGTCCACATGTGGAGTTGAGGTTTATGTCTTGCATCAGAGTTCCATTTTGC
CATGTCCGGCATCATTTCTGTCACCAAGGCCATATTTTCTAGCGACTGATCTTCTTCGTT
TCCAGTCTTCACATTCCGGTCACTTGTAATTATCAGTACTTCTTGATTGCAAGTTCAGTT
TCAGACTCTGATGTAGTAAAAAAAGTCATCCCGTCTTTTCATCTTTGGCATCACTGGTGT
GTAAGTCTGAGTAATAGCTGTGCTAAGTGGGTCTTCGTGTGGATATTCCACCTCTGTTCT
GCAGGATGGAGCTGCTGTTTTTGAAGCATTCCTTTTCCATTTTTTTCACTCCCTGCATTG
TAGACCATCTAATTTCACTTCTAAATGGCTAATACCAGGCCATGGCCAGCTCACTAATGC
CTAGGATATATTGGTCTTTATATGCCCTGTTTCATACTCAATGGCTTCCTGGTTTGCCAG
CATCATAATTCATATGTTCCACATACTGATGAGTGATGGATGTTGGCAGCGGTTTCTTCT
CATTTTGAGTTTTGCCCCTTCAGCAAATGAAGGTGCTGAAAGCTCGACTCCATCCACTTC
ATTAAGATTGACGAGTCTTATTCTGAGTGCCTTCCCACTCAAGCGTAGTGGTTACACGTT
GGTCTCTGATCCTCGTGGTTGGCAGTTTGAAACCACCAGCAACTCCGAGGGAAAGAATAG
ACTTTGTACTCCCGTAATGGTGACTGCCTCGGAAACCAACCCACAGAGGGGTCACTTCCT
TGATGGCAGTGAGCTGTCCAACACAAGGGGCCCATCTTCCGGCAACAGGTCCTTCTCTTA
TCCATAGGGGGTCCAGCAGCCAGTTTTTTCCAGAAGTGAGTGCTAGGCCCCCCCCTCCCT
TTTCCTTGTGTGTCTTAGTCTGGAAGCTGTACTGAAATCTGCTACCAGTGTTTAAATACG
GGGGCATAGTACCCAGCATTACAGCAACACACAAGCCACCACAGTACAGTGATCTCAAAG
ATAAGTTCAGGTTGTTGTGGGAGTTCCTCTTCCTGATTTGTTTCATGTATCGCGAGTATG
CATTGAGTAGAATATACGTACAGTATGAATACATGATCACTGAAAAATCACATTGCTTTC
TGCTTTGGTGTAGTAAGCAAACTGTCCAACTTTAACATGTAGCAAATGAGTACTGATTGC
ATTAAAAAACACCATCTTTGTTCTGACTTCAAAGTAGAAAATGCCTTTTATTTTTTTTTT
TTTGCGGGGAGAGTTGGTAGAGAGCACAAGAAGAGATTAGAAAGCCAGAAACCATAGGTG
AGCACCTTAAGAGTGAGATTTGAATATAAATAATCTGGGGGTTGATCTTCTGATATTAGT
ATGTCATGCTTTTAATTTTTTTTTAATTTATCAGATGTCTACATTCATTATAATGAAAAT
CTATTCAGACACCAAGTCAAACAACATAAATTGTTTGATAGATGTTTAAAGTATGGTGCA
ATATGGAATTAAAATCCTTTTCCCCCTGAATTCTTATTTTTCAAGTGCCAATGTCCATCT
TCATAGACAAAGGAGAAACACAAGTTAGATAATCTACTAAAGTTGCTTTCTGTGTATACA
TTTTGTAATTTGAGAATGAGAACACTGTAAATTAATGTACTGTTATTATATTGCTATTAC
TCGTGAGATTAGACCATTCTTGATGTGAGGTTTTAAAAAGACAAATGTACTGAGTGTATT
CTCCAATGCACAGGAGATTGTAGCTGGTGAAAGCCTTCGTTTACTGGTGTTAACATCGGG
CTGCAGGCTGATTGATACTGTTAACCAGATATCCTGTGCTTGTTGTGGGAAATGGTTTAG
GTAGCATTTTTATTGTGACTTTGAAAATGTCGCTGAGAGGCTATTGAGACACCCCTTTTC
TTCTTTTTCAGGATCGCAGCAGAATGTACGACAGCTTGAACATGCACTCACTGGAAAACT
CCCTGATCGATATCATGAGAGCAGAGCATGATCCCCTCAAGGGTAGGTGACATTTTCTTG
ATTTTTTTAAAAAAGCAAGCAAACTTAATGATCCTCCACTTTGTTTATTTTAACATTTTT
AAATACAAAAAAACAAAAACAAAGAAAGGAGCTCTAAGTATAAGGACCCCTGGGGCACTG
ACAGTTAAATGCTCAACTTCACTGAAAGGTTGACCCTTGAAACTCACAAAGTAAGCCCCT
TGGGCGGGTAAAGGCCTGGGGACCTGCAGTTCTGTCTTGTCACACGGGTTTCTGTGAATT
GGAGTAGACCCGGTGGCATCTTCTAACGACAAGTAGCATCGGTGACTTATTGCAGATTTG
TTAATAGGATGCTTTGTTCTTGTGAAATGTACGTTTTTCTCTGTGGCTTCGTGCAAAGTT
AAACAGAAAAATGAACACCGCTGTTTCCACTGTTTTCCTAGATGTTGGGAAAGAGCCATA
CTCCATAACAAACCGAAAGGCTGAGAACTAGATCTAAAAGGGTCTATTATAGTCACTTTT
TCCAGAATTTGGCAAATACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTCACTAATAGTCAGCATGAACTTGGTGACAGTGAGTTCCCGAAGCTGTTAAGGAG
CCTTGGTGGCATGGCAGGTGAAGGAAGCACTGGACTGCTAACCACAAGGTCATGATTCAA
ATCCACCAGCTACTCCTTGGAAGGAAGATGTGGCAGTCTTGTCTCCTTAAAGATTTATAG
CCTTAGAAGCCAGATGGGACCATTCTCCTCGGTCCCATGGGATCCCTAAGAGTCAACATG
GACTGATGCCCATTGGTTTGGTTTGGCTGGTTGAAGTGGCAAACCAGCTCTTCCTAAAAA
TTGTGTAAGTTAAAGCATAACAAAACCAAAACCATGACATGCAGGTCAATGTGAAAGCAG
TATGTTAGTTCTCACACCAAAGAGACAGGTGACGAAATTATGAGCCCATTGTTGGTGAGG
GTCGATGTTGACTCAGTGACCTTGTAGGATTGATTGCCCGCTGGGTGTTCAGGTCTCTTC
ACAGACACAAACCACCACATCTTTCTGTCTTTTGTTTGTTTGTTTGTTCACATCTTTATT
TTTCCAGAGCAGCCTGTGGGGTTCAAAACACTACCTTTGGTGAGTGCCAGGTGCTTACCC
CTGTGTCACCAGGGCGTTTTACTGTGATTGGCCATTTTCTTTTTCTTTTTCCTGGAGTTA
TTCAGTCTTTGCTTGCTTGTTTGCTTACTTTTCTAACTAAGTACTAATTCATCCCAAAAT
GTATCATTCGAAGTGCAAAGCTCCTTTCAGTGCATATATAACGAGCATGTCAGAATGCCT
TGGAAGCATCCTTCTTGTAGGGCGGCAGCACTTGCATTCTGGTACTTGTATTTACCAGAA
TTCATCATCGGTGGACTCCGAGTCCTGAGCAGCACCTCCTTTTCTTAGCGAGTGGCTCCT
TGTTTGGTTGCGCAACCTATCAACGTACCTCCTTGCAGAGCAAACGTGCGGTTTAAGACC
TTCGTGCCCTGGCCATCCAGGAGTCTGCTATCTCGGTGAAGGGTTGTTCCCGCTGGGTGT
GGTTGAGGCCATTCTGATTACTCATAACCATCTCTGACGAGAGTAGAACACCCCATAGGG
TTTCCTAGGACGATAGAGCCCTTTTAAGAGCACATCTCCTAAGGGACAGCTTGTGGATTT
GAAACATCCCCCATTCCACTAGCAACTGCGTGCTTCGCTGCAGTGATGCCCGTCCTCCTT
CAGTGAAGGAAGGATGTAATAAACATGTTGTGTTAGGTAATCAGCAGTGCTGTGGAGTAG
TGCTCAGGGCCCACACAAGGAAAGAAGCTGTTGCATTGAGACATTGAAGTGCACTGGAAC
GACTTCTATCCATTTTCTTTGTAATTGCCACCAAATGGCTGGGTAGCAGCATGCAAGTTG
GTAAGTGGGACTCTGGACATAAGGATTGGTCAACTTTGCTATTCTGCTGGGTATAAAGTG
AACCTATCTCAGAAGCAAAAAGAGTCCCAAAGCAATTAAGGAAGAGTCTTTTAGGCCCTG
AGATTCCCACTTCCCAGCGAGGAAAGGCATTGACAGAGGACCGGCACTTGAGACCTTGGC
ACAGGGACAAAGGAGTCAAACTGAGGACCCTTGGGCAGGAAGCTGACTGCAGAGTGGTAT
GCCCTTTGAGGATTTATCGACACTAAGGATACTTTGTAACGCTTGCTCCAGCAGGGCAGA
GGCCAAGGGGCTTCTTTGCCTAGAGTGACGATGAGGGAGACATGCCACAAATAAAGTACT
AAACGTTCTCGCTTACCATCGAGTCAGTCCTAACTCACGGCACCTATAGGACAGGGTAGA
ACTTCCTCTGTCGGTTTCCAAGACTTACCTCTTTATGGGAGTAGAAAGCCTGGTCTTTTC
TCCTGTTGAACGCCTGGTGGTCTCAAACTGCTGGCCTTGAGGTTAGCAGCTCAACATTTA
ACCATTAGGTGGTATAAGTTCTAGGTGAAAACAGTGTTACCTGAATATGACATAAACTGG
AAACTTAATAGGTTACTATTAAGGTTAATAATTTCACAGTGATAGAGGAAACGCCACACT
TGCCTGTCCTTGTGTCATACATACTCTGGTGGCTTGCGTGTTGCTGTGATGCTGGAAGCT
GTGCCAGTAGTCTTTCAAATGCCTGTCGTGTTATCCATGATGGGTTCCTCCTGAGCATCC
ACTTTAAGATAGACTAGGAAAAAAGACCTGGCCTTCATTGTCTTAAAAAATAATAAAGTG
AAGCCATTGTGAACACCAGCATAACACCGTCTGTTACAACACCGAAGATGATTGAATGGC
ACTCATCGTATGAATGGCACTCACCAATGTGACTAGGAAAGAGCGTCCTCTTCCAAGTGA
AGTTGCCTAGAATTGTAAGAAGGAACCAAAGCTATCAGAACCTTCATTTACTGATAGGGC
GTGTCAAAATGAGAAGAAACAGCTACAAACATTCTTCAAAAATCAGAATATGGACTGGAT
GAAGTATGAATCTGTGATCATTGCATGTGGTCAAAAATGAGGTAGAACACATAAAAATTG
GTATTTTAGGCACTAGTGACCTGGAATAGGCTGGTCTACTATGCAAGGAATATCAAATTG
AAGCGATACGGTGTCACATTCATTGTTGAAAAAAATTATTAGAAGCTCTACGTTGGAATT
ACAGCACTGTTAGTGAATTTAGTGGTAGAAGACCCCCATATGCATCTGGATATAATATGA
TTATTAGCATAGTTGTACATCAGCCACCAATGCCAACGATGAAGAAATAGATCATTTTTA
TCAACTTCTGCAGTCCGAGACTGATTAAATGTGTAATCCAGTTGCACTCAGAATTACCGG
TGGTTGGAATGTAAAATTAGAAAATAAAGAAGCATCAGTAATTGGAAAGTACCTCCTTGG
TGATAGAAATGCTGCTGGAGATCCCATCTACTTTCGCCAGGCCAAAGAGTAAGCTACCAC
AAATGCTCCTTCTGCCACAGCATATGCAGTGACTATAGATAGGCATGGGCCTTGCCAGGT
GGAATACAAAGGAATCAAACAGGGCACATCCGTGAAAAGACACTGCCAGACCATTGCCAG
AGGCCAACTGCAAAACAGACCATCAGTTGCACGTATGAAGTTTCAGGAAGAATTTCCAAG
TCCCTGAGAGAGCCAGTATCCTTTAAGAAAACATTTCAAAATTAAGTTTCACACATAGAA
CACTAATGGAATACACAGGAATAAAGTCAACTAAAGCTGTGGGAAGATACAATAGGGAAG
CTGAGAATCCTCAGCCCAAACAAGGCCAGGCACCACCTGCAGCAAACCATCAACTGCTCG
TAGGTAAGTTCAGGCTGAAGTAGAAGAAAATGAAAATAAGTCCACAGTACCGAAAATAAG
ACCATGAGTCTATAGGGCCTTTGGATTTCAAGAAGATTACTAGAGCAGTTTCAACACATT
GAACAGTAATGAGCAAAGACCAGATGGCTTGTGAAATGGCATCAAAGACAACAATGTAAA
GAAAGTAAAAGGACAGGAAAGTAAGACCAACGTGCATGTCAGAAGAGACTCTGAGCAGTG
TAGTTAAAGCAGATGTAAGAAATGAAGAAAAATAGCTGAACCGAAGATTTTAAAGTATGG
CTTGAGAATACAGGTATAAAATATTCCAATGAAATGTGCAAAGACCTGGATTTAGAACAC
ATTTGGTCTTTTTCAAGGTCAAAGAACTTAAAAGTCTCAAGTTGCAACACTGATGGATTG
GTGGGCAAAATACTGAATAGGATGGGAAGCAGTACACACCAAACCAAAAAGGCTTGGTCA
GTCTTCAACCAATTACTCAAGTTTTAAAAGGAACATACAGTCAAGAACGGGTGGTACTGA
AGGAAGAAATCCAAACTGCTATTAAGATCGGGCCAAGACCAAAGTTGAGGAACTGATGGA
ATGCTAGTTGAGTTATGCTAACAAGCAGGTGCAATGCTGTACATTTTCAGTCATTTTTGG
ACGATACCTCCCTCACTAATGGGTTGGAATAGAGCCAATCCAAGAACTCTGATTCAGTAG
TGTGTGCACTCTTTCAACCCGAATAAGGGGTGACTGCATGGCTTACAATCAGGATAGGTG
TGTATCAGGGTTGTATTCTTTCACCATATTCAGTTTATGTGCACAGCAAATAATCCAGGA
AGCCGGACCCTGAAGAGGAGCACAGCAGCAGGGCCGGAGGAAGGTTTATTAGTAGTAGCG
TGTGATGTGCAGATGACCAAACCTTGCTTGTGGAAAGCGAGGAGCATTTGAAACACTTCC
TGGTGCAGATTCAAGACTGCAGCCCTCTCTGTACACTGCAACTCAATGTAAAGAAAACAA
ATTCTTCTAACTGAACCAATAAAAAGTGCCATGATAAATGGAGGAAAAAAATGGAAGTTG
TGAAGGATTTCATTGTTCTTGGATTCAGGATGCTCATGAGAGCTGCAGTAAAGAAACCCT
AGGAAGATTGCCTTGGGGGAACCCTGCAAGTGCTCTCTGAAGTGTTCAGAAGCAGAGATG
TCCCTTTGGAGACGACGGCGGCCGGCCTGACCCGAGCTATGCGATCTTCTGTTTCCGCCT
GCCTTCTGTGAGCAATGAATCAGGAGGACTGACACGGATGCCTTTAAATGGCGGTGTTGG
CAATGGCTATTGCGTATACCATGGACTGCCACAGGAATGAACAAATCTGCCACAGAAATG
CTCCTTGGAAGATTTTGTTTCCTGCCCTTTGGACCTGGAGGAGGGACAAGTCCGTGCAGA
AAGACATCTTGCTTGAAGAAGCATAGGGTCTGTAAGAAAGGAGGGCCAGCCCTCAGGATT
GACAAAAAGTGAGTGTTACTCACCCATTTTGTTTGGAATATTTTGATATATGCACCTAGA
TGTATTTGCAAACAGGTAACAGTCTTTTGAACGATCTACTTTTTTTCCCCCCTTTGGCAT
TTTTGAGTCCATTCAGAGAGTTGAGATACCAAAAAACTATTAACAGTGAAAACACCTTGT
TTCCATGTACCAGGATACACAATGAGCCTATTAAAGGATAAAACATGTGATGGCAATTGG
AAGTTGAGTTTTTCAGGTGGAAATAGGCTTTCAGCTTAACTCAGTCTTTGATCAGTTTGA
CTTCCAGTTAAAGTCCTGTCTGAATCCCTAAGCTTGGTTAAATATAAAGCAAACACAAAG
ATTGGTAGTTCTAACGAAACAGGCCTGCTGTTCTGCTTCCAAAAGGTCACACCATGGAAA
ACCCTGTGGGGCAATTCTACTCTTCGCACATGTCACCATGAGCTGGAATTGACCCAATAA
TGGCAACTTGGTGGCAACTGTAACTATGTATTATATGTAATAGCTCTTGTTGCATATGGC
AGGTTTTGATGAAATTGTATAACTGGGTCTGTGTGTCTTACCACACCATAAGCACTAACT
ATATCTTGTTCATATTGTGTTCTCAGCACAGTGTGATACTGGTTCCGTTTTGTAGGTCTT
TTCATTTTGAAAACTCGTCAGAAATAAGAGTCATTTTCCTAAGTCCTAATTGGTTCCTTG
GAATTTGGTCATCTAGAGAACCAGAAGCTGTGCAACAGGTGTAATTTGATGATAAAGATA
CACTTCAAAGTGATGCTCCATGCTGTTAAAATCTAATGTAGGAAAGCTTGGCTTTCTGGT
TCATTCTCTCTGCTCCTCCTGTTGATGCTCTTCTGAGTGTATGCGAAAGGAGCCTCTGCA
GACTTGTCGGTTAGGCATTGGGGCTGCTAACTGTAGGGAAGGTGGTTCAAACCCACCAGC
TCTTTCGTGGGAGAAGGAGACCTGTCTTGGAAACTGTATAAGGTCACTGTGAGTGGGAAC
CAACACGATGGCAGGGGGTTTGGGTTTGTTTTACGTATAACGTGGAAGAGCCTTAGTGAC
ACATTTGTTTAGTGCTCAAGCTGTGAAGGGAAAAGCCGGTTTTGAACCTACCAGCTGCTC
CAGGGGTGAAAAATGAGGCAGTCTGCTTCTGTAATATTGTAACCTTGGAAACCCTGTGGG
GCAGTTCTCCTCTGCCCTGTAGGATTGCGATGAATTAGAATCAACGAGGCTGCAAATGGG
TATGTGTGTGTATAAGCCAAACTCCCTGCCAATGACTTGATGCCAAAGCGCCCCATCTTT
CTGCCAAGGAAAGAGCTGCTGACCTCGTGGTTAGCTGCTAAACGAGTAGTCCACTATGCT
AGGAGGACTCCATATATAGGTGTATATGGGTCTGTGGATATACTTATTTGGAGAGAGCCT
GCTGGCTTCGTGGTTGGCAGTTGGAACACAGCAGGAGCTTTACAGGAGAAAGGGGGCAGT
CAGCCTCTATATTTACCTATGTGGAAGCTGTATGGGATTGTTACACACCGTGCCTTACAG
GTTCACTATGAGTCAAAACCAAGGCTATATGATATATATGCATTAATTTTAAAATAAAAA
TTGGATTATCTCTGCCACCCACACATGTGTTAAGCAGATGATCCTGCCCTCTAACTTGAT
AATTAAGTCAAAACCAATAAGCAAGCTCTCTTGTATGGAATTCCAGTCACCTTCGAGCCC
CCTCTAACTAGGGTGACCCCGGATGCATCGGAGTAAAACTGCTTCGTCCTGTAAGATGGT
CGAGCGGCAGCATATGACCTCCAACTTCCCCGAGGGGAAGTAAAATCAAACTCCACATCA
GCTCAAGGCTGATTCCTTTGAGAGAGTAGCCAGACATAGTGTTACCCCTCTGATCTCCTC
CTATCAATTCTGACCCCAAACATCCATCCCTCGCAGGGCCCTCCACAACTCTGCTGGGTT
TGGAAGTTCATTCCAATGGCCACCCAGAACTCAGACCATACAATTCATGCAGTTTAATTA
GGGAAATTAGCTAGTTACACTTCAGCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCT
CTGGTGTCACAGCTTTCTGTCTCACAGCTTGAGATGATTCAACCCAAAGGGCTCTTGTGG
TACACAAAACCGCTGACTCCACTACCTGTTCTTTCTTGGTGGTAGTTAGATCCCTCTTCT
TGTTTCTGAGATCTTATACCCAGCAGGATGGCTAAATTGACCAGTCCCCACAATAGATTT
CTTATCTTGCTCCATTAATTGTGTATCTGCTTCAAATGCTCCCCAGTGGGAATTCCCATC
ATGAAGTACCTCCTGGCTGGTGTGAATAGAACAGCCTTGTTTCTGCCTTTTTAAGATTGG
GGGAGCAGCAGAAGTTTCCTTTGGTCCATCCAGTCTCCTGTAGTGCTGGGAGTTACAGCC
TGTGTAACAACTCTTTCAGTGTGCTATATGCATCCCATTTCGTAGTAACCGACTTGCAGT
CTCTAGCCTGCCTGGGGTAAGCACTTTCCCAGGTACCTCCTCTTCTATGAATGCATTCTC
CTATGAATGATCCTTATGTTGCTGTCCCTGTCAAACCCATACAGGAAAGCCATGCCACAA
ATCCGACAAGGCTTCTTAAATGGTTGCTTTGCTTACATACACCTTACTCGTGGGATGCTG
GAATAAATAGCCAGATCAAATAATTCACGGCACCATCATGTGACTTATAATGGCTGATTG
TTTTGGAACTAGTTTGCCCACCTTTTCTTCCAAGGTGCTTCTAGGTGAACTCAGACCGCT
GGCATTTTGGTTAGCAGCCAAGCACACTCACCTTTGTACCACCCAGGGATCCCTTGTATG
AGATACTTGAGGGCCCTTAAGATAGAGCACTTGCTGAGGTGGCAAAAGTAGGTGAAGTTT
AACCTTCCTAATGTTGGATCATCCGGGTGGTGTTGATCACTGTTGGGGGAGGGGGGGCAT
TGAAAGCAGGTCCTCAGCTGGTGTAGGAAGAGTTCAGTAATGGCCATCACAACTTGGTGC
CTGTATGAGTCTCGCCAAGAACATCGCTCTTCACACACCTTCCTTAAAGTTTCAGGAGCT
AGATGGGTGTGGTGGGGGCGGGCATTTAATTGCAAGGTTGGGGTGGGCAGCACCCCTTCA
AAGTGGCAAAGGTCAATCAGTATCTTGAGCAAGCACAGCTCTTTGTTTCCCTCGAGATCA
ACCGCCATCGGAGCCTTGGTTGCTGTGCAATGCAGCCCATTTAACACAACAGTGTTGAGC
GGTTTGAAGCCCTGTTTTAAAAGGGATGGCTCTGGAAACTCCAAACTTACTGTCCTCCAG
TTGATTCCAACTCATAGCGACCCCCATAAGACAGGGTNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTC
CTTGTATCTTTCTCGTCTTACCAGAAATGTTGAAGGCATTATAGAAGACAAATTTATTTT
AGTGGGCAAAAAAGCCTGATCATTTTTGCTGCTGATATTTTTTAATCACTACTGCGTTGA
TCAATGCTTTGAGCCAGTTTGGTTATGGCTGACAAAGTGGAATTGAAGCAGACCTGGATT
TTTGAAATTTGGGTAATAACTGGAAGGGGGAATATTTTGGAGGGAAGATCTGAAATGGGT
GACGGGAAGGGGCCTAGTTAGCCTAAAGTTAGCTGCAGAGACTGAGACCCATAGTGGAGG
GCCATCGTTGAGCAGGCCATGCCACTTTTGACTCGGCGGTGCAAGGTGCACACTACCCTT
GATTTCTAAGAGGAATGTTACCTGCCTGCTGGGTGTCTCCTGGTATCGTTCTATTCCAGG
GATCATTCTGGTTCACCCAGCCCCAATTTTTAAAATCCAGGTCTGGTTTGGTTTCACTCC
CACAGCCATAACTGAACTGGAAGGAACCAGTTCAAAGTCCTAGTTTTGATGCAAAGCTTA
AGAGCGAAGAAGAGCAACTCCAAGGAAATAGTGCGCTCGCCATTGTTCCCACTGTCAGTC
ATTGGCGGACTTTGAGCAAATTAAGCCTCCATTTGTGATGTTCGGTTTTAGATACTTTCC
TGAAACTGATTTATATATAACTGTGTCAGACCACGTGGAATTTGATATGGTGCTTTAATG
TAGGAATATGAATTTCTCCCTTGAAGTTTTATGCTTTATTTTGGGGGAAAGGTAGTTCTG
GAGGAGAACTCAGAAAATCGCTACCAGCTTTGAAAAAAGATGAAACCAGTTGGCATCAGA
GATAAAATCTGAAAGCATTTCTACATTTGTGGCTAACTTTTTTAAAAAAAAGAAAGAAAA
GGCGGAGGGGGAGGGGGATCTGCTTGATTCTGTTGGTGTTGCCACAAGTCACGCTGTGAT
CTTGTGAGATGGGATCTACGGGTAACTCGGTTTCATTCACTCAGATATTTTTAGATAAGA
TACTTTGAGTTAAACATTAGCTTTTTGGTTCTCAAGAAAAACATTATGTTCAGTAGTTCC
TTCCCCACCCCCCTTTTTTTTCAAATAGTCCAGGATCTTTAACCTTCCCTTTCCTGTTTT
GTCTTGAAGGTCGACTGAGCTACCCACATCCAGGGACGGACAGTCTGTTGATGTTAAATG
GTACGTTTTGGAAAAACATTTTATGCGTTCAATTGATTCCATACAGATGTCTGAATGCAT
GCTTCCATAACACTCCCACAATGAGTCATTTTGTAAATGTAAAATAAAACTACCCTACTC
GGACACAGAAAGAAGAATTAGGGGTCTGAGTGGACCCTAGTTCCGAATTGTGTGCATGTA
AAGTGGCTATGGTATGTATTTGTAGCATTGCGATTTAATTTAGCCATTCCTGACTAGGCC
TTCTTGCCAAGTCTCGGGGGGCTAAGTGGCCCCTTGGCAAGTAACTTCATTCCCAGGTAC
TCGGTTTCTCCAGATGGCAAGGGGGATTACGGTCTGTGGTGCATTTTGAGGGTTCAGTGG
GCTATTTGCAGCTTGGTAACAGCCTTTTTGTTTCCGCATTAACTAGGACAGACTAGTGAC
TCTAACGATGGTAATCATCTTCACGGGTTGACTCTGAAGCTTTACTAGAATTAGAAAAAA
ATGAAATAAGCTTTCATTGAAGGTTTTCACCACCCCCTTTGCATTGAACACACAGTGTGA
CCTCCCACAGAGAAGGCCAAGACATAACTCATCCATGCGTGTGAGAGTGGGATGGGAGTA
AAATATCCCTGAACGTATTTTTATTCTGAGGGTGCGTGGTGTGAAGGAAGTAGGGCAAGG
AAGGAATATGTTGGACACAGTATTTACCTTAAAAAGCAGTCTCCCCTTAGAACAGCATTT
CAACAAAACCTTTGTTGGAAAGAAGATAGTAGTGAAGATGGGGAAGAAAGGTTGTACGAC
AGATGAAAATAGAGTTCATGCTACCTCAGATGGTCAGGGCTAAGAGGATTTTAGGACTGA
GAAACATAGAAGAAGCAAGCCCTCTCAGTTCAGGGGGTTAAGGCTGCTGTGTATAGAATT
GCCCATGACAGTCCAACCTAGTCTGAGCCTTAAGCCAAGTGGTCACTGAAGCTTGGTGGG
GTTCACTGGGGACGGGTGCCAGGGTGCTGACAGGCAGGGCCAGATGAAGTGCTGTAACTA
ATCAGAGGCCATTCCGAGGCCGTGTTCAGGAGCTCAGCAAATTAGGGTACTCACACCGTT
TTTAAACACAGAGCTACCAGTACTAGGAGTTGTGCCGTGGAAGATTAAAAAGACATTCAT
TTTTTGTGTATTGAACGCTGAATCTGACTAAAAGCTGTGTCAATGACAACAAGCTTAAAG
AGAGTAGCTTATCATATTTAGTAGTCTCCGGGTTTAATTTATAAAATGACGTTATGTTTC
CAAGCCTACTTCTGTGAAGTCGATGCCACTCGCAGTGACCTTGGGTGGGGTTTCCGTCCA
AGACCTTGTTTTCCAGAAGGAGGTAGCCTCAGTTTGGTCCTGTGTGACAGATGGTGGACT
TGAACCACTGCCCTGGCCCAAAAGTTATTTGTATACGAAGGGGGTGTTAAAAAGCCTAGG
GAAAAATTCCATGATATTTTCATTCTATTTCTCCACACATTTTTTTAAGCCCCCCTCATA
GTAATCCTAATTTCCTTAAATACCCGAAAGTCTTACTAGATGACGTGGCAAGTATTATTT
ACCTTTTACAACTTTTAAGTAAGCAATTTAATTGAAAAAAAATTTCTTCAACCATATTTC
AAGGATTTAACAGTACAGTCTTGACACAGCACAGTGGGAAGATGCTCAGCCAGTAACCCA
ATGTCAGAGGTTCAAACCCACCAGCCATTTCATAGAAAGAAATGGCCATGTTCCTCCTGC
TTCCAAAGGCAGCAGCTGGGAAACGGCCCGCGGAGAGGAGCTCCCCTCTGCCCTGCAGGG
CTGCTGTGAGCCAGAATCAATGGCTACAACAGATAAACTCCACCGTGACAGGTTAGCTCG
TGCACAGATGTACTTGGATTTCTAAATGGTCATGAGCCACAATGATCCAGAAGTATGTCA
TCACCATAATTTAAACAAAAGCACTTGGATTATGTGTAGACAAAAACTTAGTAGCCACAC
TGCTTTCACGACCTTTATATTTGTGGCCACAGGAAACATTACGAAAACTGTTGACATGGC
AGTGTTTTATATTTCCACCCAGGGCTGCGTCTTGTGGTTGGTTTTCATTAGACTGGCTGA
GCCACAAGGCACGCTCAGGGCACTGAGCCTCTCAGAAAGCGTGGACTTTGTCTGCGAACG
TCCTTTGAGGAGGAAATAAGGTAATGATAGGAGGACTCTAAACTGAGAAGAGGCAATATT
GATACAAAAAACAAGCAAACCCTATTTACTGTTTGGGATCAGTAGTCTAAGAGGGGAAGT
AAGAGTCAGGAGTTGACATTAAGTGGATGTGGGTTTAAAGCCACCAGTTGTCCTCCAAAA
AATATTTACATTCTCGAACATCTAAAGGGGCAGTTGTACTCTGTCCTGTAGGGTCGGTGT
GAGAAACAACTTGATGTCAGTGGGTTTGGAGAGAGGGTGAGGGAAACGCACCCCCCACAC
ACACACATACAAAGTATCTCACAGAAACTCACCATTAGGTCAGTGGTTACCTTGTCTATT
AAAGCAACAAGCCTAGCTAATAGTGGTGGGTTCTGGAAACTATTATTTATTAAGAGATTA
ATACAGGAGTAATGGTTTAACAGTAGTGAAGACTCTGGAGCTAGGTTATCCGGGTTTAAA
CCCACCTCATTCTCTAACTGTGTAGCTGTGGCCCGCCACCCCCACCCCAACCCCAGTGTA
TCTCACTTTGTGTCTAAAATAATGCTAATGCTAGCGGACGGGTCTCACCTAGGGAACTGT
GAGGGGAGGAGTTCATGTTAAGTATTGAGGACAACTGACAATGACTATGAACTAAGGTGC
CAGGATCGGTGGGTGGTGGTAGTGAAGGCCAAGAGCCTTCTCTCATGAGTGGGAAACGCA
CACTTTGGACACTATAAAGGCACGAGAAGACAAAAACTGTCCTACTCAACAACAAAGGCT
TCCTGCAGAAAGCTCAGCTCGCACCATTTGATGGGTATTACTTACATAGGGGGCAACATT
TGGGTGGGTGAAAGCAAAGTGGCGCGCAGGCAGTGCATCCCAAAGGGTGGCACACATGCC
TGCCTGGTGGCTTTTGGTGGTGTACTCGGTGACATCAAGCCATGCCTGTTACCATCAGAG
ACTGTATCGTAGAAAACGCATACCAGGCAACATAAAAATGTGATGCTACAATGAATCTGG
GTCTGAGTCCATTCACAGGAGGTAGCATACATCGTTACACTGAGAATGGCAACTACTGGA
AGGTTTTGTGTTTCCATTTTGTTGTCTGCCATCAAATAGACGCTAACTCCACCTGTTAAT
TAAGCAATTATGGCTGAGCTTTCCGTTTAGGAGGTAGGAGCAGGGGTGGGCTAAGGAGGA
GGAGGAAGTTGACCAGAGTAGGTGAAAATGCAGAATGCCTCTAGCAAACCCTTAACTCGG
AGCGTCTGTGGATTCACATATTTTTTTAAAAGTAGTGCCATATCAGGCTTGTTTATCTCA
CGAAGTTGTATAGATCTAATTCTAAAATACCAAACAACTGTAATTGCTGATAGACCTACT
TCTGAACAGCTGAGACTTATCTGTACAGGAACAGGAAGCCTCATCTTTCTCCTTTGGAGC
GCCTGGTGGGTTTGAACGGCAAACCTTGCAATTAGCAAGTAGCCCAAGCTGTAACCCTTG
TGCTCCAAGGACTCCCTTCCTGAAGCCAATGAAGGTGGTGGAGATGGATATTATTTAATA
ATCCACATTGTAAACAAGTCCAAATTTAACATCCAGAAGTAGTTTAGGGAAGACACGTTT
TTCATATATAAACAAACAGCCCAGCTACTTAACTACAGTCTGAAGTTAGAACGACATCTT
GGTGCACGGATGCCTAGTGCATTCATCTTACTGCTTTAGCTGTCAGTAGCAACTATTGGG
GAGAAATCTCTCGTGGTAAAGAACTGTACAGAGGGATACATCATTCAAGTATTTGTCTGG
GTTTCGATGGCATTGTAAGCTGTCTTCCACCCCCACTCTTAAGGGCAAACGTTTTCAGCA
CTTATAATTTTCCTAAGGAATAGAGCAGAAGTCCAGGGGTGGCATTAGCAAGTTTGTTGG
AAATTACCTTCCCCTTGATTACCCACACAGAGCTCTGTGGGTGATGTGTTTGGAGGAAAG
ACACTGTATTTTTGACAAGGGCATGGTGTTTCTAGAGGCAGAGTTCGTACTACACTATTG
AGTCATGGGAACAGTGAAGGTGACATTGTCCTCATTTCCTTTGTATGTAAATGACAGTGA
GGGGCATAGATAGTCGGAGCTGTTTTTCTCTGGACGGTGAGGACTGGGACCCCAGAACCA
AGTTGTGAAAGTGCAGGCGGAGGGAGGGTCTCTTCAGGCTTTGTCTAGCACCTACCCATT
ATTAGCTTCTATAAACCTGGTGTTTGTCTTAAAGGAGCCAATCCCGTTTCTTGTTTATTT
GTTTAAAATCAGTGTGCTTTTCTAACCAGTCTATGAAATATGTGTGCCTGATAGTTAAAA
GTTGTACACAGAATATCTAGGAAACCAAGTTGCCCACTGTTTTTTCCTGAAAGGATGCAG
AGAGGAAAAACAAAGCAGGCCACAGTGGGCGTGGTCCCTTCCCTCATTGTTTGCTCTCAG
AGGGTTTGTTTCTTGTAAATTGCAAGTCAGAGTTGGGGTGAAGAGCACTCCTAATTTTAA
CCCAGTTTAGAAGCCCCAGGTGGGAAGGTGAGCACAGGAGCCATTGTTGGCTGTGACTGC
CGGCATGATGGGCACAGGAAATGGGTCACATAATCTAGCTGCTTCCGCACTGGGCTGTTT
TTGGTAGCGGAGTAGTGCCTTGGGATCTGAGCACCATCCGAAAAATAAGTGGAAGAGCTC
TGTAGAGGATTAAAAAATTACTCAGGAATGAGGTGCTTGGATTAAGTTTCGGAATAATAA
TGCCCAGGCCTAGGAAAGAGAGGAAAGCTGCTGTGAACGTTTGTATACCTTTTACTACCT
AATTTTAATATTGAGCAGGATCAGCCAGAGTATAGCAGCTGTGGGCATGAATTGGTTATA
ATGTCATGCATTTCCTGGGTGGCTCTAGAGTTGTGTGCCCCATTGTGACTTCATTATCGT
TCACAATGTGGTTGTAAACTTGATGAGACGTTTCAGGTGCTTTATCCATCTTGGATAAAA
TTCCCCGAAAGAAGTTTACAGATAGCCCACCCCCAGCCCCCTGGGGGTGAACAGGAAGCT
CAGCCCCTGGGACAGTTGGGCTTTGTGATGCTCAGGGAGCTTCTTGACCTTCTCCAGGTC
TACTGCGACCCTGAGAAAGCAGGCACCTCACTAACTTAGGCTGTCTTCTGTGTCTTTCCC
CTTGATCAGCCAGATTTTCCACAAATGATCTCCCATCTCTTAGAGACCCTTTGGCCTATT
AAGTTCAGAAGACACCTCATTAATGGTTCCTTGTACCCCCACCCTCACCCCAAACTATAC
CTAAGCCAGGTAAACTCTGAAAGAAATCTGTCAGGCTTTGAGGTTCACAGAACTTGCTGC
CATGGATTCGGTCACTAAATGGAGTTCGGTTAGTTTAGGTGCAAGCTTGCAGGGGAGTGT
CTGTAGGTATGCTTTATATTTGGCTGATGTCTTAGCAGTAACTTAGCAGGCAATAGGAGT
AGATGTGTTGGCCCTTTCTCACAGTCAATGCAGGATTAATCAATAACATTTCTTTTTGTC
TCCCAGACCTAAAAATGAGCCTTTATATAGTCAGTTTTTTGGTTTATCTTCATTTCATAG
ATGACTTTTGGTAAAATGTTCATTTTTATACCCAGATTTTGGGGAGAAGAGTTAATAAAA
CAAAACACCTCTTGGATCATATCAAACTGGCAGTGGCATATTATAAGGAGATTGCAGTAT
ATTTTCCTTTGTAAGGAAATGGGTAAACTGCTAGTAACGGATTGAAATGCCATTGTACTT
TATTATTTCTACAGTATGTGCTCTATATTTTACTGAGATGGTACTAAGCAAGATTTGTAT
TTGAATCACTCTTCTGCCACAAGTAGAGATGTAAAACACTCAGTAGATAACTTAGGAAGC
ATACCAGGCCCGTGGAAAGCCGTACTCTATTATTTATCATTTTGTCAACTAAGCAAGTTT
GAATGGACTGATTTGGGTCCGGAGTGGGGCAGGCATCCTATTTAAGTTGTCTTGGAAGCT
TTGAGCATCAGCTAATAATATTCTATCTTCTTACTCTGCTCAGTCTTCAGTATTTCTTCC
AGGCAACAGCTTGATATATGTAGATAGGATCTGAATAGATATTTGTTGGATTATATATGC
CATATAACTCTACAAGAAGTAGAAAAATGGGAATTATATTCAGTTTGTGTCCATTCACTT
GTCAAATTACTTGAAACGCTGTTTAACTGTAAAGTCTTACATATTCCTAGTCTGATAATA
TGAGCAAGTTTTTGGATGATGTTTTTTGAAACCTAATTGAGATTAAATCCACTTTAAATG
TATTATTGATCTCAGAATCCAGATGATGAATTACATATAATACAACTGCTTTGTAAACGG
TAAGGCAGTCTGCAAATGTGGAGTTACATTCTTGTCGTAACTCTTAGAACAAAGTAGCAG
TAATTCCCAGATGCCCACGTAGCTTTTCGTATCGCAGATACTTGAACCTGTGGGCTGATT
TTCTTGGTTCTGACATCTTACAATGTGTCCTTTGTTTACATGCAGCAAGGAGTTATGGGC
GAAGACGAGGTAATTTACTTCTGCTTGCTATGCTATAACTGCTTCTAATTGGGCCTTTAC
TGATCAATGGTATAATTAATTTTTCCAGATTTACTACACAAAATCTGAAAATTCACAGAA
TTACATATTGATTTTGAGCACTTACATGTTACTGATTTGAATCTTAAATCTCTTTAACTT
TGTTAACATGTTAGTACTAATGGTTTTACTGTTTTACTTTGAAAGTATTCAGATTTTTAA
CTGTTTTGAAACTAATTACTGTACTTTTTAAAAACAAAGTTGCTGTTGACAACTTACCCA
CTCGGGAAATAGCATTCCAAGAACAGCATTGAGGGCCATGTTCGCTCTGATTGTCATACG
GTCTGTAACTATGCTTTTTTTTGGACTTACCTTTGGTATGTAATTTATAATTACAGATTG
CTACTTTTCATTTTGGACCAGTGGAGAATACCAAATAGATTATTGTTGGCCCAGACTTAC
AGAGCTCATGTTTAGAATATTTCTCAGTGTCTTATAAGAATGTAATTGTTGTCTGTCTCA
CATGCCACACATCCTGGTACACTCTGCTCCCATCTCCTCTACACACACCCCCTGGGGGGA
GGGGCGGGGCGAGGCAACTGCTTAGAACCCTAATGGGAAAATCAGGGACTGTGTGATTTC
AGACTGTTACTAGATTTCTCAAGAAAACATCTGTCACTTCTTTGTGGCTTAAAAATTTAC
CTCTCCTTTCCCTTTTATAGACATTGAGAGGGCGAGGGTGGATGGGATGAGAGGAAGCAA
AAGTGACTTCACACAACTACACGATCCTCCCTCTACCTGTGCAATAACCCTGCTTCCATC
ATGCTGCGGTGGGAAGAGGCACTATCCTTTGTTTACATGTGTTGAATGACAAGGCTTCTC
TTTGACAAGTGAAAATCGCCCTTGAACCTAGGGAAGATAAGCAAACCCGCAGCCATTGCA
TCAGTTCTGACTCATAACAGCCCTTCGGGACAGTAGAGCTGCCCCCCAGGATTTCCAAGG
CTGTATATCTTCGCAGAAGCAAACTGTCACATAATTTCCCCATGGGCTGGCTAGTGGGTT
CAAAGCCCAACCTTTGTTTAGCAGTCAAATGCTTAACTGCTACAACACCAAGGTCCTGCC
CGGTAGCCCATGGAAGATGGGCAAAGTAACAGTGCCCTTCGGTGCTTGTGTACTGACCAC
AGGGTAAATGTTGGACTGCAGAACACAGGGTCAGCGGTTGCAGCCCATCATATGAGTTAG
TCGGTGTTGGCAAAGACATAAAGCTGGTAGTTGGAATCACCTTGCTGGTAACTTTAGTCA
AGAGTGTGTGTTCTTTGGGGGATAGGGGGGAAACAAGTAAAATGATTTGCCACTTACTGA
CTATAGAAATTACTATTTCATATGCTTTTGTGGTCTTTCTAGTTTTCTGTTTCAGATCAG
AGGGATTTAACATCATGATCATCCAGCACTTTGATGAATCTCTTGGTTGGTCCTTTGGTT
TTCTAACTAGAACTCTCTCACTCCCTTTTTTTTTTTAGCCTTGTGTACATACTTTTCATC
TTTTAATTTCAGTGATTTATGAAAAAGTCTAATTTAAACCCAGTATAAATATGATAAAAG
GAGTTCTTGGGATCAAGACATTAAACATGCGGCTGCTGTGTATCTTCCCTTCTCTCCATT
TAATCGTGGTAGACGACATGTAAGCGGTTATGAAAAACAAAATGGTCTTGCCCTGCTTTC
AGTTGGTAGCCTGTGTCCTGGTCCTGGGCGGTTTGGAGAGCCCCTTTCCTGGGCACCAGC
GTTGGGAATGGAGGGAGGCCTGCCACGTGGTTTACGGTGGCTCCCTGAGGGACAGAACAG
ACATTGCCTGGTTAGTGGCACAGGGCTTCTAACAATAGCTGGATTTTCTGGTGGTATGTA
GCATGCATGGTCTTTCTATCCACTCCTCTGGTGATATTTGGAGTCTACTTTTAGATTTTG
GACTTTGATAGATGAAATCTAAATCCATTAGGAATGGCTACTGAAAGATTTTGTTTCAAT
TTGGAAGTAATTTTAACACTCCACATAACAAACCCCAACAAGTGACTGAGTCAACGTAGG
TTCGTAGCCACCCTATAGGGCACCCTTTACACCAGAGGAAAGCTGCCCAATAGGCTTTCC
AGGCTTGGAGCAAATAACCCGAGAACCTGGGTTCTGGGACGAAGACTGCGATACCAGGTT
GGAGGAAAGCTTAAGAACCTTTGGTATTCAGATGACACACCTTAGTAATGACAGTGAGGG
GACTTGAAGCACCCGCTGATGAAGGTCAAGGTTTGCAGTCTTGCGTATGGAGTACATCTC
AATGTAAACAAGACCCAGATCCTCACAACTGGACCATTAGGTAGCATCATGCCAGAATGG
AGAAAACCTGAGAATTTCATCTTGCTTAGATCCACAGTCGATGCCCATGAAAGCCGCAGT
CTGTAATCAAACCCCAGATTACATTGGGTAAATCTGATGTACAAGATCTTCTTAGAGCAT
TGAAAAGCAAGGATATTACCTTGAGGACTAAGGTGTGCCTGACCACCCAAGCCATGGTAT
TTTCAGTGGCCTCGTAAGCATGTGAAAGTTGGGCATTGAATAGGATGACTAAAGAATGAA
TGTGTTTAGATTATGGTGCTGGAGAAGAAATTGAAAATACCACAGATTGCCAAAAGACAA
ACATCCGTCTTGATAGAAAAAGTATAGCCAGACTGCTCCTTAGAGGTAAGGATCGTGAGG
CTTCTTCTCATGTACTTCAAACATGTTATCAGGAGAGACCAGCCCCTGGAGGAATTCATG
TGTAAAAGGAAGGCCTTGGAGGAGAGAGCGGGGCTTCACCAGTGGGCTCACACAGGGGAA
AGATTGTGAGAATGACGCACAGGACTGGGCAGTGTTTTGCTTTGTTGTACATTGGGTCAC
TATGAGTGGGAACCAGCTCGGTGGCACCTGACAACAGTAACAACGACAAATCTCTATGGA
AGCCGATAATCACATCTTCCTCCCACAGAGCACAGGTACAGTCAAACCACCAGCCCTTTG
GTTAGCAGCTGAGTGCTTAACCACTGACCAAGATCACTTTCAAAGGGACAACCTTTTATA
AGATTTTTAAAAAAAGAAACATTTGGTTCATAAAAGGAACTGCATTTATTCATTTAGTCT
AGTTAGTGCATTTATTCATTTAAAAACACTACTACTGTCTGCATGGGTTTGGATTTATGG
CAGGTCCGATCCCATGGGCCTCTCATTGTGTCCCATGCCAAAGCAAATTGTAACCCCGAA
CCACTGCCTGGCTTTACCCCCATGGACTTCAGGCACTGAAGCGGGTTACACAGTGAAAAA
AAATGAAGTGAAAACACTGCTACTGAGCATATCAGATATTCTCCTGTGGCCGTGTTAAAA
CACAGAGCTGATAAAATGATTGCCAAAAATAAAACACGGCCTTGAACTGATGCAGCCAAG
CCATTTGCTCCTGTGTCTACTGAAGGGGACTGCTTTCCTTCTTCCTTACCCTTTGGCTAC
CTTTCTGCCCAGGTGTAGAGTTGAGTCCATGTCTTGGTGTAAAAGAACTTCCCCCTTGAC
TGGGGAGGGGGGGGGTACCCAAAAAAAGTATTACAAAGTAACTATATTTTAATGTCCTTA
CTAATGTCAATAAGAGCTTGGAATCAAGATGGGTGTAAATATTAATTTAGGAGATTGTGT
TTTCTTATTAATACAAAACTGAGTTATGCTGAGGAAAAGCAAACATTTGTTGTCCTGAAC
CCCTAGCCTCTGGGAAGGGTTCCTGGCAGCACCATGATTGAGTAGTTGGCCCCAAAGTGA
ACGATGTGAGATTTGAACCCACGGTGGCCGCATCACAGGAGAAAGATGAGGCTGTGCAGG
TCGTAGAGCAGCCAGCCTTGGAAACCTGCTGGGGCACTTCTACTCTGTCACGTGTGGGCA
CCCTGTGCCGGGAGCCCAGCTGGAGCCACAAGCTTGGAGACTGGATGAAGAAGAAGAGGA
CTGGCCCTTGGAAAACTGACTGTTCCACGTGGTCGCTGTCGTTCCTGCCTTTCTGGGAGT
GGCCTTGCTGGTCTGTGGTTGGAGTTAGATGGGGTTTATGAAGGGAAGTGGGAAGTAAAA
CTTCTCAAAAGGTTTCTACATGGCAGTCTGTTCCCTTAATATTTAAAGGACTGCTGGGCT
CCAGAAGAATTATCCATACGTGAAAACAAAGCAAGAAGCACCATCATGGTCAACTCCAAC
GTATCGGGAGCCTATAGGTTAGGGGTAGTACTGTTCCCTCTGGTTTCCCAGACTGGGAAT
CTTCACTGACCCGGCACGCTCTTTCTCCCATGGAGTGACAGGTTTGAAATGCTTGCCAAC
CTTGCTGTCCACTGTAGCACCAGAGCTCCAGAAATATACCAGGAAGCTTCCAATAGTTTG
TGGAGAATGGAATGAAAAGATTCCTGGAGTTTTTCATGATCTTTTTGAAACTCCCTGGTA
CTAGACTGTTTTTAATGAAAAAGAAATTTTTCAGTTAATAGCAATGAGTACTAAAAAGGA
ACATTTTCGTAAACAGGAAAGTCAGAAATTTGTGTTAGTGGATTAAGTATAGACTAAGGA
GGATAAGAAAAATAATCTTGAATATGAGAGAAGTAGGAGGTTGCATGGATTATCAGGTAG
CGATTCAGACCACATTTAGTAGTAATATAACATTCTGCATTGCTCTATAGTGGTCCCTGG
ATTTTCTGATTTTATGTAGATATTATTTCACCTCACTTACCATATATACTCATGTATAAG
CCGAGTTTTGCAGCACACTTTTTATGTAGTTTTTGTGGTAAAATTCGGTGCCTCGGCTGA
TATTTGGGTCGGCTTATATTCGAGTATATACGATAACTCATGATCTTGTGACGCATCCAG
AGTAAGTATGTAGGAATTTGAACACACAGAGTATGACCATTTTTCTGCAATTTACCAGGC
TGTACAGAGAGCCTTTTGAAAGTTGCTGTTTTTGCATAAGGGACTATCATCTATCTGGGT
ACTTTTCCATTTCTTCCCCGCACCCCATGCTCTTCTGCCTAAAAATATACCCCATTGTTC
ATAGCCGTATTTTCTATTTGTAACTTTGGTTATTGCAAACTTTAATTTACCTTATTAGTT
GTGTTTGTTTATGAATATGCATGGTTTTGTATGTACATTGTGCATTATCCATCTACTGTA
TATTTACACATAGGTAAATGTTCATGTCAACACATTTTTAACTAGGATTCCTGAAATAGC
ATTTTTTGTGGAACAATCAGCTCTTCCTTGTTGCCTTGAACAGAATCAAGAACTTTGAGT
TGAATTTACCTTGTAACAAATATCCAGAACCTACAAATTGTTTAATTTCTAATTCTTGAG
GGAAGAGCCTTAAGAACACCACATTCGCACTTTTAAAAGAAGAAAGATCTCTAAAATTGC
CTGTCATTGCTTTTAAATATTGATAATTTGTAAGACTACTTATACAGCAATTATAAAGGA
GGAAAAATATCAGTAATTTTATTATGTATATTGGTGAACACAACTTCATTGTGTGACTAT
TACCACAATGTGTACCTCAATTTTTCTATTAATATATTTTTTGGTTATTTACCTTTTGAG
GGATATTATTAATATAGTGCACATTCTTGTGCTCTCATTCTTTAGACATAAACACTCATT
TTTATTGGATGATACATTCCTAAGAATAGAATGACTAGTTCACAGACTTAGTATAGACTT
CATTTGAAATGGGGAAATCATTTTTCAGTTTTATATTCCAACAGATTTTGAAACTGAGAT
TGACTTTAGACTGTTGGCGCTTTAATTTCACCTGTTCTGATAAGTGCTATCGTAGCGCAT
TTCTAAATTGAATTTTCCTTTTGGGAATTATATTGGCATATAATTCATATATATTAATTC
AGTAGTTCAGTCACATAAAGGAGAGTTGTACAGTCATCACCCCATTCAGTTTTAGAACGT
TTTTTTCAATCTTGTACTCATTTGTACTAGCTCCTCCTTTTTCCCACAACCTCCCCTTTC
ATATCCCCAAGGAACCAGTTATAATCTATGAGACATTTACTGGTCTTTAGAGAACAGTTA
CAGTCTACATAGACCGTTACTGCCTTGTGTTCATTTTCAGAACAATATTAAAAACAAAAT
AAAAATATTAACAAAGTAAAACAGATAAAAAAACTTCAATAGAAAAGAAAGCATTAGATA
TTTAAAACCTGGAACAAATATAAATGGTCATATGGAAAATCAAATGATACCATGCTAAAT
TTTAACCTTACCTGCCACAATCCACTTTCCAATCGATGCTGCCTAAAAAGCAAGGCTGTT
CACATCCCTGGTCTCTAGTCAGAGGGGATTCACCAGAGGCTTCGTGTATTTCCATTTCAT
GGTTTTTTTGTTTTGTTTTGTTTTTTAAAGAAACAACATTAAAATGGGACAAAGTGGGTA
TCAAATGATACAGTATTACATTTTAACCTAACTATGTCTGCCAACAAGGCTATTCACGTC
CCTTTACTGTGATCAGAGGGGATTCCCCAGAAGTTTAAACCCTATGTAGACCCAGCCAGT
GGATTTGGGGGGGTTACCACTGTCATCCATAACCCACTATAAAACAGGTATTCTCAATTT
AAGCTCTGATGCCACTCTTGCCTTTAGATTTGGATTATATTATTTACAATCTTTGGACCA
CACAAGCTAGTGTGCTCCTTCCACATGGCCTTAGTTGACAAGCCATTAATAAGCCATTAA
GATCCCAGGTGTTATTCTTTCTGATAGCCAGGCATCATTCTTCACCACACTTTAATAATA
GCATGCTTAGCTTCAGTGATCTCTTCATGAGGGTGAGCATCAAGTAGGGCCATGTCATAG
AAACGAATTGTTCTTAGATTGGGCCCGGAATTAAGTACCCCTTATTTCTCTGGCTCATCC
TAGAGCCTAATTGTCATTTTGTTACAGAACATTATCAGCCATCCCCTTAATGACGTAAGA
ATGATGTTTTCATGCGCTTTTAAACCTTTTCGGTAACACTTGGGAGTTCCACTCTTTACC
TTGTTAGTAAACTTTTAAAATTAACCATTGTGTGATGTGAGGGTTAGGGATCAGGGGGCC
TTCCCCCCCCCCCCCCCACACACACACACACCCCTTCCTTACAACTGGATAGGATTTTAT
GGTATTTCTATGTTAATTATATGGATAGATGTTTAAAATGCTAATCAAACCCGAATTACT
GAGATAAACTAAAGTCATAGTATTATTTTCCTCCCATGTATTTCTGGATTCATGCTGCCA
GTATTTTTTCTAAAGGATTTTTGCATTTCAGTTGATGGGGGACATCACTACATAATTTTC
ATGTCCTATGCTTTTCTTGTCAGGTTCAGGTAGTAAGCAAGTTGGGAAGAATCCCCTTCT
GATCAGATTGGTGGTATTCTTCAGAAGTTTGCTCCAGTCACCAGTGAGGCTGTCTCTCTA
GGCCTGGGTAGTTCTTTGTAGAAAATGTTATTTATTTGCCTTGAGTTATTTAAATTTATA
GAATCAATTTCCTTAATAGAGCTCTTGAGCTTCTCCCAGTTTGCGCCTCTTGTGTAATGT
TTTGCAAGGGATTTGTTTTCTTTTTTCTCGGAATTGTTCTCTAGTCCCCCCTCTTCACAC
CTAGCACTGTCCTGAAGGTTTTCTTTGTTTTCATGAGGCTTGTTAAGGTTTATCAGAAGT
TCACAAAGAACCAAATTTTGCCTTTTCTGGTTTTCTTTATTGTTTCTCTATCTAGTTTTT
CAGGATTTTTTTTTTTGTCTTGCTTTTTTCCCCCATTAAATTTGGCTTCTCTTTCTGAGT
CGAGATAAGTGAAAAATTGTCTTTTGGCTTCCTCTTTTTTAACCTAGTGAAAAATAGAAA
TATTTATTGGTGCCTGACAGTTCTGAAAAGACATTTTGCCTGTAATTTTCCAGATGAAAT
TTGAAGATGCAGTTAAAGGCATCACGGAACAGCTTTAGCTTCTGTCATTGATCCCAGCTC
GTTATTTCCTTTGCACTTCTATTTGTATATCATTTGCTATTTTTCTAGTTTTGAGGTAGA
AATTAGATACCATATATACTCAAGTATAAGTCGACCTGAATATCAGCTGAGGCACCTAAT
TTTACCACAAAAGCGGTATTAAAAATGTGCTAAAAAAAACTTGGCTTATACACGAGTGTA
GACGGTAATTAATTTTATATATATATATATATATATGGGTTTGAATATTCGTTTAAAACT
ATAAAATGCTCTCCAAATGTGGCTTCACATGCACCTGTCTATTTTGTGTTGTTTCCTTTC
TCATTCCATTTAATGATAGACCTGTGAACCTGAATTTAACCTTGTTTTGGAGGGCGGGAA
AAGGAGGCAATCTAATGTCTGGTTGGAAACCATTGCAGGAATTGCAGTCCAGATCATTTC
ATAATCAAAAGGCACTTCTCCGCAGTCTACGAGAGGCCTGGGCACGGTGGCTGGCGCAGA
GGTTTTGGATGTAGCAGCGATTGTGAGAATGGCGCAGGGCCGGCAGTATCTCGTCTGTTG
TCACTCCGAATCAAAACCCAGCAGAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNATTCAAGACTTGGATTTTAGGCTTTCTGTCAACAATGAGCTGCCCA
TTTGACTTATAGAGTGTAGTGTCCCAGAGAATTCTCCCTCAAAGCAGAGCAAGAAATTGT
GGCAAAACGAATTAAAAAAGCTCAAAAAGTTTAGCCCTCACAAACCTCTTCTGGAAGGAA
TTACTTAACGATGCAACACAAACACAAGGAATAATAATAAAGCATCAAAGAAACCAGAAG
GGGTTGGAAACCGTGTTTCTTGGGCAAAAATACCAGCATATTATACATATAGGATATGCA
TTGTTGTTTTCCATTGAGTCGGCTTGGACCCTATGCACAAGAAGGAAACCCCATACAGTC
GTGCACCATGCTCACAACTGTCCTTATGCCTGAGCCCATGTGTCCATCCATCTCATAGAG
GACATATAATGGGGAAAACATTAGGAAATGTGACTCGAAGATTACAATTGAGATGTCATT
ACTAATAGAGATGTAATTTCAAACAACAGCACTAATGCTAAAATCCAAAGTGATTTACAC
AAAACAAAGCAAAATCTGGAAGAGAAGTTGTGAGGATGACAGGTCTTAAAATGTCAAAAC
TCAAATTCATGAACAAAATTAAAAGTGTGCCCCACTCCCTTCTCATCCTCGATTGCAACT
CGGGACCCACACCACAGCATTCACTCACCCCCTCTCTAAATTGCCCATGAACATTTTTCA
TCTTCTAGTTTCAAACTCAGTGACCTCTGGAAAAGGATCAAGGCTGTGTTTTCTAATACA
GCCCTGCCCGCACCTAGCATCTGTAAATTCGTTTGAATGCCTAATTGAGTGCCTGATTCA
TAACCCTGATAAGTTGTTCTTAGAAGCCATCAAGTCATCTCTGACCCATAGCAACCCTGT
GCACAAGAAAATGCAACACTGCCTGGTCCTGAGCCATCCTCCCTCACCATCCTTGACTTT
AAGAAGCATTCTGGCTGTACTTCTGCCAAGGCAGATTTGTGTACCATTTGGGCAGCCCAT
GGACCTTTCAATAATCTCTGCCAGCCCCATAATTCAGATGCATTTATTCTTCAGTATTTT
TTATTCAGCTTTCACATGCATTTGAGGTGATTGAAAGTACTGTGGACTGGGTCAGGTGCA
CCTTAGTCCACAAAGTAACCTCCTTGCTGTTCAACACTGTAAAGAGGTCTTGTGCAGCAG
ATTTATCCAATGAGTGCTTCATTTGATCTCTTGAGTGCTGCTTCCATGAGCACTGATTGT
GGATTCAAGCAACAGAAAATCCTTGACAACTTCAATCAAAAAATTATCAGTTGACTCAGT
TGTAAATATTCAGTTTACAACCCTGAGCCCTCATAAAAAAATGGGTTATGAGTTTTGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTACCTAGTTTCACTCTGGGC
TTTCAGAAATGTTTCTTTTACTAGCTAATCTTATTCTTTGGCCTCCAAAATACAAACTCT
GAAGCACTTTGGCATCTTCTTGATGGCTGTACAGATCTGTGTTCAGATCTTTTGCTCTTC
TATAAGATCCATGACTGGAGAGGCAGCAAACTATCTTAGTAGGTTCTATTTTTTCCATCC
CTGCTGAATTCAGCATTAGGAATGCCCGCGAGTGTTTTACTGGGATGTGTGCAAATGAGG
ACGACCCCAGCACTCAAGAGCTGGAGGGGATGCCCCTCTTTTCCACGGTGCTCATGTGCA
GAAACCCTGCCTACCCCTTTATATAAGCTGGCACACCTTGTTAACAAATTAAGACCGCGT
GTCTGCAAATATTCCTTTTTGCCTTTGCCCACTTAGTCCCGTCTACACGTGGTTTGGGAC
TGTGCCCCCTTACCTGTGCTGCTCATTGCTTTTCTGCCACAGATGTTCATGTTTCTCCTG
TTGCTCAGCGCCCCCTCCCCCCCTTCTGCTGCTGTCAAAAACAACAGAGGTGACCTGGGT
TGTGTGTGTGTGTAGTGTGTGTGTGTGCTTCACTATCACTGTTGCCATGTGACTTGATTT
CTAAATCATATCAGAGTGCTCCTACTCTCTTCAAGATAGGTCACCAACAGTCTGTGCTCT
CTGCATTTCCGCGGTTTCTTGTCCGCCTGTATCACCTCTGTTTTTAGTCCCTGACTTTGC
CAGTGGTGCCCGAATGCCGCACTTTTCCACCTGAGATCACGTGACCCCGTTGCTGTGTTT
TAGGTCGCTCAGAGGTGACCTGGGGTGTGTGTGTGTTTCACTATCACTGTCGCCGTGTGA
CTTGATTTCTAAATCATATCAGAGTGCTCCTACTCTCTTCAAGATTGGCCACCAACAGTC
TGCTCTCTGCATTTCCGCGGCTTCTTGTCCGCCTGTATCACCTGTTTTTAGTCCCGTGAC
TTTGCCAGTGGTGCCCGAATGCCGCGCTTTTCCACCTGAGATCACGTGACCCGTTGCTGT
GTTTTAGGTCGCTCTTCCCTCTTTCCCATCGATGACGGCTTGCTCGACGACGGTCACAGT
GACCAAGTTGGCGTTTTAAATTCACCCACGTGCTACTCAGCCCATCAAAACGGAGAGCGA
ATAGAGCGCTTCTCTCGAAAGGTGTTTGTTGGTGGTCTTCCTCCAGATATTGATGAAGGT
AAATCGGGAGATAGAAAGCTGGAAATAGGAAGGTGGGGGACTTTCAGAAAGTTTGTGGGG
GAAATTCCATTATCTTTAAGTTTGATTTGTCTAATATGTTTTTTACACGCAACCCAACAG
GGATTTTTTCTTGAACTGGGGCTGGGGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGAGTCTTCCAGAATCATAGGAGAAGCCACAATTTTCCTTG
ATCCCCATATCTGATGGTGGGATGTCTTCACAGTTAACAGTGATCTTGGGGTCCAGTGTG
TTTCAACGAGTCTTCCAGAATCCTAGGAGTCTTCCACAAGTCACATGCAATTGGAACAAA
GGGAAAATAGTTCAGATGGAAACTACTGAAGTTGGGTGATTTTTGTGACCTTGTAAAAAA
CTTGCTACTCTTTACAACTAATCCGAGTGAAGAGGGTAGTAAGCCGGGGAGACTAGTGAT
AGAAATCAGTCTAATGCAGTGAAAGAACACCACACATGTAATTAAGACGTGGCTGCCATT
TATTAGACACCAGTCTTGGGAAAGAGCAGAGCTTCACTTGTGAGACCCTCATGAACTCTC
TTTATTGAACCTTGTCAAAACATTGACATGTCTCTCCTGCCAGTGTATATTTATGGTTTT
GTGTGCTGTAAATCCCATTTGTAGTCATATACTCTAACATGACATTTTTAAATTCATCCC
CAAATGATGAATTCTGGCCACCGTGTTCCTAGAAGTTGAATTTGTTTTTGACAAAATTTT
CTTTCTTTGGTTTGCATATGATTTTAATAAAGACACAAGACAGGTTCTCCTTGTTATCAT
CTGGTTTACCTTAGGCAATATTTGGCGCTTAGCAATAGTACATCTTGATAGAAAATTGTT
CAATGCGGCGTTTCTTCAAATTAACCATGAAAACAAATTCCTGAGACCTTTTTGTTGTAC
TTCCTGTAGATGAAATAACAACTAGCTTCAGAAGATTCGGGCCTTTGGTGGTAGACTGGC
CACATAAGGCAGAAAGCAAGTCCTATTTCCCACCAAAAGGTAAGGGGGTTTTATTGTTCC
CAGGTGCCAGGGAATTGGTTGTATAAGGACAAAAGAGAGCCTATCAATTTCTTTTTTTTT
TTTTTTTAACATTTTATTAGGGGCTCATACAACTGTTATCCCAATCCATACACACATCAA
TTGTGTAAAGCGTATTTGTACATCGTTTCTCAAAACGAGTTTTCTCTCCATTTAAACCCC
CGACATTAGGTCTTCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTGTTTATCCCCAATCCATACACACATCCAATCTGTGTAAAGCGTATTTG
TACATCGTTTCTCAAAAACATTTTCTCTCCATTTAAACCCCCCGACATTAGGTCTTCATT
TTTCCCCTCCCTCCTAATTTCTTACTTTTAGAATTGACTAGGGCCTTATCTTTATGTAGG
GTCAAATTACTAATGGGATAATTACTAATGGATAATGAAAAGGCTGGGAACATGTTGAAC
GAGGCAGAATGGTCTTAGGAACGATTAAGAAATCATGAGACACTTGCTGTATTTTCTCTA
CAGTGGCTTGATCGTGATTTCACAGATGCAAATCGACAAATGTTTTGAATATTTTCTCCC
TCTCAAGCATCATTCTAAGTAAACCTGGTTACACAAACATAAAAAAGTGTCCATGTTCAG
TACAACTAGGAGTGAAGTATCTTATTCATAGCAACTTGTAATATAGTTTCAATATTGTAA
GACCTACGTGTTTAGCAGAACTTGAGAAAATGGAAAAAGCACTGCAGTGTGTTCTTTGTC
ATTGAGTTAGGAGTGTAGATTGGGCAGGAAGGGACTCAGTGCTTTTCTTTAACCCCTAAT
TACTTTAAATCCTAAGTAGGATACTTAGTTGTGTTAATGACTTACTGCTGGGCTAATGCT
GTGGCTGACTGCCAGAGACAAAGAACCACAAGTTATGCTAACATTCATCTGAGCACAGCA
AGCACGTGACCAAGCCCAACACCAGCGGGGAGAGGAATTACACCTTGTCCACAAGGGGAG
TAGGGAGCAGAGCTGAAAACCCATTTTCTCTGTCAGAGTAGCTCATGGCAGATTCCTCTG
AAGTGAGTGTGAGAAGAGGAGAGCTTGAGAAACAGACTTTTCTTGGAAGATCATTGGAAC
GTATTTTCTAGAAAAGGTAGAGGCACGCCACCATTTTCCAGAGTGGAGTGAGATATCAAG
ACCCAGGAAAAGACTCCAGAAAATCTGTTAGATGCTCTGATTTGACGGTGGGAAAGGCAA
CATAACAGGTGTGGGGCACCTATGAAAGGAGCTTGACTGGCGCTCCCAGTGAATTGTGGG
AGAAGTGCACTAGCACTTCCATTACTGGTGTCTAGCTCTTTCGAGAAGGAAGCGTGCAGC
ACCGGCGTATGACCCATGTCTTGAGATCTTACCCTGACAAGAGTCTTCAAGAACTTTTTG
AGTAGGGATTCTGAGTCTCAGCCCTCTATTATGAAAACCTAATTAAAGCTTTTCTTTTAA
ACACACACATAATTTTGGGGTTTCCTGGACGTGGAATTCCTTTGAACCCTTGATTTAGAC
AGAAAGTGAACTCAGGGTAAGTAGAGTTACTCACTGCTTAACATGAGTTTATTGCCCAGA
GTCTTACTGTTTATTTTATACAGTTTATTTTGTGTAGCCTTCAATACAAACATGCTAGTT
GGTAATGTTCCTATCCAAGAGATCCTGGTTCCCCCACAGTGGTCCAACCAGTTTGTCCAC
ATCTCTGGCCCTTTGCCTTTTCCCTCAGTGCTGCCAGAGCATCCTCTCCAGAATGCCCTC
CCACGATGCTATCTTACCCCTCACCAGCCTGCTTAAAGCCTGCCTGTGACTTTTCTTCTG
ACTAGCCCATCCAGGTGGCTGGCACAGACAGACCAGCATCCGCTCATCTCCCTGGCTTCG
CCTCTGTGCCTGTGCTCTTTCAGAGCCTCCTCCTGCCCATGCGTTCAGCATTTTCTCAGC
TTGTGAGCTCTGTACCTCAGCTTCATTAGCAAGTTTCACAGGGAGAGCGCTCAGGCTCCT
GCTGAGGTTTCATCTCCCTGTTGTGGGCCCCCATCCTGCCGTTCATCACAGGGATTCTAT
TCTGTTAGTATTGTGACATTGCAAGTCCTGTGATTCTTTTGTCGATGTGGGTGTCATCGA
TGAGACTGTCTTCTACAGTGTTTATTCGCCTTTATATCTCTAACAATTCCCGAATTGTTT
TGATAGTTCCCTGATATGTGATGTAAACAGAAATAAATACAAGATTCAGTGGCTACTTTG
GCCTTAGGGAAAAGCTTCATTGAGAAGAACCAAAAAACTCACTGCCAATGAGTCAATTCC
AACTCACCGTGACTCAGTATGAGAGGGTAGGATCCCCTTCTAAGGTTCTGAGCCGATAAC
TACTTCCTGGAAGTAGAAATCCTCATCTTTCTCCTTAGGAGAAAGCAGCTGGTGGTTTTG
AACTGCTGAGTATGCAATTCGTAGACCAACAGGTGGTGTAGAACTAAATCTTAGAAATTA
CTGTTGTGAGGATCAGTAGGTTTTGCAAGTGGGTCAGTACCTCGGTTCTTGGCTTCGAAC
GAGAAAGAATTCACGCCGAAGCCTGTTTGTAATCCCAACGGATTTTTATGAAGGATGGGA
GAAGTTTCAGGTTATACGGTCTTAAAGGGGTGGGGTGCACACTATTTCAAGGAAGCGTGT
CAAGCAGCGCGGAAGCCATGCTTGGGCCCACAACTGAACACGGGCAACCTCGTGGGACTG
CGCGCCCACACGTGGTGAACTGAGGCCAGAGAGCATGGCCCCATAGGGTGCAGGAGCAGG
GAGAAAAAAGGGGAGAGTCCTCTCTGACCTACCACTGACCAGGAGCCCGGGTAAAAAGAC
CTGCCCTTCCACTGCTGGGGTATTGACTGGGGAGGCACGGGGGAAGGTATTGGTTGACCC
CATTGACTGAATTAAGCCCACCTGGGTCTAGTTGGGCCGCCCAGGTTTAATACCCACCTG
CCTTGGGCCCTGAATTTGAGCATGACCACTTAAGGGGCCTTCGTTGGTGCCTAAGGGTCA
CCTGATTTCCTTCCCAACCTCCTGTAGGGGGTCTGTGCAGGCATGAGAGGGACAATCCCC
AGTCCCTGTCTCAGCTACCTAACACTGAAATAACAGAACCAAATTTAGATCGTATATTTT
CCTTTGTCATTGACATATAAGGATTACCCTATATCATTATTAACAGCTCTGGCGGCCCAG
TAGGTAAAGTATTTGGCGCTAACTACAAAGTCATTGGTTTGAATCCACCCGGTGGTTCCA
TGAGAGAAAAAATGAGACTATCTTGCCCTGTGTAGATTAGCAGTCTTGGAAACCCAGTGG
AGTAGTTGTACTGTGATCAGTAGGATCCCTGTTGGAATCAACTCGATGGCAGTGGGTTGT
CTGGCTGCTTATATGATGACTAACTATAAACGGTTACGTGTTAGAGAAACTCTGAATAGT
ATTTTATATTATCTGTTCATATTTAAAGTTAGTTGTCATGGGGCTGATTTTGAGTCATGA
CAACCCGTGTGTTACAGAGCAAAACCTTCCTGCAGGGTTTTCTTGATGGTGATGGTAGCG
GAAGCAGATCGCCAGGCCTTTTCCAAGGTGCTACTGGGTGGGCTCAAGCAGCCAGTTTCT
TTAGGTTAGCAGTCTAGTGCGAACTATTTACTTTAACTGTAGGTCCTGGTTTACTACCAT
GTTGCTTAATTAAATGTTGGGATAGAAACATTCCTCTCCTCCTGGCAGCGTTCACAATAT
TGGACTTCAGGTAGTATTTAGTGAATTGACCCTACGCCCTCCTCTTTATTCGCGGAAGTC
TCGCCATTCTCTCGAAGGAGCATTCTGCTGTACATCTGCCCAGACAGATTTGTGCCTTCT
TCTGATGGACTGACTGGCTTTTGGTACTTCAAGAATTTTCTTTAAAAAATAAACATGATG
TCTCATAGACTTGTGAAAGCAAATGAAATAATGTGCATAAAACTCTTACCACCTGGTAGG
GGGACTCTAGAAACTAGCTAATTATTGCTTGATTATTTTTGTGTGTGCTCCATCGAATAT
GATAACAAAAGGCAGAAGAGTTGGAGTCCTATTTGATGGTGTGGTGTTATTTTTTTCTCT
CCCCCGCCACCCCCTCCCCCAAAGCATGCATTTGCCGGCCGATCCAGAAATGTAGGGTGA
AACCACTGGCCTTGACATAGTACCTCCTGTTTTCTGGTTGTTGTAGGCTATGCGTTCCTT
CTCTTTCAAGAAGAGAGCTCAGTCCAGGCTCTGATTGATGCTTGCATTGAAGAAGATGGG
AAGCTCTACTTGTGTGTTTCTAGCCCAACCATCAAGGACAAGCCAGTAAGTCAACACCAC
CTGCGTTCCCAGCTACCCACACATCCTCCATACCTGTCTATGCTCATGACTGGAGAAATC
ATCTAACGACCATGACTAAGTTTGGAAACACCTAAGTTTGGTACCTCTACTTAAAAATAA
AAAATTGATTTTCAAATTCAATAAGCTGCAACTTTGAATAATTAAAAGGACCACTGCAAA
AAGACAGTGGAAGCTGTGTACATTGTAAGACCTGTCACAGTATCATCACTTTCTTCTTCA
TAGGTTCAGATCCGTCCTTGGAATCTAAGTGATAGTGATTTTGTGATGGATGGTTCTCAG
CCTCTGGATCCCCGAAAGACCATTTTTGTTGGAGGTGTTCCAAGGCCATTAAGAGCTGGT
ATGTAAAAGATTAATGTTTGAAAACCACTTTTTAAATAAGTGTTCGATTCAGTAGACACC
CTTGTGTACGAGGCATTATTGGGTGTGGGGAGGGGCAAATACCTGAGTTATCATTAACTA
CAGACAGAATCCTGAGACAAAATCTGAGAACAATTGTTGAAAGTTCTCTCTTGAAACTCA
TTGCTGGACGGTGGATGCTCATCTAGCAAGATTAAAAGCTAACTGCAAGGAGACTCTTGA
TAGTCTACTTAAATGAGAAGAATCTCAATAAATATGTCTGGCTTCTTAAGGGGAACTTTG
AAAGGAATTAGGACTTGGGGACTTGTTTGTTTTGGGTTTTATATTAGAGCCATAAAGTAA
AAGAAAAGCCTACTTGAGGGAGTGATAACTTCTGTTGGTAATCCTGAGCCAGAGGTCAAG
CAGAAGATGACCTGTAGGGCCGTAATTACAGGCTTGCAGATTCCAAGGAAGGCTGTAGAT
TTATATTTGAACAAGAGCTAGTGGTGCCATTAAGAGCCTAGAATATAATGAGAGTCGTGA
TATCAGGAGGGGAAGGGGCAATCGGATCACAATGATCTGCATATAACCCCCTTCCTGGGG
GATGGACAACAGACAGATGGGTGAAGGGAGACATCAGACAGTGCAAGACATGAAAAAATA
ATAATTTTTAAATTATCAAGGGTTCCTGAGGGAGAGGAAAAATGAGGAATTGATACCAAG
GGCTCAAGTAGAAAGAAAATTATTTGAGAATGATGATGGCAACAAATATGCTTGACAAAA
TGGATGGATGGATGGATGGTGATAACAGTTGTATGAGCCCCCAATAAAATGATTTTTAAA
AAAGACCCTGAAATAGACATTTCAATCAAGGTTATTGACATTTGTTATTCTTTTAAGGAT
AATCACAGTAACTATGTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCAAGAGAAGATGTGC
CCATCTGCTTCGTCTGGCAATCCTATGGAGCAGTGTCGCTGCCCTTGTAGTTGCTATGAG
TGGAATTGACATGATGCAGCGGGGTGGTTCTGTTTGTTTCTATGAGAATGTCGCCCAGAT
GACCATACGAACTTCTAAGTGTCTCGCGATGATCAGTCATGCAATTGTGTGTTTACAATG
CATGTTCGCACGGAATTTTGTGAATAGTTCACAGTTGTCCATATGTATAGAAATCATGTA
CCCATGGGTATAGCCTTAATGTATCCCCAGGAGGCCGACTAAGAAGAGGGTGCACTAAGA
GCTTTTGATATGTAAATTAGGTGACATCGCTTGAGTTGATACCCTCCTGGTGTAATAATG
CTTGCCCTTCAAGCCTCTTCTCTGAAGCTTTGTACATGAAGAGTATTTGGGGGAATGGAG
GATTGGTTAATCAATGCCAGTTGCCTAGACCACGGGCTCTAGAAGTCGTCATTAAGTCAA
GTGCCAAACCATTACAGCCTAAAGGTTGGCTGTAGGAACCTCCCAGCCCAGTCTCACCAG
CCAGAGCTTCCAAAAGATCACAGCTTTGAAAACCCCACGGAGCAGTTCTGCCAGGAGCCG
GAATGGATGGCAGTTACCAAGACACCCTACCTTCCCATTGTCCCTTCAAATATAAGTGTC
TAAGAGGATTTGCCTTTTTTTCCAGATATACAAGTGTAAACATTTTAAACTGGTTTCCAC
TTTAGTTGTTTTCAACCCTGGCTACACATTGAAATCACCGGGGAACATTTGAAAGCCCTG
GCCCAGCCCCAGCCCCAGGTTCTGAGATGATTAATCTGGGAGGCTGCCTGGACAGCAGGC
TCTTAGAAATTGCCTATACTGAGGGTTGTGATAGGCAGCCAAGCTTGCCGTCCTCTACTT
TAGCAAAGAGGTGAAATGGTCCCAGAGGAGTTTAGCTACACTGTATATGCGTGGCTTCAT
GTACAGAAGCAGAAGGAATGGCTATCTCCCTGTTTCTAAAATGATTGTGAAGGACCAGTT
GTTCGAGGGTTGTGCATTGATTCTTAGTAGTAACTCGGGCACAAAACAGGTGATTTGAGA
AACAGGTACCTTCTTAAAAAGGCCATAGTAAATTTAGAATGGACACCCCAAAGATACACC
AGGTACTCACTGGGTAGAAGATTATTAGAATAGTTTCTTCAGTTTCCTTTTTAGGCATTT
GGACGCTTAGGAAATTGGCTTAGTTCCTAACTCCTTGAGAGCCACTACACCTTGTATTTC
ATTGCGTCTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACC
ATCATCAAGTCAATCCTGACTCCGGGTGACTGCATGGTTTCAGAGACTGCAAATCTCTAG
GGAGCAGACAGCCTCAGCTATCTCGGGAGGAACAGCTGGTAGGCTTGAACTGCTGACCTT
TCAGCTAGCAACCCTAACCTAAGCCAGAGCATCCTACTTTATAAAACCATTTCTAGGATT
GAGAAACAAACATAAACAAAAAACACACAGGTAACTTACATGGTTACATTTAAGAAAAAA
TTGTCAGCAGCTTTCTATCAAGTGATCCCTAAGCACACATGGTGTTAGTGTCTGTTAAAA
CCCAGGGAAAATCCAGACACTGTCTTCAAGTCGCTTAGACCCCACACCCCAAACCAGTAA
CCCCAGAGCCCAGAGCCAGGCGGGCGCCCACACCTCTGCTCTGCCTTCCAGGTGGAGGTG
AAGCCATATGTGCTCGATGACCAGATGTGCGACGAATGCCAGGGAGCGCGCTGTGGCGGG
AAGTTTGCACCTTTCTTCTGTGCCAATGTCACTTGCCTGCAGTATTACTGTGAGTTTTGT
TGGGCAAATATCCACTCTCGGGCAGGCCGTGAGTTCCACAAGCCATTGGTGAAGGAAGGC
GCCGACCGCCCACGGCAGATCCACTTCCGCTGGAACTGAGGAGCGCGCTGTGTCCAAGGA
GAAGGAAGGGTGCATGTGGGTTACTGTGTTGGAAGATACTGACGTGCAGAAGAAATAAGT
GCATTCTTCTGCTTTTCACCCCGGCTGTCAATACGTGCATCTTTATCAGCAGCCAAAACA
CCACAAGCCTCTTGTTTTTCACCAAAACCCTACATCTCAGGCTTACTGATTTTTGCGATA
TTTTCATGTTAAAAAATAAAATGTTCTTTTGTATTTTCTCCAAGTTATTTTTATATGTAA
AGTGAAAATTAAGATAAGAGAATGTTTTGCGTAGGGGCAACACAGTCTGCTGCTATATAC
CGTGGGTGAAGCGTGCACTTATTTCTGAACATGGGTTTTTAACTTCAAGATCTGCCCCAG
GAACTTTACCAAAGGTAGCAAAATAATAGTGAAGATGGAATATGTCTGCTACAAATGCTT
ATTTTTATCGTTGCTATTTTCCGTGTATACATAAACTAAAAATTAGGGTTGATTGTTTTT
GGCTTTGGGTTTGGTTTTGGGTTTTTTTGCTCTCCATTTTGACTTGCAAGAAATAATACC
TCAAGATAATCGGATTTATTAGCTATTTTTAAACATTTTTAATCACAAGCTGTACTAGCT
TTTGCTGCTATATAGGTGTTATGTGTAAATGCCACCTATTAATACGGGATTGAAAATGTT
AGAGACACTGCATTGCAGAGATAAAAATGCAGGCAGCACAATATGGCCTAAACTGCCATC
GTTTTAGAATGTGAAAAAATAATTTTTTAAATGCATGTTTACTTACCTGTATACACCATA
TGCATGCACTAGAGTTTATTAACTTACAAGAGGCGAGGTCTTGCAAATGCTCACACAAGC
TCTCTTGAACCTAGATCGCATGAACAAATGATAAGCTTTGTTTAAAAGAAGCAAACTTGC
ATGCATTATTGTGACTTCAAGTTTAAAAGCAAACCTGTCCTACATGTGTACAATATGCAA
ATTCGTTTTAGATTAGCAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1282, 2001..2090, 27491..27581, 38289..38339, 45045..45068, 79027..79197, 81549..81638, 103546..103664, 103923..104037, 105060..105241, 107391..107618
1001..1282, 2001..2090, 27491..27581, 38289..38339, 45045..45068, 79027..79197, 81549..81638, 103546..103664, 103923..104037, 105060..105241, 107391..107615
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved