Echinops_telfairi Locus METAP2
snOPY snoRNA Orthological Gene Database
Echinops_telfairi METAP2
Echinops_telfairi
METAP2
GeneScaffold_2161
SNORA9, SNORA9
8581..8715, 12775..12909
33538
TGAGACATCATCTCATGTACTTTGGAAATCTCATCAGGAGGAGCCAGTCTCTGGAGCTA
GACATCACACGCGGTAAAGCAGAGGGTCACTGACAAAATGAGGGAAACCCTGTAAGAGAC
GGATTTACACCGGCTGTAGGAATAGGCTCAAGCATACAACAAGTTTTAGGATGACGATTG
GATGAGGCAGCGTTGGGTTCTGTTGGACATAGGCTCACTGAAAGTTGTAGTCAATCCAAT
GGCAATAAGAATAATGACAATGAGAGATCTACAAAAGTTAAAACCATAAAGATTCTGGAA
GCAGTTACCATGGATGAGGTGGAAGAGCTGTTGCTTAGGGGACCTTAGGGTTATGTTTAA
TGGTAGTGGAATAATTTGGAAAAGGATATCAATAATGGTTGCACAACATGAAGAGTATAA
TCAATGGCACTGAATTATACATGTAGAAGTTGTTGAACTGGAGAATGTCTTGTTGTGTAT
ATTTTTGCCACAATACCGGCAGGGTGAGGGAGGGTGGGGTGTAAGGGGGAACTGATTACN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGGTTCATGAGGGAGGAGGG
AATGGGAGGGAGGAGGAAAAATGAGGAGCTGATACCAGTGGAGAGCAAATGCTTTGAGAA
TGATGAGGGCAACGAATGTACAAATGTGCTTGACACAATGGATGGATGGATGGATTGTGA
TAAGAGTTGTATGAAACCCCAATACAGTGATTTAAAAAATAGAATAACAATCACATGAAT
AACAATTAGTACAAGGAAGAAGAAAATGTTCTAGAATTGATTGTGGTGATAATTGTACAA
TTGTTCTTGATATGATTGAATTATTGGGTTGTGTGACACCCACCTGAACCAGCGATTCTG
GAAGCTGCTCTGCCCCATTCCCTCTCGCTCTCTCTTGCAACATGGAGGGCGTGGTGGGGG
CAGCGACCTCCAGGCGAGGATGGGATATGAACCCACATGTCCAATAAAACTGTTCATTAA
AAAAAAAAAGATTCTAGAAGCAAACTTTCCTTGCCTTGGGGTAGACAATCACTTCCAGAA
GAGGTTTCAATTGGCACAGACTACAGAATATGAAAATTAGTAAATTAGACTTCATTAAAA
AAGCATAAACTCCTGCTCATCAAAACACATCCTAAAAAAAATCAAAAGACAAACCACAGA
AGGAGAGAAAAGATTGCGATTTGCAGATCTGGCAAAAGACTTGCATTCAAGGTATACAAA
GCTCTCTTGCCGCTCGATGGTAAAAGGCAGTCAAGATGAGACTGGTTGTACAACTTCAGG
AATGTAACCTGTGCCACTGAGCAGTACGTAAAGAATCATTGAACTGTGTGATCTGTTGTG
TATGTTCTCGACAATGAGAATAAATGTTAAAATACATTTTAAAAGAGACAATCTGATTTA
AAATCAAAAGATTTAGAGAGTTGAACAGGCATTTTACAAGAGATATAAAAATGGCCAATG
AACACATGAAAAAGTATTTACCATCATTAGGCCTAAGAGAAAGCAAACTAAAGCCATTAT
GAAATAGTCACTATGCATCTGATGGGAAAAATTTAAAACATGGATAACATGAAATGCCGA
TGAGCATATGGAGAAAATCGAACTCTCATTCATTTCTGGTTGAAGTATAAAATGGTACAA
CCACTTTGGAAATCTTGGGCTTTTGTTTTGCTTTGTTTTTTAAAGGTAAAATATACCTAA
TCTATGAGCCAGAAACTTCAATGCTAGATATTTACCTGAGAAAAATGAATATATACCAGG
GTAAGTAAAAGTTGTACTACTATAGTTCCTGTTCTTACATACACGGCTTTCTTAGAAAAC
ATGTTTAAGCATGTCTCTATCCTCAGTGATGACTGGCTGACATGTTCTCTCAGTCACACA
TTTGTTTTAGTTTCAATGCTGTGCCTTAAAAAAATAAACAAGTAAAAAATATGTTTTTTT
GGTTCCATGGGAAAAGAAACAATTTTTATGTCAAGAGAGTTCAAGCTAACATTAATTTTT
GGACAAAATTCAAGAGGACATCTTCCCAAATTATTGAAAGTGCAACACGTTTATGGGAAT
GCTGTCCACAGAAAACAGGTTTTCCAATGCATTAAGCATTTTAAGAAAGGATGAGAAGAC
CCCAAAACTGTGCCCAAAGAAGCAAAATCATCCACCTCTTTGAATGAGGACAATGTTGAA
GAATCCAGAAACTGGTGGACAAAACCTGTTGAGTTGCCATTAACGCACAAACTACTGAAA
CTGGGGTTTCACGTGGTTCAGTAGGACCAATTCTGAGCAAACTGCTTCAGCGAGCTTTCA
GCTACCCGGGTGACAAAAACATTACGGAAACATCAATAACTCAAAAAGCTGATCTTTCCA
TTCGTTTTTTAAATAAAACTGAAATTCATTCAGACAGTTTTACGGAACTAATGATGTCTG
AGAACAAGTTTTGGATTTACCACTTCAATAGTGGCATCCAAGGGGACGTTGCTGTTGTTT
TCTCCTAGTGTGTGTCCTGTTGGGGTTTGTGTGATTTTCTGTTTATGAAATCCAGGATAG
GTGTGGTAGTTAGACTTTATGTCAACTTGAATTGGTATGAAGGTGTAGGGGTGGAGTTCA
ACCTGTCTATCAGGTCAGAGCCTGATGATGCCTCTTTGAAGCATGCCTCTCCTTGAGGAT
GGGAGAGACAGTGACAAGGCCGCCTTCCTCTCTCAGGGGGTGCACCTGCAGGAATAACTT
CAGGGTCAGGTCCCCTGACCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNATGCGGACGAGAGGGAAGAGGGAGCTGCCTCCACAAACGAAGAGGCAGCCAAG
AAGAAAAGACGGAAGAAGAAGAAGAGTAAAGGGGCTGCCGCAGGTGAAGAGTTCCGTGTG
TTCCCGGGCCCTGCTAGGGATGGCCGAACGGCTCCGGCCCAGCACGGGTGGCGGGACTGG
GGATCCTGGGCGGAGGGCTGGCCTTCTTTCCGACTCTGAGCCGTGGCAACGCACGGGCTC
CCGACTTTCCAGTCCCAGATAGAGGCCGCTTGTCGGGGGCCCTGGGGGGCTGGGGGCGCG
GGTGAAGGAGGGGAGGAATTGGGTCTCAGCTTCCCGAGGGACTCCAGGGCCGCCGGGCCC
GCGCCCCTGCCTCGCCAGGACTCCGCGTCCACGCCCAGCCCGGAGCGGGCTGGAAGCCGT
GCACGGGCTCGTCCTTGGCCGCCGCGCTTTGGCAAAGCCGGGACCGTCGCGAGTGCCGGA
GAGGCTGGGAGTGCATCTTGGCTCAGGGTGGTTGGGCGAGCCTGAGTGTTTTCACTGTAC
CTCGCCCACCCCTCCGGTCACTAAGGGATGTTTGTTACGGGCTGCACATTTTGGGGGTCT
GTGTGAGTGTGCACACGTGTGTGTTCGCGCGCGCGCGCGTCCTTGTCATTGTGTAGTGAT
TGCCGACTGTGTGGCCGCGGTGGTACGAATGTTCAGCCGCCTGATGTCACAGCGTCGTGA
AGCCTTAGGCCTGAAGTACGGTGGCACTCGGCCCGCGTAGGGGGCGGACAGGCTAGTATC
TTGTGTATCTCAAAAGAACCATCTCGGGCCTGTAACTTCCGAAATCCACCAGTGGGCTAG
GAAAACACCGTGGAAAAGCTCACAGTTGGATTGTATTCTGAGCTGGGAACTTGACAAATG
CTTACTTTTGATTAACCAGGTTTTTTTGGCTGTTTTTTGGGTGTTTGGGGGGGGGGGCAC
AAGTCCTTTTTATAGTGAGGGGTGGTGGTGTAAATTTTTACTGGTTTCTAATGAAGAGCA
CAGAGTAAAGAGGGAAATGTGGCCAGACCAAAAGTGACGAATATGGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGA
AAAGCTATGGAAAACTTCCTCCTATACCTCTTCTGAAGACACCTTGTACTCTAATGGGAA
TGTCCTCTATTAGATCTGACCTGTACCTCTCTTCTCCTTTTTAACAGAGCAACAAGAAAC
TGAATCAGGCACCTCAGTTGATGAGGTAGCAAAACAATTGGAAAGACAAGCTTTGGAAGA
GAAAGAAAAAGATGATGATGATGAAGGTAAAGGATTAATTAGATCTTTGACTAGAAAAAG
GAAAAACTAGGATAGTCTTTAAAATCTTCTGATTCACAAAATATAGTATTCTCTGACATG
AATTTCACTTGGGAAGACCTCAATGCGGCAGCTACAAAGAAAGCCTATTTAATAGCAACT
CTTTAGAAAACTGTATATACTGAGAGCTGCTAAGATAGCCAGATCTCAACTTCTGAAAAT
GTACTTGGTACCAGGCCAAGTGGTGGATGAGTTCTCAGAATAAGTTGGGCTCTGTTTGTG
TAACATTGAACAACTTGTGTGTTCTAGGCACTCAGTATCCTTGGATATTTTCATAGGTGT
CCTCATTTTATCCTCTCAAAACCCAGCAAAGTGTGTGCTATTCTCATCTACTGTAAATTG
AGAAATGATGGTTAAATTGTCCGATGTGACATGCTATGTACTGTGTGGAGTAGAGCCTGA
ATTTCATTTGTAAGTCCTGATTCCAACTCCATCCTTTTTACACTATATTAAAGTTGTTTG
AGTCACAAATGAATATATTGGAGTGCTTTTCAGCTTCACAGTTGTAGCTTCTTGTGATAT
TTTGTTGCTGTGAAATGTCTTTAAGAAAACAGCTGGAATTTTGTAGCAAGACAGGAGAGG
GAGAGATTAAGAATTAGCTAATGTTTATTTCCTCAAGCACTAGTAGCCTGGTGTTCTACC
TGTCAGCCATTAGCAACAAATTCCTGGAGTGCTTTATTGTGTTGGGGAATGCAGAGCAGT
GGTTTGATTTTCTTTTAGAAATAAAATGCTCCCTGCCTTCAAGATGTTCCGCAGTCTGTG
ATGAAGTGCCAGAATTCAAAGGAATGGTTTGTTTTTTTCGCTTCAACATTAACGTTGGTC
CATTTTACCTTGGTTTACACATCAGATTCTGAACTTACTTTGAGCTCGTAGCAATAATTA
AAAAAAATTTTCAATCAAAGGTAGATCCACGGGGTATAGATGACGACAATGTTAATCTTC
CAGCCTACTCTGTCTGTACAGAGTTGTAGGGTTCTCTTTACATTGAGGGGAGATTATTGT
TTGGTAGGGTTCCACAGTTTGGATCGATGGTTTTCTAACACATCTTGTTAACCAGGATCA
ACCAATAAGTGCTGAGAGGTTTTTGAGACACTAGGAAGATAGTGTTTCAGATTAATTTTC
CTAAAGAAATCGGTGGTGTGATGAAAAAAACAAAACAAAGGTAAAAGTATATCTGCAAGA
CAGTTTATGTAAATTTGGAGGTGAGCTTGTTGGCTGAATGCAGAAGGAAGGTTCATTGGA
AGAAATGGGACTTGAATGAAAGATAGAAGAGGCCACTTTGGGGTGTGATAGATGGGAGTC
GGTTTTGACTCATGGTGACCTCATACACAACAGAACAAACATTGCCTGCGCCTGCACCAC
CTTCACAAGCACATTGTGAAAACGTCATGTTTGGCAATTAATTGGAGGAGCTTTTTTTTT
TTAAGAAAAGAAGTATATTAGGGGGAAAAAATAATTGAATGTGGTTGCTTATAGGAGAGG
AGAAGTAAAAGAAAGGCAAAATCTTTTGGGGGGCTTTGTAACAGTAGTCCAGCCACGTGA
TGTTGGAGATTTAAATTGACAATCACTATGAGAATGGAAAGAAAGAGTGTATAGTGCAGT
TAAGGAGCCCTGGTGTAGTGGTTACATGTTGAGCTGCTAACTGCAAGGTCAGCAGTTCGA
AATCAGCCCTTTTGAGGGAGAAAGATGAGCCTTTCTACTCTTTTAAAGAGTTAACAGTCT
CCAAAACTCAGGAGGACAATTCTACCCTCCCCTATAGGGCCACTATGAGTCAGCATTGAC
TTGATGGTAGCGAGATAGTAGTTATAGAAGGAGAATTCAAGTCTTGGGGACCAAGGAGAA
GTGAACTCCCGGAGTTTCAACTTGGGTGGAAATTTTGGTGACGTTGGAAGGGAAAAGTGT
TAAGAGATTGGGGGGTGGGGAACTTTGTAAGCAAGGAAGAAGTTACTGAGTTTAATTTTG
AATGTGCTGGGTTAGAATGTATGTTATCAGTATCTAAAATTGATTCTGTGGGCACTTGGC
AATATGTTGGAGGTACTTGCTCAACTAGTATTTTAAGTTAGGTTTATTAAAGCATAATTT
GCTCACAATTGATTGCGCTGTGGGTTAGGCACTGAATTGCTAACTATAAGGATTTCAGTT
CAGACCAATCAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTCTGATATAATTTAAGCAAGCAATA
TGCAAAATTATTTTGTAAGAATATTGGGTCCATGACATAAGTTATTGAAGATACAGTATG
TGTGGGCATACTTATATATTTATGCTTGATTTTGTCCTTCTACTTTTATGAAGTTAATAT
TCATGTGTACCTGAAATTATCTTCTTAGATGGAGATGGTGATGGAGATGGAGCAACTGGA
AAGAAAAAGAAGAAGAAGAAGAAGAAGAAAGGACGTTAGTGTCTTAAGTTGTTCTTTTTA
ACTGCAAGCCTCCAGCGTGTCTGGGTCTGGAGTGACCCTGTGCATTCCTACAGTGCTTGC
AAGAACAGTTTTGAAACGGTTTGAGGCCTTCCTCTGCACCATCTCCAGAGCAAGGTTATA
GAAATTTCAGACAAACGAGGAAAAAAAAGATATGTTGTAAATGAGGATAATATTGCTATA
CCGAATAGAGGTAGAACTTACTAAAATTAATAACTAGCAAATAACAATCTTGGTATTTTC
TTTAGCTGTTATTTGGTTAAGGGACTTAATAGGAGTTGATTGCAAATTAGGAGTTCATGC
TGCAAAGTAATTATGAATTCCTAAAAGTTTTATAATTTAACACTAGAAAAATTAGAAGAA
CAATTATTTCCAAGGATGGTGAAAGTAGTGCCACTAGGTGGTGGTAGGGTGAATACAGTT
TGTAGTTACTGACTAGCATTGAAATTGTGAGGTTCTTGGTGTACATTAAATGGTGAATCC
CCATTATTTAAAATTTGTGCATAGTGAGATTTTATTAGTAATTTTTATATTGTACTATTT
GATATTGGCGTAAAATCAAGATCCCAAACAAGTGGCATAACCCAACATCTTCACGGTCCT
AAAGCCACATTACAAGGAGATTGTATAGTATTAAAGAATAAAGATTGGTGCGTAAATCAG
AACACTTTCTGAGGCTCTTAAATGTTCTTTGGACAATTAGGGACCATGGAGTGTCTGGTT
ATATCTTTTAAACTATGAGGTTCCATGAATCCAAATTTTGAGGGCTTGGCATCTGTTTTT
ATTTCTCTGTTGACCTGATTTTAAGGAAGCTCTTGGCTCTGTCTGTCATTAATCTCCTGG
TATGTTTCTGTCCATCCTTACTACTCATGAGTCAGCCTGGCTCTAACCTATGAAGGCACA
TGAGCCTATATTTAATGAGCACACGCTACCTGCATTCTAGGAATCTTCCCAGGATTATAA
TGTCGTATTCCTTCTGTCCCCCCAAAAAGTGTGCCTTCAAGAAGTGACTTTCACCAAATT
ACACTAATGCTTGCCCGTCAACAAAAACAGATCAACAGAAGGAGATACTCAGTGACTGTA
CGAAGGGGCATCAAAAAGTTCATGGAGAGATTCCATTATCTTTTCATTCCATTTTTCCAC
GAGCTTTTTGAAACCCCCTGCTTTTGTCCTTGATAGAATTTTGGCTGACTGCATTAGCAT
GACGCCATTGTTAGTCTTTCTTCATTGTACCTTGTCGGGGTTGTTGTTGTTGTTCTTTAG
ATTTCTCTCTGGCACTTTGCTGTTGTCAAGAATCATGTGTGTTTCTTCAAGGGGCTGATC
TATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGGGACACAGAA
TGAAGTTCTAAAGACTTGAACGTTTCCATTTCCAAGCAGCAGAAATTAGAAAGATGATGA
CAAGCTTGATGGGGGAGTGTTTTCTGTTTTGAGTTGCTAACAACCATAAAGGAACTGAGA
AAATAATAATATGGATGAACTGATCATTTATTTGTTAAATTACAAAAATTAATACTTTTT
TGTATTTCACAGCAAAAGTTCAAACAGACCCTCCCTCAGTTCCAATATGTGACCTGTTTC
CTAACGGTGTATTTCCCAAAGGACAAGAGTGCGAGTACCCACCCACACAAGATGGGTAAG
GAACATATCTTCAAAATTGACTTTTGAAAGTTTAAGCTTAGTAATAAAATAAAGTAGATT
TGATAGGTCTCCACTAACTTAAAAGCTTGTGAATTTATTGCAGAAAAAATAGTAGGAGCC
CCTCCCAGAAAGATGGGGACCAGTAGTAGATTGGTGAATCAAAAAGGCAATTACTAAATA
TAAAAATTTTTTTTTAGGTAAATGTCAAATTTCGTATATTCATTCGTTGATCTTGATATT
TGAGCACAGATTTTTATTGAAGTTTTACTCATTTTTTTCCCTTCGTTCCATAAGCTGTCC
ATAATTCAGTCTATGAATTCCAATTTGGATATCTGTTAAGAGGAACAGGAGCTGAGTAAT
ATAAGGACAGATGGCTATAGTTTAACTTGGTCAATTTTTTTTAAATATACACAAAATATG
GCAAGTGTTTTGGGGTGATCTGCCTTAACTGGTACTTTTCAACACAGATTTTTGGTTTTG
TAGAAACGATTATTATCGGGTACATAATTCCATTACACAACCATAGTAACAAGGACAGAT
GGCTTAAACAGGTCTGGGAACAAATTCACCTGTTTCTTAGGTATGTTCTGAAAAGATCCA
TTTCAGCTGCTGACCTTTGTGACATCGAAGTTTAAAGTGATAATGAACNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGGGGGAGAGATGAGGTTCGAGTTTCCGCCTTGGAATCTCACAGGGCCAATTTTT
CCCAGTCCTGTAGGGTTTCTCTGAGCAAGAATTGACTCGATGGCAGTGAGTTTGGTTTTG
GTTTTTGTTGGTATCTATCTTTGATGTATCTCCCCCCCCCCCCCCATTTTCATATTTTTA
TTGTGCTGTTTGGATTATTATTATTATTGCCATAAATTCTTTATCAGAGATATGTTTTAC
AAATATTTTCTTCCAGGATGTGGCTTGGCTTTTATTTATTTATTTTTTCTTTAACAGTGG
CTTTGGAGAACAGAAATGTAAAATTTTGATAAGCCCCTTTGTGGGTCCTACTTTTTTGTG
TCCTAGCTGAGAAGACAAGAGTGTTGCCTCAATTAATGATCTATAATTTATCCCTAGTTT
CTATATCCATTGCAATGGCTACATAGAAACTCAAAGACAAAATTCATGATTGGATGATTT
ACTGAGGAAGCTAACAAGTATAGTGTCAGTGAGAAATACTCAGCATAGTTGTTTAACTGA
ACATGTTACAAAGTTTCAGGTCTGCTAACAGGTGCGACAAAGGGCATCCCACTCTGCTGG
AAGCCTTAACCTGAAGGTTTTCAGCTATAACTCTTTAGGGTCTGTAAACCCAGCTCTCTG
AATTAAGTGCCCAGAGGCACCACACCCTGAGAGCCAGCCTCTTGCACAAAAGCACTCATC
TTAACTTGCTCCATCGGTTGGAAATTCCATTATTCTGTTCCATGCTTTGGTTCCTGGTTC
TGCTGCTGCTTTTCTGATGGTGTAGCTGCCATCTGGATCCAGAAGGTTCACTGCTGCATG
ATTCTTTAGTCCGCTCCTGATTCTTGCTTCTAAGAGGGCTCATTTTATACAGCAGGGAAT
CATATGTGGAATCATTCATAGGCAAATCCTATCCGTATCTTCCCTCATCTTTTTACTGGA
CCCATGCAGGAAAAGGTAATTTGGTTGGAATTGGAAAATTTGGCTCGAAGAGCCACAATG
AATAATTCACTGCTCCCAGGAGCAAAGAGCCCTGGTGGTGCAGTGGATTGATTACACATT
GGGCTTGCTAGCTGCAAGGTCAGCAGTTCAAAACCATCAGCAACTTGAAAGAAAAGCCTT
TTACTCCCATAGAGTTACGTAGTTTCAGACACCTGCAGGGGCAGTTCTCCCTTGTCCATT
AGAAATGATTAACTGGCAGATTTAAGGAGGGAAGTTGTTTAAGATCTGGTATATACTGCA
AGCCTCCAGCGTGTCTGGGTCTGGAGTGACCCTGTGCATTCCTACAGTGCTTGCAAGAAC
AGTTTTGAAACGGTTTGAGGCCTTTCTCTGCACCATCTCCAGAGCAAGGTTATAGAAATT
TCAGACAAACGAAGGAAAAAAAGATCTGGTATACCTGTTAACCATTTCTAGTTTAAAGTT
AAAAAGTGAGAGCAGCAACTTAGGACACTAACATCGTTTTTAGTGGTTTCTTCCAGTTTA
CTCCCCTGTAAAAGGCAGATCAATCTCTAGAAGTGTATGACTAAGCTAAATAATTTAGTC
AGTAAAATTTGTTAAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGGGAAGTCACCGCGTGTGTTGTCCCATGGCCCCCCACCCCACACCCC
CAACACACACACACACACACACACACACTGTTAAAAAGTTTAACTTAAATATTACTATCA
ATAGAAGGATGAGGGTTTTTTACCCAATTAGTTTTCTAGAACTCCTCTCAGTTTTCTCTT
TTTTTTATTTTACGTTGGCCAGCTATTAGTCCCTCCGTCTATGAATGAAATCTCACTTGA
AATTTTTTCTCCCTCTTAATAAGAGAACTTGACTGTGGTGAGTTCAAGTATGTGTCTACT
TGTAGTTTAGAAAGTTGGCAGACATTTTATCAAAGAGGCTGAAAATGTAACAGTCTTTTT
GTAAAATATCTTAAATTATTTAGTACAAGGAGGCTTCGACAAGTTGGAAAAATTCCATTT
ATCTTTTAATTCCTTTCTGCCATGAGCTTTTGAAGCACTGTGGTATTATATCTCCATTAG
CTTTTATACTTGTTCTGCTGTTTCTTAAATTCACTAACACTATGTTTTGCTTACTCTAGG
CGAACAGCTACTTGGAGAACTACAAGTGAAGAAAAGAAAGCATTAGATCAAGCTAGTGAA
GAGATTTGGAATGATTTTAGAGAAGCTGCAGAAGCACATCGACAAGTTAGGAAATATGTT
ATGAGCTGGATCAAGCCTGGAATGACAATGATAGAAATCTGGTAAAGTGAATATGTTTTT
TGTAAGCACGATTTTCAAAAAACTTTTTTAATTGCCAAGTCTCCAATTGCAATATACCAC
TTTGCTAAAAATTTTTTTTAAATAGACATTTTAAACATCTCTTCTATATTCTTCTAGTAA
TATAGATATATCATGAAGTCTGAAGAGCACTATAAGTTTGGACATTGGCCGCCAAATTTG
GTACACACTCATGCATGAATTAGACTGATGTTCATTTTCTGTCTGGAAACCTCTTTTGCT
ATTGAAAGTTAATTAACTTGGATTAGTAGAGTAACATTTTATAATACCTTGGAGTGAGAC
AAAACATAATAATGCAGTGAAAAAAACAGTAATTGTTTGATAAGCTTTCTGGACTTGGGC
TGTGAATGTGAACGTAAACCGAATACCTTTTTTTCTTAGTGAAAAGTTGGAAGACTGTTC
ACGCAAGCTAATAAAAGAGAATGGCTTAAATGCAGGCCTGGCGTTTCCTACTGGTTGTTC
TCTCAATAACTGTGCAGCCCATTATACTCCCAATGCTGGTGACACAACAGTATTACAGTA
TGATGACATCTGTAAGATAGACTTTGGAACACACATAAGTGGTGAGTTCTGTACCCTACC
TCACCCTCCCGTCTAATGGATGAAGCTATGGAGAACTGAACTCCCAATTTTGTTCTTAAC
CCCTGGCCTTTTCAGTGTAGCTATAAACTCCTTGCTGTCAACTCAATTTGGCTTGAGCAA
CCTATGTAGGGTTTCTGAGGCTATACATTTTTACAGGAGTAGGTAGCCTCACCGTTCTTC
CACATAGTGGCTGGTGGGTTTAAACCTTCAGCCTTGTGGTTAGCAACTCAATAACTATTC
CACAGCATCACCAACCAAAACCCAACCAAACTCATTGCCATTGAGGTGATTCCAACTCTC
TTTAATAGGAGGAGGTAGAACTTCTTCTAAAGCAGCGGTTCTCAACTTGTGGGTCTTGAC
TCCTTCAGGGATCGAACAACCCTTTCCCAGGGGTCGCCCGATACATAACAGTAGCAAAAT
TACAGTTATGAAGTAGCAATGAAAATAATTTTATGGTTGGGGGGCCACCACAACATGAAC
TGTATTAAAGGGTCGCGCATTAGGAGGATTGAGAACCACTGCTCTATGGGCTTCCAAAGT
TGTAAGAACTCTTAAGTAGAAAAGTCTACTAGTCTTTGTCCCCCGAGAGCTGCTGATCAT
TTTGAACTGCTAACTTTGCCGTTAGAGCCCAATGTGTAACCCCTGTGCCACAAGGACTGC
TTAAGTACTTAACCTAAGGCTGTACGAAATTGCAGAAGCTAGGACTCGTGCTCAGCGACC
TGTGGTTCTGTACATTTTTTTAAACAGGTTTATTGGCACTTCACATATCAAGAAGAGTTG
TACAGTCTTTACCACAGTCAATTTTAGAACATTTTCTTCTTCCTTGTACTCATTAATTTG
TGTAAATTTTTTTTTCAATTTTGGCCCAAAGATAAAACAAAACATTCTCCAATTCAACAA
CTTCTACATGTATATTTTAGTGCCATTGATTATACTCTTCATGTTGTACAACCATTACTG
AAATTCCCCTCTAAATTTTTTCACCACCATTAAAATAAATTCAATGCCCTCCCAGCAAAA
AGTCTTCCTCCTTCAAATAATATTCGCATATCATATACTTCCATATTTAAGTTGTTTTTA
AAAAGTTATATACACATCATGACAATCAGTTCTAGCACTCCTTCCCACTTCCCGCATTCA
TTGATTGCTCCCCCACCCCCAATACATTTTCTGTACCCTATTTGCTACCTTAGTTTTCTA
GAGCTGCAGTAACAAAATGTCACAGATAGGTGGCTCTATGGACCATAGTCTATTTTCTCA
CACTTTCTGAGTCTAACCGTCCAGGTTGGGCCACCTACCCTGTTGTTTCCTTCCAAAGGC
TTTGAGAAAGGAACTGTTCCATGCTTCTCGTCCAGCTCTGGTTTCTGCCGGCAGTCTTTG
GTGCTCAGTTGCTGCTGACAGATGTGTCTGTACATGGCAGCTTCCCCACTGTGTCACTTG
TGTTTCTCTCCTCTTTGCTATGACTCCACTCAGAGATTAGGACAGGTCTACTCCAGGATG
AGAACCTCAAACAAGCATCTGCAAAGAAAAGTCTTTCCCTAAGCAAGGGCACACAGATAC
AGGGATTAGGATGTGAGTATCTTCAAGAACAGTTTGATCCAGAACTCCTGTTTACTCCCT
GTTCTTTCTGATGGAAGGTTCTGTTTCCTCGTGCTTATGTGAGAACTGAATTTCTGTTGC
CTTAGCAGTGGTTTTCAACCTGTTGGGTCGCGACCCCTGTGGGGATCAAACAACCCTTTC
ACAGGGGTCACTGGATTCAAAACAGTAGCAAAATTATAGTTATGAAGTAGCAACAAAAAT
AAATTTATGGTTGGGGGTCACCACACATGAGGAACTGTAAAAAGGGTTGCGACATTAGGA
AGGTTGAGAATCACTGCCCTTGAGCCTTCAAGAGGTCTTCAAGAAGTTTGTGTACAAATA
GAATTAAAAGATAGAATGTCTCCTTGCATTGTTTGAAGATCCTCTTATGTACTGGCCTTA
GAATTAGTCTCTTCATTCTAGAACCTTTCTTCATACATTTCCCCCTCTTTGACTGTGAAT
GATCTCTTAGTATGGGGTTCTCTCCTCTTTTGAGCCCATCATTTTATTTTGCCTGTTAAA
TATCTAGGGTACTTAATAGAATAAATAATACAAAGTAGATGAAATGAGCAGCTGGTTTTT
AAATTTAAAAGAGGAATTTTCTCTTTCAGGTAGAATTATTGACTGTGCTTTCACCGTCAC
CTTTAATCCCAAATATGATATGTTATTAAAAGCTGTCAAAGATGCCACTAACACTGGAAT
AAAGGTAGATGAGCCGTTTAATTGTGACTGTTTCTTAGCATATTGTTTGAGGTCTTCAGG
CTACGACAATGAGTACTCTCTGGTAGTCTGTTCTTAAAGCCTTATGTGGGTAATTGTAAT
AGTGTTCCATGGGCCTTTATGAAAGAAGTTGTAATGTACAAAGAGTTTTTATAATTGTCC
ATTGTCTTGAAATGTTTAGGGAGAAATTAAAATTTGCACTTTGGATTAAAAATTTCACAC
TATTCTGTTTTTAGTGTGCTGGAATTGATGTCCGTTTATGTGATGTTGGGGAGGCCATCC
AAGAAGTTATGGAATCTTATGAAGTTGAAATAGATGGGAAGACATATCAAGGTATGGTCT
TTACGTTTTTAGTTTTTTTAAATGCACATGGCCGCTGCAGAATTAATTTAAGTGCTTTCT
TCAGTCAGCTGCTTATCTTACTGTCTTGGGGATAAAAAGAAAGAAAATGGGATTAGGCCT
GCTCAGAGGAATGTGAAGCTGTGTCATAGGTTAGCAACTGTTGCCAAATCATTCTAGTGG
CTGATAGATAATAGGATGATCAACATGCAGGCTTGGTTTTGAGTGACTAGCCAGATCAAG
GCTCAAAAGCTGGGGGCTCTTTCCATTGATGAGTTGGATTCAGAATTTGAAGGCTGCCAG
TCCCGATCTGGGTCCTTCCTTTCATCTTTCTCAGTTGCTTCCTAGTTTTCCCAGGGTCTT
TAGGGATAAAGCCCCCCACTCCCATCCCAGTGCTTTCTGGTGCTCTGTACTCATCTGTTT
GTCTGTCCTGCCTGCAGCCAACAGCATGCCTTGTCTGTTATGTGCATTTGTGTTTATGTC
TTTATTACCTAATTATGCCTATGTAAATAATTGCTTTAAGTATGCTTCATTTTGAATTCT
ATAAAGAATTGCATAATTGTGTCTTTGCTCATATTATCTTTATCCTTAGATTTTCTTTTT
ATTGTTGCCCTGTTAAAATTTGCAAATAAACCAGTTTGTTGATTATTTCTATCATTCACC
TAAGCATATTTTGTAGTTTAGAATTTTCAGACAATTATATTGAGATGACATAGACTGTAA
TTCTGTCAAAGCCATTTCATTACCTTTTTAATTTGTGAAAAATATATATGTAACCATTTC
AACAATCATCACATATACATTTCGGTGGTATTATGATCATTGTTTAACCATCACCCTTCT
CACTATTTGTCACTGTTAACAGCACATTGTTTCCTTACATTTTGGTCTATAACCAAACAA
ACGTGTTTCGTGTTTGTAATCATTGAGTATATGATACTTTGTTAGTCTTAATGATGTTAT
CTTGAAAATTACTTCTTTACATGGCTCTCATTGAGAACTCATCCTGTAATTCTTTTTTGG
TTACAATTTTTAGCCAATGATCTTTCAACATCTTTTCATATCCTATTTAGTGAATTAGGT
TTCTAATTCAAAAATAGCTACTTTGTCATTACTCAGTAGTGCCATACTGTGTTCCTAAAT
AAATGCCTGAACTCTGCCCATTAGCTAAGAGATCTCTTTGTGTTTTGAGACTAAATGACT
GTTATTTTCCCGTTATGATAGTGAAACCCATCCGTAATCTCAATGGACATTCCATTGGGC
CATACAGGATACATGCTGGGAAAACGGTGCCCATTGTGAAAGGAGGGGAGGCCACAAGGA
TGGAGGTATGTTTGCCATTAACACTTGCTCTTTTGATCATTTAAAATATACGGTATGTTG
AGCAGAATAAACTTGCCAGCCCTGCCCACCGCAGCAGAGGAAATTGGGCTGTGTCAATGT
ACAAAGTGGTTCTAGTCAGACCAGTGCTGAGTCTACCATGGGAGTTGAGGCTGTCGAAGG
ATTGATTATTCAACACTTAATATTTATTAAACAACTGCTGTGTACCAGTCTCTTTACTAG
GCACTGGGTCTATACTGCCTTGAACAAAACAAAGAAGTTCCTGCCCTTGTCAAGCCGATC
AGGGGTTTGAGAGGGTAGGGAATTGAATGTGCTACAGTCACCAAGTGGGGAAGGGTTGGG
TGAGGGGAGAGTGCCAGAGAGTATATGTTCATGCTGTTCTTAAATAAGCTTCAGTCAGAA
ATGAAGATAGCACTTGTAATTACTTTTTACTTTCTCTCCTTGACTTGATCATTATACCTT
GAAGGAAGGAGAAGTGTATGCCATTGAAACTTTCGGCAGCACAGGAAAAGGAGTGGTTCA
TGATGATATGGAGTGCTCCCATTACATGAAAAATTTTGATGTTGGACATGTGCCAATAAG
GTGAGAGGCTTGGTTTTGTTTTTTTACTATTTTACTTCCCAATTTTAAAAGACAAACTTC
CAAGGTGATAACATTCATAAATATGGTTGTACCTCTTAACAGTAAGTTCAGTTGATTCTG
TAATATAACAAAGAAATTGGCCTTAGATCCAGTTCCTAGGACTTCTCAGAATGCCAGTGT
TATTTTGGTAGCACCTCTAGGGCTTTTTCATATCTTCCCATCGGTAAGCTTAGTATTTTT
GCTATTTATTTTTTTGCCTTTTGTGGAAGGTAGTTGGAAGAATAGATTTATACCTAATGG
AAGGCATTGAGCTTGATGGACAGAAAGGAAATTTATTTTCATGGACTGCAGAAAGGAGTC
CTGGTGGCAAGGCTGGTTTAAGTATTGGACCGCTAACCAGAAGGTTGGCACTTCTAGTCT
ACCAGCCACTCCACAGAAGAAAACGGAGGTTATCTCACTACGAATCAGAAGTGACTTGTT
AGCAGTGGGTTTGGTTTGCGACTCTACGTGAGTATGTATTAGGAGTTAACACACCTTTTG
CATGTACAAGGAACACTCATCTATACTAGGTGGGTACACATTTATTGCCAGTGGCCATGC
TGTGTTCAGCGGGCATCTATAATTAAATACAAGACTACTATACACGCTTTTGATTGAGCG
GCAATTTAAAAAGGGGGCTTTGAATCTTGATTATCCAGTGAAGCCTAGATTGTTTTTTTT
AATGGGGAAATCTTTGAGTTGGTAACTTTTTCAGCCAACCATTAATCTTGGAATTTCTCC
TCCTAGGCTTCCAAGAACAAAACACTTGTTAAATGTCATCAATGAAAACTTTGGCACGCT
TGCCTTCTGCCGCAGATGGCTGGATCGTTTGGGAGAAAGTAAATATTTGTTGGCTCTGAA
GAATCTGTGTGACTTGGGCATTGTAGATCCATATCCACCGTTGTGTGACATTAAAGGATC
ATATACAGCGCAGTTTGAACATACCATACTGTTACGTCCAACATGTAAAGAAGTTGTCAG
CAGAGGAGATGATTATTAAACTTAGTTCAAAGGCCACTTCAACACCTTTATTTTCTAAGC
TTTGTTGGACACTATACCAGATTTAATGTGCAACAGATTGTCTTTTAACAGAGGATCCTT
TAAAGCTTTTATCCATGTTTTAAAAGAAATTTGATCAAAGGTAAACCTTCTAATGTAATT
AAATTTACCAAGAGAAAAGAAGCTTTCAGGACTTTGAGAAATGTTAACTGTTTTTCTCCC
TGGTGTAGGAAAATATTAAAGCTCAAATAAGTTAGGAATGAGTTACACATTTCATTTGGA
ACACCTCAGAAATGCTTTTCAGATATTTATATTACCATATTCCTACTTGGATGCGTTCAA
TGACTACAGCCAATTCTGCACTTATACCCTCTGGTATTGCTTTTTAACCTCCTGAAATCC
ATTTTCTAAGAAATAAAGATGTTTTCAGATCTGAGAGCTACACTTCAATGTCTGCGGTTA
TAATTCTGGACAAGAAATACTGAAATTTAACATAGGAAAATGTAGAGCCTTTGCATAGAT
TGTAGACATCTGTACTGGACTTTCTTCTGACATAGTGGCTAAAATAAAATATACATACAC
AAAAGGGGACAGGATAATTTTCTTAATGGAGCTTTGGGGAATAGTTTTGTTTATAGGACC
ATGTTGATCCTTTCTCCCTCCCCCACCTTTCCTGTAAAGCCCTAACAAGTGAACATTACT
TAATGGGAACATTTTTCCCACTTGAAGCCTTGTTTTAGCAAACTTGTGACATTTTAGGTC
CTTCAGTGGTTGTTTTTTTTTTAATTGGGAGATATGTTCATCTTTGTCAAGTCAGGATGG
GCATTGAAAGCCATAATGGCAAAGAAAAATCATCACGAAAATATCCCATCTTGTTAGTAA
AGTTAAATTGACACTATTGGGCTTTTTCATGAGTCATTCTGTAACATGCTGCCCTTTGAG
TGGCTTGCAGTCATAACATGGATAGCATTTCAGGAAGGGAGGTTGCAGCGGCACTCCCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1033, 2942..2966, 3070..3162, 5444..5545, 8488..8553, 10212..10314, 26159..26320, 26739..26920, 29129..29223, 29474..29570, 30801..30904, 31384..31499, 32286..32538
1001..1033, 2942..2966, 3070..3162, 5444..5545, 8488..8553, 10212..10314, 26159..26320, 26739..26920, 29129..29223, 29474..29570, 30801..30904, 31384..31499, 32286..32535
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved