Echinops_telfairi Locus SRP19
snOPY snoRNA Orthological Gene Database
Echinops_telfairi SRP19
Echinops_telfairi
SRP19
GeneScaffold_5181
SNORA5
7808..7938
10055
AAGTCTATTTAGTTGAAAAAAGGAAATAAAAAACCAGTGCTTTCAATCAACTTACAGTT
CAGTAAGTCCGAGTTACTGATAACGCATAATTGCCTTTTAATATTATGTGAAGTTATGCC
CACTTTGAAACCAACACTTTGTCATCAGGATCACCTTCACTTGTTGCAATGTACGGTTTT
TAAATCTCTAAAAAGGCGTGGAACCTTTTCCCCCGCTATTAACATGGCTATGTGCACCTG
TTTGGACTTACACCCAGGATCTGCCTGCATCCAAAAGACGGTGAGTTCTACAGTGCGTGT
CCTCCGAAGACTAAAATTTTCTTCTGAGGTCGTTTCTAACCTTTATACAGCACATTGAAA
TACATTCCTTTCCCAAATTGAAATCAAACAGCAGGACCTAGAAAGGCGTGACGCCCACCC
ACTGCTATCTAGTCCACTGACTCATGGCTCCTTAATACAGGGTTTCCGAGATTGTATATC
TTTATGGGAGCTGACAGTCTCATCGTTCTCATCTTGCAGAGCAGCGGGTGGGTTTGAATC
ACCCACCTTGCGATATAACAGTCCAATGCTTAACCCAGTGTGTCACCAGGGCTCCTAAAA
GGCGCCTCTGAACGACACAGCACTCCCGCGATGAAGACCTCTCGCCTCACGGCAGGAGTA
AACACCACCGCTTAACCGCGGTGTGAAAACAGACCAGGGGGAACGTGAAAAATGATTCCG
TTGCTAAAAACAGCTCAGTGGCTACAAACCCTCTGTGGGCGGGATCTGAGACCGGAACGA
CGGGAAGGTTTCCTGTCCTCTCGCGGGATCTCCACGGGCCACGTCAGAAAGCGGGGCTCC
AGGCCGTGAGCCATTGGTGCGATGATAGACCGGGCCGTGAAAAGCCACGGACGTGGAGGC
GTTGCGGGAGGCAGGACTTCCGCCGGAAGTGCCCGCCGCCTTCCGGCCTGTCTTCTCTGC
GAGTTGCAAGCTGGCGGGGTGTGCGGTCGTCCTGCGTGGAAATGGCCAGCGCCGCCGCGC
GGTCCCCAGCTGACCAGGACAGGTGGGTCCCGGAGAGAGGGGTCCTACGGAGGCCTTGCT
GCGAGCCCGCGGGCGGCGCCCACCCCGGAGCACGGCCGCGCCGGGGCCGCTGGGCACTGG
CCGCAGACCCGGCGCCGCTCCCGGGGAGGCGGTTCCAGCCCGAGGAACCTGGGTTCTTTA
GCAAGTTTAGTATCAGCGAAGCCAAGAGAGTGTGTCCCAGCTGCAGGAACATGGCAACTG
TATCCAGCTAGACATTTATAACCAAAACACCTTTTTGGTTGTGTGTGTGCGCGTGTGGAA
AAAAACAAGCTGGGTGCTCCGCTGAGTAAACTTTCCTTCGTGAGTTGGGCGGTGGGAGGC
AAAGTGAAGGCTGACTGCCGCGGGCCGTGCTGTGTGACCCGGGGTACCCCCCTCCTGTGC
TTTGTCCCGGGCCAGGTTCATTTGCATCTACCCCGCTTATCTGAATAACAAGAAGACCCT
CGCGGAGGGGCGCCGCATCCCCGTCAACAAGGTGAGGCCTGACACTCGCGCCCCTGGAGG
GATGGGTGGGTCTGGCCTGTTGGAACCCCCAGTTTCTTTTCCTTTTAATACTTTAAAATC
GAAAGGGAACAGCAGGTAAGTGGGGGAGCTTTCCTTCATATTGGTAAAACCAGAAAGGCG
TTAATTTATAGCAAGTCAATTCTGACTCAGGGCGACCCTATATTTATGACTTATAGCTGT
GGAGATTATAATGAAGTTATGACAGTTCCCCCCCCTTTTTTTTGACAGTTTTCCCCCTTA
TGAAGAAAATTGAAACCCTTGCTTTATACATTGTAATGTCCAGAATGCAGTTGAGTTTGT
AAATAGGTTTAAAGGCAAATCAATTTCAGTTTTTTGCCCCAACAGTTTTGTCACTTAATT
TACATATCATACAATTGAATGGTTCAATCTTATCAAGGGATTGTACAATCAGCACCCAAT
CTATCTTATTGGTTGAGTTTTATGTTACTTTTATTTAATGTTTTTTTTAAATAGGCTGTT
CGTGCTTGTGAGGCAGGAAAACTTACATTTTTTATTGACCTAGGAGTTAAAATTTACAAA
GTGACTAATGCCGAGTAAAAGGTCTATATTGAAGTTTTTTCTTTTCAAAGTGGGTGTTGT
ATTTTGCATTTTAAAAGATCATAACCCATTTTGCAATTACAGTGCCCGATTAAAGGTAAC
TAGTCTAAAGTAATGTCACTTATTTTTGTGCCCTTTAATAACTTCTAATTTACTGCCTAA
ATATGTAAAAATTGGCTTTGCTACCTCAAGGTAAGAGAAAGGGTGCTAAAGTACTTCTTC
AAAATAATGCCGGCACCAATCTACTGTGACATGTTTCTGGTAGCAAACCCTCATATAATT
TGGAGAATTACTGAAATTATAGGAAAGATTAAAGACGTGCATGGATAGGTTGGTTGGTGG
ATCTTTTTAAAACAAATAACCTTTATTGTGTGGCCTTTATACAAAAATGTACATAAATAC
ATAGCTTTATTGGTTTTCACAAAGTGAGCACACTTGCATAGCCAGCATCCACATTTTTTG
AAAAGCATTATCAATACCCCCAGAAGATTCCTTCATGTCCCGTTAGATACTATTCCTTTA
TATACTCACCCAAATCAGTGTTCTGACTTCTAACACAATACTTCACCGGATTGTTGAACT
TTATATAAAGAGAATTGTACACTATGTACTCTCATGTCTTTGATGTATCCACATTTTTTA
GTGTAAGTTAATTTTCATTGCTCAGCAAGGTTTCTCTGAACAGTCCGATGGGCCTTGAGG
ATGTGAGGGTGTGTGGCAGCATCTCTACAAGAGCCCTGGTGGTGGAATGTTTGCACCTTA
GTTTGCTTACCACAAGGTCAATAGTTCCAAGGCACTAGCTGTTCCCCAAGGGAAAGAAAA
GGTTTTCTATTTCTGTAAAGAGTTCAACTCAGAACCCCAGAGGGGCAAATCTACCTTTGC
TTATAGCTATGAAGTGGCATGGACTTGAGAGTAGTGAATTTGGTTTTTGGTTTATAGTAG
AAATCCATGTCAGATTAAGCTGTTTATGGCTTTTGTTTTTAACTTTCAGGCTGTTGAAAA
TCCAACAGCTTCAGAGATTCAAGATGTATGCTTAGCAGTTGGACTTAATGTATCTCTTGA
GGTATGATGTAGTTCTTTATGATTTTTCCACCCTAATCTCGTTGATATAATAGCTGTTGA
GCATAGCTTATTTTTGTTTTTGTTTTTTATATTAGAAAAATAAAATGTACTCTAGAGAAT
GGAATCGTGATGCTCAGTACAGGGGCAGAGTCCGGGTTCAGCTGAAACAGGAAGATGGCA
GCCTCTGTTTGGTACAGTTTCCATCACGTAAGCTCTTTTAAATAAATGAATGGTGTTCCG
GGATAGGTATTCCTCTATAATACAACATATTAACAAATGGACCTTTTGGAAGATATAAAT
CGTAATTTACAGTCTACAGATTTCTCTACTACTGAGTGGAGAGAGGTAAACAGGTTTTAA
CTCTTTCAAGTTAAGTGCTTTTGTGTGTGTGATGAAACCTAATTTGAAGGAAAAAAAACA
TTTTGTAGACCTCTGGAAGTTTTCATGTGGCCAGCTTAAGAGTACAAAATTTTAAAAAAT
TAATTAATTAAAAGGAGTATAAAATAAATCATTAAATGACTAAAAGTTAATTACCATTTC
AAATACTGGAGACCATTGATATCTATGACTAGTGATTATTTTTATTCTTTATCTAAAAAG
CAATATTGAGTGAAAAACAACAAGTTGAAATGCACAGGGTATCACTTATGTTCATGTATA
AAATTTACTGTTGTTTGTTGATATATGGATGTATCTATTTTGAAATGCCCTAAACGGATA
CACCACAAAGTGCACTCCATCAGACCTCCAATGCAGGGACTGTCTGTAGTCCCCTGATGG
TGGACAGAGAGTGAAGAGTGTAAAGTGGTGGAAAAAGAAAACTGTGGCTTTTTCTTTAGT
GCCTTTTGTTTCTTTCTTTCTGATAAAGTAAGCAACTACGGAAAGCTTTCTTTGTCTACA
GCGCTATGGATGCAACAGCAAAACCCAAAATAACCTAACAACTTCCCTAATACTGCTTCA
AAGCAAGCACATCAAACTTGATTCCACTAGAATGTAGTTATTCTTTACAATACTAATTTT
TTTAAAGACTGTGTGTGTGTGTCTGTGTGTGTGCGCGCGCGCACGCGCGCGCAAACTATT
ATTGAGCATCTTCTGGCCAAGTTAGTCTCTCTTCATAAAATGGAATTACAATTTGAGGGC
ATCCATGTTTGCTTCCTTGCCAATACCAAGTTTGCCTCATTTGAATCTTCCCATTTCATG
AGAAACATGAATTGCCCATGTAGGAGTTTTGTTTGCTTGTTTCTAAATGATAATAACCAA
AATTGGACTTCAGTATTCCAAAAGGCGATTTGGGGTATTGGGGATATCAATCGATGCTTC
TTTATATGTTGTTCTTTACTTTTCTAAATTTATTTCCTTTTTTTTCTAAATTTATTTCTT
TTTAATTTAAAAGATCTACTTATAATTCTTTCTTGGCATAATAAATCCAAACTGACAATT
TGAGTACCCTTATTTTTATATAAATGAAGCCGTATAATACTTAGCCTTTTTGTGTGTGTC
TTCTTTTACTTAGCATTGGCATCAGTGTCCATCCGTGTCATAGGTTTCCAAACTTACTTG
GCCTACTCTCCATCTTCCAGGGGGAGAAATTACACAGTACTCCCCAGGGAATTAAAAACT
TTATATATGATACCCCATAAGGCAGGGTAAGGTGTGGGTCTCTACTTTTACAACATCCTG
GGTCATTTCAGGAAACACTGACCTTTGCTGGAGCATATATCAGACCCTCATTCATTTTTA
TGGTGGAATAATATAGTCCATTGTATGTTTAAACCATATTTTTCATTTGTTGGTGGCACT
AGGGATTTTACCTTATGGCCAAGGTAATGCTACTTTGAACATTGACACTTGTTTAAGGCT
CTGTTGTTAATTCTTTAGGGTTTATAGCTAAGATTAAAATTGCTGGGCTTTATAGTAAAT
GTACTTTGTAAAAACCCACCCTAACTTTTGCCCAGTGCCGGCAGCATTTTGAACTCCTAC
CAGCAGTGCTATTCAAAGTGGTATCTCCTTGTGGTTTTGATATTTGCATTCCCCTTATGT
AAATTGAGTGTCACTGCTGATTAATAACCCTTAATGTTTTAAAATTGTATTGTTTTTATT
GTTGAATTGATAGAGCTTGTTATTCTAGAAATAAGTCCTTATCAGATACATGATTTATAA
AGATTTCCTTTCATCCGTGGGTTATCTTTTCACTCTCTTGATGGTCCTTGGTGCACAAAA
GTTTATAATTTTGGTGATGCCCGTGTTTTTACCTAATTTGCTTCTGCTGTGCTTCTGCCA
TGTTTAGAAAAGCATTGCTAAATCCCGCAGACCTCCCTCATGTTGTCTTTTAAGAGTTTC
ATACTTTTAGTATTTAGTTCCTAAATCCATCTTGAGTTTTTTAATGTGATAGAAGGTAAG
AGTTAAACTTTCTCATATCTAGTGTGCCCAGCACCATTTATTAAACAAGCTCTTCTTTCC
CCCATTGAGTCAATGCTGACTCATAACTGCCCCATTTGGATTTCTGAGACTGGAACTGTC
TTTATAGGAGTAAAAAACCTCATCTTTCTCCAGAGAAGCTACTGGTTTTGAACTGCCAAC
CATTCGGATTGCAGCCCAACAAGTAACCACTATACCACCAGGGCTCCCTGACCATAATTA
TGAGGTCTTATTTCTGGGCTCTTAATTGTATTTCACTGGTTTACATGTCAATTTTTATGC
TGGTACAACAATGTTTGATTCGTATAGCTTTGTAGGAAGTACAAGGGGGTACCCCAAAAA
CCAGACACCCTCCACCCCCACAGCTATGTATTTAAATTTTTTTACAGAACAACCTTATCA
CCATCAGAGTACTCTCGATTACACTTAAAACGTTTGTCAAAGCTGCGATTCCGTTCTTGG
AAACATTTTTCAAACTTAACTGTTTGGATGGCTGACAGCCCCTCCCTTGTTTGTTTTTTT
TCTTTACCTCTTCTATGTCTTCAAATCACTGTCTTTTTTTTTTAATCATTTTATTAGGGG
CTCATACAACTCTTATCACAATCCTTACATACATCAATTGTGTAAAGCGCATTTGTACAT
TCATTGCCCTCATCATTCTCAAAACATTTTCTCTCCACTTAAGCCCCCGGCATTAGGTCC
TCATTTTCCCCTCCCTCCCCGCTCCCCCCCCCCCCTAAATCACTGTCTTTTCATATGCCT
CTTCATTCTCAGAAAAAAAATTCACATGGAGCAATGCCAGAGGCATGCTGTTTTCTCCCA
AAAGTTGGCACACTGAGATGGTTGTATGAGCACGAGGTGGAAAAACCAGTCCCCCGACTC
CCACAAATCTGGCTTTTTTTGTCACACTGTTATGCAGTCTTTTCAGAACCTCTAAATAGA
AAGCTTAACAGTCTGACCTGGTAGAACAAACTCCAAGTGAACTATTATCCCCTCATATTC
AAAAAAACAAATGAGCGTCATCTTGATATTTAATTGCACTTGACAAGCTTTGGGGGGGCG
AGGTGATGGTGGCATCTGCCACAGGCGTGATTGGTGTTTACTTTCGGGGTTATAAGAACA
GCGCCGTGTCTTGTCACCAGTAATAATCTGGGAAGAGTCCGGGTCCCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTCCTCCTAAGAACCCAAGGCACAGATTTT
GCAACAACCCTTCTCATTCCCAAATCTCCCATTAAAATCCACTGAACTGAGGTCCAAGAC
AGTCCAGATAACTTCCTATCTTTTCAATGATCCATCGTCGGTCTTCAAGCAGAAGTGCCC
AAATTCTGTAGACATTTTCATCTTCATCCATCAGGGACGTTGACACATGTCCAGAACAAG
GTTTGTTATCAATCGACATCTCACCATTTTTGAAATGAAAAAAACCACTTGTACACCTGG
TATTTTCCCATTGACACTGTCTTTTAAAGCTGTGTTCAACATCACAACAGTTTCTGCAGC
ATTTTTCCCAAGCAGGAAACAAAATTTCCCAGGCACATGCTGTTCTCTTAAATTGGCCAA
CCCAAAAAATGAGGTTTGAGCGAAACTGCTTTTAGAAAGGGAAAATTCGTGACCAGAGAG
AGCCTTCCCTGGTGACACCACTGGGGGCATCAGTGCGAGTTGCTCAATGCTCACTTAGCT
GGAAAAGTGCGTACTATGAAAGTTCCTCCCAGCAGAGCTTTTTTCCTTTTTTGTTTGGTT
TGGGGGGGGAGATCCCCTCGTATGACTGCTCCAACTTTGTTGTCCTCAATATGTTTGGCT
AGAGCCCTTTCAGATTTGGAATCATTTCAGATTATTTTCGATGCTATTGTAAATGGAATT
ATTTACTTTTCAGATTGTTCATTGCTAATGTCTAGTGGTAGTGGTTACACATTGTGGGTT
AGGCATTGGGCTGCTAACTTTAAGATAACAGTTCAAACCCACCAGCCACAGCTGGGGAGT
AGGATGAGGCTTTCACCTCCTGTACGGATGTACAGGCTCAGAAACGCTGCCTTAAGGCCC
TGTGAATTGGACATGAACTCCGCCGCAGGAGAAGCAGGGTGTTTTGCCATCCCTGCATCA
TGCCATAGGGTCGCTGTGTCAAATTCAGTGTCTGCCCCACCCATGGCAGACTGGCCCAAA
AGGCTGCCACAAACACTGTGACGCATGGGCCCTGTTTTTCTTTTCTGGACCTCAGGGATA
AATTTCGTTTCAGACACCAAGCTTCTAGGCCTTGAGAGTGTGGGGTTATGTAGACTGGTG
GGCCTTTTGGCTACACCAGGATATGCGTCATGTCATTTGAACTAAGATAATTTTCCTTCA
TTGTTTCCTATTCAGGTACCTCATTTCGTATTCTTGCCTAATTGCTTTGGCTGGACCTCT
CAGTAAAATGTTGAGTAGAAGTAGCATCCTTGTCGTGTTCCTAATCTTGGGGAGAAAGCT
ATCAGTCTTGCACAAGAGTGTGGTGTTAGCTTTGAATTTTATAGCTGCTCTCGGGCATGA
GGCAGAAATGCCCAGCGATCTGTAGTTTGCAGAGTAGTTTGATCATGAATGGGTATGGAT
TTTATCAACTGTCTTTTCTTTTTCTTTTTTTTGAGGTAATTGCTCGAGTTTTTATACCCT
TGTGTACTCTGTTTCATTGATTGGCTTTCTTATGAATTGCTTTACCATTCCTGGGGAAAA
CCCAGCATGGTCATGATACGTCACCCTTTTTAATAGGCTATTTAAAGTTTTTCTAGGTTT
TTTGGTGAATTCTTTGCATCTATATTCATAAGGGACGTTGATATATAATTTTTATCCTCC
TTTGTATGGCTTTGATATGGTAATGCTAGTCACATAAAATGAGTTTAGGAAGTGCTTCTT
TCTAATATTTGAGCTCAAAAAGAATTAGTGTTAAATTTTCTTTAAATATTTAGTATAATG
GAGTCCCCAGGTATGGTCAAACAGTTACGCTCTTGACTACCAACCAAAAGGTTACAGTCA
TGGCCAGCAACAACATTGCAGTACAATTGCACACTGAGAGACGTGGGGTCACCATGAGTG
GGGATCAACTCTACAGCCACTGAAAAGAAGAAAACGTATAATGTGCATAAGACTCGGATA
GAACTCGCCAGAGAAGCCATCTGGTCCTGTTTAATGGGGAGATTTTACTTACTGATTCAG
TCTTCATACTTGTGTGATATCTCTCAAAAGACTGGGGAGGAGAGGTTTGATTTGACCAGC
AAATAAGAGAAATAAAAATAGAAGTTTAGTGAATGGTGCATCCAATTTCCAGTAAGAAAA
TATATAAGGTAGTGTAAAAAGGGGGGGGGGGTGGCAAATCGAGAGACATGGTGGGTTGAT
AAAACGAAAGCAACTATTGGAGCTGGAGGCTTCTAAGCATATGAATAATATTCATTGACC
ATGTACTTGTGTAGCTTACATACAATGATATTAAGCCTTTGTTTATAACTCATTATTTTT
AAATACTCATCTTCAAGCTAAAGATCAAAATTTTGTTTGATTTAATATTTGATAATTTGA
TTGTATTCAGATATTTTGAGCATTGTTCTCAAATTCAAAACTTCATTGTCTCCAGCAGAG
GCCATCACTAGTCACTGTTTTCATAGTCATTTGTGTGGGAGGAAGCCAGCCCCCACAACT
GAATGGGTCCTAAGGCACACGCCAACTTCTATGTCTCAGGACATTTAAGCCCCCAGGGCT
ACAGACAACCACATACCAAACAAGGTGGGCAGTGTCCTGACTTAGCGATGTCTCCTTCAT
TGGAGAGTGCACCAGTGTTTTAGGCACGTAGAGCGAGTGGACTGTCCCCAAGGGAGAACA
ATAGCAACAGGTCTGCCCAGCCAAATAATATAACTGCCATGTGCTTGTAAGAAGTGACCT
TAAAGTTGCACTATTTTGGGGGCGATGATTTTTAGTTAGAATGTGACAGACTCTTCTCCA
ACTCGCAAATGTGAAGACCTCCCTCCACCAGAATCCTGGCCTCCCAGGCTTTTAAATCAT
GAACATAGAGAATTTGTCTGCATACGCACCCTTTCTGGTCCTCAGTTTCCCACACATTTG
CTTTTTTGGCTTAATTTCTTATTATGGTTGTGGCTTTCCAGCCTCTCATGTCTTATTTCT
CATACACTAAGCCTAACTTTTGGTTCCTAGGTAAGTCGGTAATGTTGTATGCAGCCGAAA
TGATACCTAAGCTAAAAACAAGGACGCAAAAAACAGGTGGGGCTGACCAGAGTCTTCAGC
AAGGAGAAGGAAGTAAAAAAGGAAAAGGCAAGAAGAAGAAGTGATCTGGGGTGAGCATCA
AGTCTGTGGTACCCCGGTAGGACACAGGAATGGAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1041, 1455..1530, 3109..3180, 3275..3386, 9870..10003
1001..1041, 1455..1530, 3109..3180, 3275..3386, 9870..10000
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved