Echinops_telfairi Locus NCUBE1
snOPY snoRNA Orthological Gene Database
Echinops_telfairi NCUBE1
Echinops_telfairi
NCUBE1
GeneScaffold_2231
SNORA70
6516..6649
19864
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCCTCGGCCCGGCG
CTTTCGGCCCGATCCGCGCTGAGACCGGGCAGCTGCGGTGCGGTGCGGAGACGCGGCGGC
GGCGACTGGCCGTGAGGCGGGAGCCGGGCCACCGACCCGCCATGGAGACCCGCTACAACC
TCAAGAGTCCGGGTGAGCACGACAGGGGACCGGGGCCGGGGGGCGGCCTGAGCTGAGCGG
ACCGAGCAGCAGGACAGACTGCCCCGGGGCTCCGGGCTACAGTCCCCTGGTGCCCGCCAC
TACTCGGAGCTCTGCTACCGGCTTCACACTCTACGCGAGGCCGCCGCCTACCGGGGAGGT
GCAGGCCGCGGGCGAGGACACACCGGCTGCCCAAACCGGGGTCCGGCCACCGCCTTGCGC
CACCCTGACTTTCCTTTTCTGCTCTTCGCCGGGGTCAGCCATGCCTTAAACTCACCAGTG
AGAACAGGTGTAGAGGTGGTGTCGTGAGGAATCGACCTGCACCCCGAACACCGGGCCCCC
ACCGGACTTTTATTAGCTGCTCCACGCACCCGCCTTTGAGAATTCGGTTGTCTCCTATTT
GCAGTGTTTGGGCGAATAGAATTTCAGCTATAAAGGAAAATGTGATGTTCTGAACTAGTT
AACCGAAGAACTAGAAAGCTGGGAGAACCGAGTACTTTAGAGTTAATCATGATTTTGCCA
AACGGATGAGAAATTTGTATTCAGCCCTTGAGTTTTTTCCTCCTGTATTAATGCAGCTGC
TTCGTTTACAGAAGCACCTAAGCATTCCTACCTTCGGGTTTTTTGGGGTTTTTTTTTTTG
GTGCATTTAAAAATGCAGGAAAAATACCTAGCATTCCTATGTTAAGGCAGATTTGAATCA
CGGGGTTTAGAATGTTATTGGGTCTAGGAGCCCTGGTGGTATCATGGGTTATGCGTTGGG
CTGATAAGCACAAGGTCAGCATGTTCGAAACCACCCACTGCTAGAGAAAGATGAAGCTTT
CTGCTTTCAGTGATTTACAGTCTCCCAAACTACCCTGCCCTAGGTCACTATGAGTTCGAA
TCTCTTCATGGCTGTGAGTTTGGTACCTCGATAACCTCAGGAGAGGGGAAGAATAGCTCT
AATAAATCCTAAGCTATTTAGTTTGGTGTGTCTAACTCTTGCTGCTTGTTTTTTTTTTTC
CTTCCCTAAGTTGACACTGTGACAAAAACAAATCCTTCTGATTATACAAAGACTCCTGAA
AAGCCGGAGGCTGTTGATTAAGTAGAGCCTCAGTAGCCAGAGCCATCAGCTAAAAAATNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCACCAGCTGCACCTTAGGAGAGAGACGAGCTTATTACTC
CCCTGAGTTACAGTCTCAGAAACCAGGAGCTGTTCTACCCTGCCCTGTGGGGTCACCGTG
AGTCAGAAGAGACTCGACAGTGAGTTTGAGGTCTCTTTGAATTTCCACAAAGGTGGTGCT
GTTATTCTAAAAGAAAATTTCAAAATGTTGTTGCTGTTTATTTAGTATATGGCCCATTTG
AAGTTCAGAGAAGTGCATTAGATGAGAGATGGGCCTTACCGAAAATACCAGGAGTCATTG
TAAAAATGCTTTCTTTTATTTCATTCTCAGGTCAGTGATACCAGGGGGGCTTAACTCTTT
TTTTGCAAAAATTGCATTATCTTTCTTTTCTAAAACCTTTTTTACTGTGAATTAGGTGAA
GGTTTACAGAGCAGATCATCAGTTGTACCTTCAACAATTTATACATATTTTGTTTCAGTT
CATTCACTACAGTGTCAGTTTTTCCATCCCTCTTTCTTTCCTAACCTCCTGTACTTGGTC
CTCGGGTAAATGTTGCCCTTTTGATCTTAAACGGTTGATTATTCTGGCATGGTGGTGAGT
ACCTTTCAGACCTGAAGGGTGACTAAGGGCCATGGACGCAGCATTGCTCTGGATCCACCA
CCAGTAGGCCTGTTCTCCGTAGATAATCAATTTTGTATTCAGCAGTTTAAACTAATCAAA
GATCCTCATTAGCTTATCCTATTGCCCTCCTTTATTTTTCTTTTCTCTCATGTGGATTAC
TATCTTCTCCTTCACCAAGTTAATATACTCAGCCCTCTAGTCTATTGTTTCATCTTCCAT
CCCTTCCCCTCCCCTCATTGGTACCTTCAGCGCCTGTTCCCATTGTTAGGAGAATTTGTG
TCTATATATATATAATAATGGTCTCATACAATATTTGTTTTTTTGTGATTGACTAATTTC
ATTCAGTATGTCTTCCAGGTCATTCCACACCAAGAGGTGCTTTACAGTGTCATCATGGGT
TTTTAGGGATGCATAGTCTTCCATTGTGTGAATGAACCAGAGTTTTTTTATTCTTCTACT
GATGGACATTTAGACTATTTCTATCTTGCTATTGTGAGAAGGGCTGTGATGGATGTGCAT
TGGTGTGCATATGTTTGTTTGTGCTATGACTCTTCTTTGGGTCTGTATCTAGGTGAAGGA
CTACTGGGTCAGATGGAATTTCTGTTCCCCATGTTTTGATGTGGTGCCATGCTGCTTTGC
ATACTGGCTATACATATTTACAGTCTCATCACCTGTGGATGTGGGTTCCAATCTCTCAGC
ATTTCCTCTAGCCTTAGTGGTTTTCAAATTTGACTGTCCAATCTCTCAGCATTTCCTCTA
GCCTTTTCAAATTTGGCTGTCATTGTTGGTGTAAGGTGTGAGGTTGATGTAAGGTAGTAT
ATCATTCCTGCTTTGATTTGCATCTCCCATGGCATTTCTTAATGGTTGTTACCTACTTGG
AAGTCATCTTTGGTGACCTGTCCATGTCCTTTGCTTCTTTTTTAATTGAATTTTCTTTTT
CTCACTGAGGTGTTGCAGTTTTTTATAAATTTTTTCTCTTATCCATTTTGTTGTTGCCAA
AAAATATTTTCCCATTTTGTGGGTTCTCTTTTTATTCTTTTGATTAAGTCTTTTGATGCA
CAACAGGGTCTTATGTTTCCTGGGTCCAAGTCGTCATTTTGTCCTCTACTGTGTGTTTTC
CTTCTTTATATTTGATAGTGTGTCTGTGTCCCAGAGCCTTGGTGGCTTAGTGGCAAGGAA
TTGAAATTGAAAACACCAGCTGATCCTCAGGAGAAAGATGAGACTTTCCACTCTCGTAGT
GAGCGCAGGAGCAGCTCGACCCACTTGTACTGGGTGTCTATGAATTGGAATCAACTTGAT
GGCTGGGAGTCTTTGAGTGAGTCTTTGCTTTGCAATGGCCCTTTATCTTTGTTCCTGTTT
TTCACCGATGGTCTTTAGAACTCTGGGATTTACACTGAGTTGATTTTTGCATATGGGTGA
AGGACGGTCCTGCTTTATTATTCTGCAGATGGAAATCCAATTTTTGCCAGCACCATTTCT
TAAAGACACTGTCTCTTTCCCAATTAATGTTTTTTGGGCCCTTTTGTCGAAGAGCAGAGG
GTCTGTGGGTGAATGGATCTATTCTGGGGTGCTCTGTTCTGTTCCATTGCTTCTTTGCAG
TTCTGTTATACTAGTACCAGGCTATTTTTGAGTACCATGGGCTGTGCATAAGATTTTGAG
GGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAATAAGCCGGTGTT
CTGCCAGCCCCTAGCGACGGCTTCCTGTCTCTCCTCTCCATAAAGCTTTTACCATATGCT
CCCTTGAACTAGTCCTCTGCATGTTTTTTGTTGCACTGGAAACTTTTTCATTTGGCTTGT
CAATCTACAATTTGCTAGGAAAGGTCGTTAACTATTTCCCTCTTACACATCTGACTTCAG
CCGTTAAGCGTCTCATGAAAGAAGCAGCAGAACTGAAAGATCCAACAGATCATTACCATG
CACAGCCTTTAGAGGTGAGTTTATATTTTTATATCATCCTTTGGATTTTAATGCATCAAA
TTCCTTAAAATGGTCTTTTTATTGCTTTGAGGCATTATTAATATGTGTGATGTGATTTAT
TGATCGGTCGAATTATATTGCATTAGCTGTTCTGAATGAAGGAAACACTTTTCTACTCCC
TGTAAAATGGATTTCAGGTCTTGAGTTGTGTAGGGTGGGAAAGTGGCCAAAGCTCCGGAC
TCTTTAGTTTGGAAGGTCCAGGCTCTCAGTGGCACTCTGCAGCCAGCCCGGACACTTTCA
TGCCAACATAGTCACCTTCTCAGGGAAAGAGGGGATTGAAATCTCCGTGTCATTTCCATG
GTAATAATGAGAATAAATTGTAATAATGCATGTGCAATATTGTGTAAACTGTCAAGTTCT
TGGTAACTATAAGACAATATTAGTAGCATACACAAGCTTATTTACTGTTTATTAATGTCA
AATTTAAGCTTATACCATATATACTCGTGTATAAGCTAAGTTTTCCAGAGCATTTTAAAT
GCCGTTTTTATGGTAAAATTAGGTGCTTAGGATGATATTCGGGTCAGCTTATACTCGAGT
ACATACGGTACTCTTATTTATGAATACATAACAACTTAAAAGTTTTGTAACGTTTTGTTT
AAAAATAATGTAGCTCTAATAGTACATTAAAGCTAGATTTAATAGCTACCCAACTTTAAT
TCTTGAAACAAATTTAATGCATTAGAAACTGTTCTAGCAATAGATTACAACATCTACTTT
TTTGTGGCCTAGTAAGATTTCTAATATTCATATTGGTCATAAGTGTTCAACAGTAATGTT
AATGAATCCTTGTTTTGTTTTAATTCAGGATAACCTTTTTGAATGGCACTTCACTGTTAG
AGGGCCCCCAGATTCTGATTTTGATGGTGGTGTTTATCATGGACGAATAGTACTGCCACC
AGAGTATCCTATGAAACCACCAAGCATTATTTTACTAACGGTAAATATTATTTATGGCTT
TTGGAGAATGCTGTGGTTTAATTCTTCATGGTGACTAAAAGTCGAACATTGTTGTAATTT
TGTGTTTGGAGTTCCCCTCTAAATAATTCCTAGTATCTGCAGCCAATTAAGCCGACCGTC
CTCCTCCTCGTGGGGGCCGGTGTGCAATGGCTGCATACAGCAAGCCTCCTTGGTAGTGTA
TGCAGCCTATTGGTATGTATAGGCTGCCCTAAGGGACCTTGGAGACAACCTTTTGCTACT
TTTCGATGCCACTGGTCTGGCTAATTTCTGCTCTCCCTAAACTAGGCTCCAAACTGGGAT
GCGAGGTGCTTTTGGGAAACTTCAAGGCACAGTGGCTAGAGTCCACATTGGCTAGGTTAT
CATGTCCATCTGCACCAAGCCTCAAAACAAGGAACATGTTTTTGAGGCCTTACACAGGGC
CAAGTTCAAGTTCCCTGGGCGCCAGAAGATCCACTTCTCCTAGAAGTGGGGCTTCACCAA
GTTTAATGCTGATGAGTTTGAGGACATGGAGGCTGAGAAGCGCCTCATCCCGGATGGCTG
TGGGGTCAAATACATCCCTCATCGTGGCCCCTTGGACAAGTGGCGGCCTTGCATTCATGA
AGGCTTGGTAGCCCTGTGCTGCCTCACTGTACCCATCAAATAAACATTGAGCTTCCTGGT
TAAAAAAAAAAAAATTCCTAGCATGCTGATACATTGAGAAGTACTAATGATAAAATAAAT
GCATCACTGTGATCGTGTGGTTAATTAGTATTTAATGAATTAATATATCACAGTACTGAG
CATAGTGCCTAGTATATTATAAATAAACAATAAGAGTAGCTAACTCCTGTCCTATGCGTC
ACAGTGAGTCAGAATTGATGGGCAAGAAGTTTCGATTTTGGAATGGTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAACAAAATACCAGCGAGGAATGAG
TGTCACGGTTCATGTCAAAAAAGGAACATTTCTAAGGATCTGTCTTGAAGTACCATTGCT
GGACAGTAACTATATGAATACAAGGGAAATCCAGTTAATACAACTATTAATCAAGTATGC
CCACCAACTATTAAGTCTAGTGATGAAGAAAATTGAAGAATTTTACTAACTACTGGTACT
TCAGTCTGAGATTGATCAAACATGCAATTAAGATGCATTGATAATGATTGACTATTGGGA
TGCAAAAGTTGGAAACAGAGGAAGGAACAGTAGTTAGAAAATAAGGTCTTTAAGCAAATG
TGGTGAAGAAAGCTGATGGTGCCTGGCCATCAAAAGATATAGTGTCTGGGGTCTTAAAGG
CTTGAAGATAAACAAGCAGCCATCTAGCTGAGAAACAACAAAGCCCACATGGAAGATGCA
CCCAGCCTGTGTGATCATGAGGTGTCGATGGGATCAGATATCAGGCATCAAAGACCCAGA
GCGAAAAATCATAATGTGAATGAGGAGGGGAGTGCGGAGTGGAGGCCCGAAGCCCATCTG
TAAGCAATTGGACATCCCCTTGCAGAAGGGTTGTGGGGAGAAGATGGGCCAGTCAGGGTG
CAGTATAGCACCGATGAAACATGCAGCTTTCCTCTGGTTCTTTAATGCTTCCCTCCTCCC
CTCCCACTATCATGACCCTAATTCTACCTTATAAATCTGGCTAGACCAGAGCATGTACAT
GGGAACAGATAAGAGCTGGAAACACAGGGACAGATAAACTCCTCAGGATCAAGATTGAGA
GTAGCCATACCAGGAGGGGAAGGGGAAGGTGGGGGGAGAAGGGGGAACCGATCACAATGA
CATATCTATAACCCCTTCCCAGGGGGATGGACAACAGACAGGGGGTGGGGGGAGACATCG
GACAGTGCAGGACATGAAAAAATAATGTTAGAAATTATCAAGTGTTCATGAGGGAGGGAG
GGAGCGGAAGGGAAGGGAAGGGAAAAAAATTACCTGATACCAAGGGCTCAAGTAGAAGGA
AAATGCTTTGAAAACAATGATGGCAACAAATGTACAAATGTGCTTGAAACAATGGATATA
TTGTATTGGATTGTGATAAGAGTTGTATGTGCCCCCAATAAAATGATTTTTTTTAAAACA
TTTTATTAGGGGTTCATACAACTGTTATCGCAATCCATACACACATCAATNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTGACAAGATACAAATGGAAATGTTTCA
ACAAGCTGAAGAAGCACTGGAAGCACTCACTGATCTAACTCAAGAAATTTGGAAAAGTTA
CCAGGCAACTGATTGGAAAGATCCTTATTTGTGTTCATTCCATAGGCAGGCGACCCCGCA
GAATACAGAAATTTATAGAACAGTATCAATACTACCCATGCAATTAAAATTTTGCTGTAG
ATCATTCGACAATGGCTGCAGCAATACATCAACAGGGAGCTGCCAGAAATTCAACCTGGC
TTTGGAAGAGGACATGGCATAAGGGATATCTTGTGCCTGACCCAACCCATGGTATTTTCA
ATCACTTCATATGCATGTGAAAGTTGCACAGTGAATAAGACGAGTGGATGCATTTTAATA
ATGGTGCTGGTGAAGAATATTGAAAGAGTGGTGGACTGCTAGAAAGCAAACAGTCTGTCT
CACAAGAAGCCTAGCCAAAATGTTCCTTAGACGCGAGGATGGTGAGACTTCTCGTATACT
TGGACATATTATCAGGAGAAACTAGACCCTTGAAAAGGACACAGTGCTTGGTAAGGTAGA
AAGTCAGGAAGAAGAAGACCCTTGATGAGGTGGATTCGCACAGTAGCAGCAACGATGGAT
TCAAACAAAGCCATTGTGAGAGTGGTGCAGGACCTTGCAGTGTTTCATTCTGCTGTACAA
AGAGGTGCTCTGAGTTGTAACTGGCACCATGGCACTTCACAACAACTTTATATATGGGAG
TCGTGGTGAAATGGTTAAGTGCTTGACTGTTAACTGAAGGATGGATGGGAAGACCTGGTG
ATGTGATATGATATCATAAACATTACTGCCTTAAAAACCCTATGGGGGAGCTATACTCTG
TCACATGGGGTCACTGTGGGTCAAAACTGACTTCACCCACGGATCTCCTTTAACTTTTCT
TACTTTCTTTTGTCCTCATTTTCCTAGGTTTTGTAATGTGGATAATAATATTTACATCAT
TGAATTGCTTTGGGATTAAGTGAGTCAATATCTTACAACTTTTAGAATTGGGTCTCAGTT
AATGTTAGGTGTTATTACTATTTGTATCTTAGATTTTTCTCTCCATCTTCATATATTGTA
TCCTTTATGTGAAGAAAAGTTACTTTTTTTTTCTTGGACCTTGATCCATTTGTAAGTTTT
TCTTTGATTAAGCTTTTCTCTTTCATTTCTTTTTAGTTATAACTATGTTTAATTATCTAA
CCATCAAAAAACAAGCCAAACACAAAAGCCTTCATATCTCACTTGCTAGCTCAAGCTGTA
GTCCTATTTTTCTCCCTCTCCCACCTTTAAGGATCTGCTCTTAGCCTGTGGAAGTTTGGC
TTCTATATCTAGCAAGCACTGTTGAATCATGCTCACTATAACATTTTCAGAGGCCAGTTT
GAGAACTCCCATGACCTCTTCTCAGCTTCTTCCAGTTCCAACTAAATTAAGTATTTCACA
CACACACAGGTGGCAGATGGTGAACCAAAAGGTATTCAGTAAATTTCAAACTAATGCCCC
TTTATTTGGTGTAGTGGAAAGAATACTGGTGTTAAAGCCAGTAGATCTGGATTCTCAGTC
TTACTCTTTCTGCTAAATCATGGGCAGATAATATTAGCTCTACGAAATTCAGACTTCTCT
TGTCAAAATGGATGTTATATATGATTAATGCACCCACAGTATAAAGTTGCTGGCATATAA
AACTTCCTAACAAGTATTGGATGAGATTGAGAATGCTAATACTGGCAATAGGGCTGGAGC
AGGAATTACTACTGTCAGGTGTTACTGCTGTGAGTAGTAAGATCAAGGAGAAAGGGGTTG
CTTGGTACATGGGAAAAGCTGGGTGGGGAAGTTGGGGCAGCAGCTGTTTACCAATAAGAA
CCACAATTGTATCATTGGTATGGTCATGTTTCAGCATACTGGCTGAAAGTCCTGCCCTTC
TGGTCTTCAGTATTGTACTATTTCCGGTTCTCTTCGTCTCTTTTGAAAAGCTTTCTTCAA
CCTTTATTCAGCAAGTATTCATTAAACATCTGTCATGTCCCAGGCCTTGTGAGTGTAGCA
GAGAATGTCAAAAGTCTACCCATGTAGAGCTAATATTCTGACTTTATGCCTCTTTTTTCT
CATCCTTCCACTGAGTATGAATATCTTATAAGTTCAGACTTTAACTGTTGTCTCCATTTG
TATGAAGTGGGCTTCAGTGAATCACCTCTGTGAATACAGTTACCAGATCTCTTGACATAT
CTTCTGACATCAAGTTTTACTACTTTTCCACATGCCTGCTAGCATCATCAATATCTGAGA
CCGCAGACCCATGTTCAAAACGGAAATAATGATCTGACCTTCTTTTTCGGTGTTCCTGCC
TTATCACATGGCGTCTTCTTTCTGGAAGGCCCTCCTGCCCCATAGCTCAGAACCTTTTCT
CTGTGCCCTTTCTCACCAGCATCTCATTAGATGATACTGAATCCTTAGATTTTTACCTTG
ATTGTCCCTTAGCCTCTTGCTTTATGTCATTTCTTGTCTAGCATGAATTATAGCAGGAAC
TGATTTAGATCATCAGTAAATCTTCATATATTAATTATTTAGAGTTAGTTGTACAACTCA
GTTTCCAAAAGGTGCTACAATTTCTAAAAACAGCTTATATGGCTTAATCAGCGGAGTGTC
TATAACAAGACCCTTACAGATTGTACTTCCTTGGAGGTTACATTATTTCAAAAAAGCCAT
AGAAAGCATAGAACATTAAACACAAATATGTCATTTTTAAAGTGTACTGTATTCTTTTTT
CTTCAGGCTAATGGACGCTTTGAAGTGGGCAAGAAAATCTGTTTGAGCATCTCGGGACAT
CACCCTGAGACTTGGCAACCTTCGTGGAGCAGTGAGTATCGATTCATAGTGGTCATACTT
GCACATAACTTTAGGGGCTTTATACTTGTGAAGTACATCTTCTTGAGATTAAAGCCGATT
TGGAATTTCATATTATTGAATAAGTAACAAAAATGCTAGTCCTTGCCAACATTATAAGAC
AATTCCCGTACTATACCCTTTCTATTTTTTTCCTCTTCCCAGAATAAACCCAGTGCCTTT
TACAGAGCAACTTAGATTGATGTTGACTTTTTATTTCAGTAAGAACAGCACTATTAGCTA
TCATTGGGTTTATGCCAACAAAAGGAGAAGGGGCCATCGGTTCTCTAGATTACACACCTG
AGGAGAGACGAGCGCTTGCCAAAAAGTAAGTGTTCCCTTTTCATTCTTTCAAAATTTTTA
TATCAATACATTTTAAAAATTGTGAGTTGGGTGAAAGTTTACATGCAAATTGGTTTTCCA
TTCAGCAGTTTGTATACATTGTGTTTGTGACATTGATTGTTGTGCAGCCTCGCCACTGTC
CCTTTCACAAGTGTTGTTTTCATCAACCGTCACAGAAACTCACTCAGGACCTTCTAAGCA
GCCTGTCTCCACGTTCCCGTTCAGCTGCCTCGTGTAACACTCTGAATGCCTGCTTACTCT
AGAGACTCCATATGAGCGGGATCACACAATTTTTGTCCTTTGAATCTTAACTATTTCATT
CAGCGTATTAAAATGAAGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTTGTTGGTGACTCTCTAACAGTGTGTCAGCATTCTTTTTAACGGCGTGAACT
TTGCTCCTTTTACTCTGCTTTAAGTTCTCGGCCCCTTCTCATCTGTACGTGTGCGTGCTT
GCTGAGCTTGTGGTCTCACGCGGATGGTTTCTGAGTAGGGCATTAATCTAGGGAGTGATT
TCCTTCATTTTGTCTGCCGCCTTGCTGTTCCACTCCAAGGTGCTCTCTGGGCTTAGGATA
CTTGGTTTGTAGTGTGCCTCAGTGACTGTCTCGGAGCTTCTCTTTTCTGCTGCTATAGGT
TGCCTGGCTTCCTTTTCAAATAATAATTTTGGTTCTCCGTATTTTTCTCCTGATCTAGCT
GGGACTACCTATTGTGACCCCAGTTAGAATGGTCTGAAATGTCGGTCAGGCACCACCTAC
TACTACTGGTCTCAGGGGAGATGTGGTTGTGACTCACATAGACCATGAGTCAGCATCGAC
TTGATGACAGTGAGTTTATATTTTTTTGTTTTTGAGTTTTTGGTGCTTTTGATCACCTTC
TTCCTGTTTCCTCTTGGTGAGTAGAGACCATGGTTGGAACCATCTAAGACTCCAGATGGT
GCTCACGTTACTAGGGTGCTGAACTATAATATGCCAAAACTCATAAAGAATTTTTATACA
GTAGTTCTTAAAAATCATGCATTGAGCTGCCATCCACAAAGTGAATGGTTCAAATCCACC
AGTCACTCTCTAAGAGAAAGATGCACTCATCTGCACTCTACTCCTGTAGAGATTCAAAGT
CTGGAAAACAAGGGCATTTCCACCCGTCCTGTAGGGTTCTGATACTGGCTCAGAATGAAC
TCCGTGACGGCGACATATGCCAGTGCACTAAGTTGTCCTAGACTCTCCGATTCTAAAGGG
CTGGTCTTTGACTGTCACATCTTTCATGAGTCCAAACCACAAGTACCTCACCACTGACGT
TTAATCAAATTAATTATAGAGGTATCTGATGTTTTCAGGGTTCACCCATGTCATANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGTGAACCTTCGTGTCCTGGTTT
TACTGTCTCTTGGGTATGTATTTAGGCATAGTATTGCTAGTTGTAAAGCAATTCTGTTTA
CCTTTTTGGGGAACCGCCATACTGTTTTCCACATACAATATACCATTTCACAATCACTCC
AGCAACAGAAGAAGATTCTAGTTTGTTTACACTCTCAGCAATACTTACTATTTTCCTTTC
TGATCAAAGCAATAGCACCTGACAATCACAACAGTAACTAGGGCTATGGGGCATCTTGTC
ATGTGTGTATCGACTGTGTGTTAACTGTAGTAGGTAGGGCTATGGGACATCTTGTCATGT
GTGTATCGGCTGTGTGTTAACTAATAACTAGGGCTATGGGACATCTTGTCATGTGTGTAT
CGGCTGTGTGTTAACTGTAGTAACTAGGGCTATGGGACATCTTGTCATGTGTGTATCGGC
TGTGTGTTAACTGTAGTAACTAGGGCTATGGGGCATCTTGTCATGTGTGTATTGGCTGTG
TGTTAACTGTTCGGTGAACTGTCTATCTGAGTCTTCGGCCCGGGCTTTTCTTGCGCTCAG
TGGCGTTTTGTTCCCGAGTTGTAGGAGTTCTTTATGTAGTCTGGATAATAAACCCTTATC
AGATATGTGGGTCCCAAACATTTATTGTAGTCCTGTAGGTTGTCTTTTCACTTTATTGAT
AAGGTACGGGAAAGCTTTATCTTTTAATAAAGTCTACTTTATCTATGGAGTTCTGGTGGC
ATAGTGATTGCATTTTGGGCTTCGATCCCCAAGGTCAGCAGTTCGCAACCACCAACCACT
CCGTGGGAGAAAGACAGGGCTTTCTCTTCCCATAAAGAATTATGGTCTCAGAAACACACA
GGTGCAGTTCTACCCTGTCATAAAAGGCAGCGGATTTGATTGGATTTTTGTCCTTTATGT
TGCCTTTGTTGCTTGTGCTTTTGGCATATCTGAAAATCTATTATTGAAAACTGGGCCCCA
AAGCATCACTCCAGTAGTTTGTCCTAAGAGTTGTATAGTTCTAATTCTTAAATAAACTCT
ATTTTTAACTGATTTCTTTACTCCTTTATACATGTTCCTGCTAAAAGAAAAGGTTATTTG
AGTTTGTTAATGAATTTTTTTTACACAGACTCAAAATAGGTTTGTTAGTGTGATCTTGAG
AGTAGTGTAATAGTATATATTTTCTATATACTTTGTTAATATATAGGTCTAAAGATGACA
TTTCTTTAGATTACATATCAGAAAAAGGGAATCGAAACACTAGGCTTTTTGTTTTATGTT
TTTAACAACCTAATGTGTTTGTCTCAGAACTATAATTATTGATTGCTTCATTTTCTAACT
TAGAGCATGTGGGGAAAAGTGATGTAGAATTGTCCCATTTAATTTGTGTAGCGTTCGAGT
TCTCTCTGAAAGGGGGTTATCATGTAGCATGTTGATACGAACCCATTAAAAATGATTTCT
TACCAGATCACAAGATTTTTGTTGCGAGGGGTGTGGCTCTGCCATGAAGAATGCCCTGCT
GCCTTTAACGTCTGGAAGCGAGTCAAGCCAGGCTGACCAGGAAGCCAAGGAACTGGCCAG
ACGAATCAGTTTCAAGGTACCGTGAGGGTATACACAAGCCCTGGGTTACTTTCGTCTACT
GCAGTATTCTGAGCAGAAAGGAAAGCGATGTAGTTCTTTTGGAATAAGGCTTTTAAAGAT
ATTTTTTAATATTAACAAAGTACGAATACAAGTCACAAAGGTATTACAGCACAGTCATGA
GAAACTTGGACTCCGGAACAGAACACGGTGTCCATTTCTCATGTTTTATTGTAGTACTCA
GAAGAGGAAGTGCCTTTTTTCTCCTACTGCCATTGAATAGGTTTTGATTCATAGATGTTG
ATCACTTTCTTCCTTTTGAAATTCTTACCGCATTTTAATTGCTTAATGTGACTATATTAT
ATATCATCTTTTTTAGACTTAGAAATGTACTACATCTATATCTATGGGCACTGGTGCGCA
GTGATAAGCACTGTGCTGTTGACATATCGACATTTCAGCTGCTCTACAGAGAAGCTGAGC
AGCTGCTCTGTCAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTT
GCCAGCTGGAATTGACTTGATGGCAACAGGTTTGGTTTGATGAGGATTGGATACCGTCTG
TTAATACCTGCTGTGAAATCATGTCATTTGACTCCTGTGATAGTAGCTGTGTCCCATAAT
CAAACACATTGATCTTTTCTCAGCAGACCTCGGAATATTTACATTCAGATAAGATAAAAA
CTACTAGTAGCCTCAAATCCGTTTATATCAGGCTTTCCTGAAAAATTACAAAATAGTTTT
TAGTTGTGTTTTGGGGATGTTGGAATGGTGACTGTGAGCTACCAAGGAATAGCTCTTTGG
AAACAGCTGTCATCACTTCCTCCCCCGTGGATACCCATCCTAGTGTGTGAGGTTCGAGGG
CTCAGTGCTTAACTGACTGGTAATAGCTATTGAAACAGCAATTAAATCAGGCTGAGGGGA
GAAATGTAATAGTCTGTGGGCTGTTTTGTTCTCGTCCTCCTGTAACCCTTCTCTTGGGCA
TGTCTTTTTTCATAGGCAGAAGTCAATCCATCTGGAAAGACTATCGCTGAGTCAGACTTA
AACCACTCCTTTTCCCTAAATGATGTACAAGATGATATACCTACAACATTCCAGGGTGCT
GCGGCCAGTGCGTCGGTATGTCTTGTGTGTGTGTGTGTGTCTGTGTCTTTTTGTTATTTG
GCATAGGAAAAGATCTCTAGATCAAATATTTGAAGATTTTAGTTTTCTTAACTGATAAAT
ACTGTCTCTCAAAGCAGCGGTTCTCAACCTGTGAAGCTTCACAGGGGTAGCTGGATTCAT
AACAGTAGCAAATGACAGTGATGAAGTAGCAGTGAAAATAATTTCATGGTTGGGGGGGGT
CACCACAACATGAGGAACTGTATTAAAGGGTCACGGCATTAAGAAGGTTGAGAACCACTG
CAAGAATGGTATTTTCTTGAGCAAGTTATTTATTCTTTGACCTTTGATTTATTGTTTTTT
TGTTTTCCTCCTAAATGGAGCTGGAATGAATAATTTTTAAGCCAATAAAACGTTTTTTTT
TTATGCCAATAAATATGCCAATAAAACGTTTTTTTTTAATTTAAGCCTTAATAGGTTTGG
AAACCCACAGGGGCAGTTCGACCCTGTCCTGCGGGTTATTGAGTCAGTGAGGAGGACCTC
AGGCCTGGTCTGGTCTTTCATTGTTTAGCTTTCTCCTACCTAGGAGACGATTGCCGTCAT
TCCAAAAGTGAGAGATGCCTTTGCTTTAAACACCTTAAAGAGGTCTTGACAGCAGATTTG
CCCCCTGCAATCTGTCATTTGATTCTTGATTACGCTTTTATGGATGCCGATTGTGGATCC
ATTGAGTATTAAATATCGTCTGAAATCAGTGTTGTAAGGGATTGCTTTTCTAAAGATATT
AATCATGCTAACACAGTTTGGAAGAGCTGTCCTTCTAAGGGAAGTCATGCCTGACTGTGT
TTGAAACCTGAATCTAGGTCCCTCATAACAATAATAATAACAGCTAACATTTCATCCGTA
GTGTCAGATATACTGCTGTTGAAATGTTAGTTATTGTTATTAGTATTAGTAGCCATAGTT
AGTGCTCTGAGATTCTGTGTATTTTGTTTATATTCTGTGTGTTCTTAAACAAGCATATAT
ACAAATTTTCTTTGACAATCACAAACCCGTAATTAAAATTGTCTCGTATGGGGTGCAGAG
CCCCTCCCCAGCAGCCCTTCAGCAGCCTCCCCAGCCCGGAGCCACGAGCACCTCCATGAG
CCCTCGACAGCGTCGGGCCCAGCAGCAGAGTCAGAGAAGGTCTTCAGCATCCCCAGATGT
CCTCCAGGCCCAGCAGCCACGAGACAACCACACTGACCATGGAGGCTCAGCTGTACTGAT
TGTCATCTTGACTTTGGCGCTCGCAGCTCTCATATTCCGACGAATCTATCTGGCCAATGA
GTATATATTTGACTTTGAGTTATAACATTGCTTTGTGTTTCAAGAGCTGTGAGGAGTGCT
TCATTAAACATTCTGCATTGGGTACACATTGTTTACAAAAAGATTATTTTGTATCTACCT
TCCTTTCATTCCTGTTTTGATCCGTATTAGAAATGAGTGGGATCACATGATGTCCAGCAG
TGTGTCCTGCTTAGTTTAAGGGACCTAAAGTCAAATGTCCCTGTCTCACTGTTTGACCTG
CTTTCCAGGGAAATAGCCCCTGGTTGTTTCTTAGGCCTCAGCTTTTATTTATGAAGATTT
ATTATGCTTTTCTGTATAGCCCTTGAAAATCTTTGTTTTAAATTCCAATGAGTATTACTA
GCTACTCAATACCATTTGTTGAGTACATTGTTTCTACTTTTGTAGAATTATATAGGGATA
GAATATTTGAAAAGGGAAAGTAAAACTCCTCAAATACCTTCAAATGTACTCAAAACTCCC
CAAATCAGACATTCTGGGATGGCCCATTCTATGACTTTGTCTCTTAAGCCCTCCTAAGCG
AAAAGGAACTTCATTGCAGTTGAATATTTTGAGGAAAGGAGACTACACTGGGTTACTGGA
CGTTACTAGACAAGAGACGAATATTTGGTAGCCACTTTGATACACTGTCATCCCCTGCCT
CTCACACGCACACCAACTGTTAAAAGAAAAATAACCCTCCATAGAGCTCTTTTTTTTTTT
TTTTTTTTTTTATGGGCTGGGTCTCTTTATTTATTTATTTTTTTTTCTTTAAACAAAAAT
CATTTTATTTGGGGCTCATACAACTGTTATCCCAATCCATACACACATCAATTGTGTAAA
ACGCATTTGTACATCGTTTCTCATAGAGCTCTTTTGAGGAAGAAAAACTTCAACGTAGGA
AAACTCTTGGATTGTCTTCCAGAAATTCCATGATTTTAAAATTTGAATGTTTTCTCTATT
TTGAATTGTATATCTTTTGAGATGTATTATATGCCTAGTTGTGTGATCACTATAAATGAA
TTATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1031, 5340..5413, 6268..6399, 11526..11610, 11859..11964, 16206..16335, 17415..17534, 18586..18864
1001..1031, 5340..5413, 6268..6399, 11526..11610, 11859..11964, 16206..16335, 17415..17534, 18586..18861
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved