Echinops_telfairi Locus DKC1
snOPY snoRNA Orthological Gene Database
Echinops_telfairi DKC1
Echinops_telfairi
DKC1
GeneScaffold_3424
SNORA36
4580..4714
9053
TTGGTCTGTAGTCTGCAAGGTCAGCAATTCAAAACCACCAGTCACTCCCCCAGAAAAAA
GATGTGGCTTTCTGCTCCCATAATTAGTTTCCCAAACTCACTTGGCAGTTATACCCTGTC
CTGTAGGGTCGCCCTGAGTCCGCATCAGATGGCTGTGGGCTTGATTTTTTTTTTTTTTTG
AGATGTGTAAAATACACAACGGAAACGGAAGAGTTGGTAAAGAGTTTAAATATATCATAT
ATATTATTACTATATGATTATGTGAAACTTTTCAATATATGTAATATAAATCGTGTCTTT
GGGTTGTGTACGTGGTGAAATAAAACATTTGGGTAAATGGACTACAGAAAATACATTATT
AAGACAATTTTCATTAGTTTCTTTTCACGCTCTTAGAAGTGACTGCTGGAACATTTGAAA
AACGCACGTGTGGCTCGCATTCTAATCCTATTGGACAGCGGGGCTCTAGACCGGAAAGGT
ACCAACAGGGAATTACCATCTCTATGCCTCCATTTCCTCATTTTTCAATCAGGGCTCATT
CGGACTCGTCCCTACCAGTGCCGGCAAGAGTGCGCCCAGGGCTAATACATCCAGAACTAT
GGCGCTTGACACTGCGACCAGATGCTGCTGGGCTCAAGGCGCACGGCCCCACGAGAGCGG
ACTGTCGGCGCCCCGCCCCCCGACGCCAGGGTCCGCCCCACCCCCCGCCCCTGCTGGCCA
CGCACGCGCTCCAGGTCTTGGCCACGGAAGGCGGGGCTAGGCCTGAGGGGCACGGGCGCA
CGCGCCTCCCGGGCCACCCAGCCAATGGAATTGCTCTTTCGGCCTTTCCGCTCCTCAGGC
CCTCCCCCTCCGCTCCGCCCCGCCCTGCGGCGCGGCACGCACGGGGCGGGGCGCCAAGGG
GCAGGCCGTTGCGGCGAGGCCTGACGGGACCTAGGCGGCGGGAGTCGGGCTTATCTGCCC
GTTGGCGGCACCCGGGGAGTCGCGCACGTTGTGTGGGGAACATGGCGGACGCCAACGGTA
AGGGCTGCAAGCCGGCTGGCCGCGCGCACCGAAGTGCAGCTAGCTCTGGGGAATGGCGTC
GGTGCCCGCGCGCGCGCCCACCGGCACACCGGCCTCTTCGCTCCAGGGCCTCAGGCCGGC
CTTGCCGCTCAGCCCGACCCCACATGGCGAGGGCGCGAACCCTAGAGGGCCCTGCGTGGC
GCGGTTGTGCTGGCGCCTCTGAGGTGGCGGGATCCCTGGGCCCCTGCACGCCGCCGCCCC
CTCCGCGGGTTGGGGGAGTGGGGCGGTGGGAACAAGGGGATAGGAAAGCCGCGGGACCGA
ATGGGGACATTGTCACCAAGCCCGGAGGCCACGATCCTCTGCTCGGCTGTTCTACGGCTT
TAAGCCTCACCACGACCACGTGGTGAACCGGAAGGGAAGCCAACACGTGTGACTGCTCCC
CTTCGTTCCCGACCTTGCTGAGAAGTGCTACAGAACTTCTGCCCTAAATCGGTATCCTCC
CTGCCCTAAGCCCTGCTTGTGTTCCATTCCAAACTTTGTGGTCTTCGTTTTTTGGAAAAT
CTCCAAACCCCGCTGTTTTAGTTGTTCAGCTGAAGAAGCATAAGAAGAAAAAGGACCGAA
AGTCGCTACCTGAAGAAGATGTAGCTGTAAGTAAATGTCTCGCATAACAAGCTGAAGGCA
GTAGTAACCTAAAGGTTTCTGAGACATGTACTGGAATGGGCCATCCTTTATGTCAAGACA
CCGAGCCTTGCAACCCCCCGCCCCAGCCACCCAGAGCTTTGTATATGAGACCGTTGTTTA
TTAAATGGTTTCTTGCTGGTCTCAAATGAGCTCCTGAAAGTCCTTTTTCTGTCGTCTGCC
CACCAGTCCTCCAGGCTCCTTAAGCATTAGGACCCATCTCTCAGTATTGGCACTTGCAGT
TCATGCCTTGTTGACCTTTCCTGCAGAAGCCTGTGGTTAAGTTCTGACCCACAGCCGTCT
TACGCTTAACGGAAGGAAGCACTGCCTGGTCCTGTGCCATCCTCACAAATTAGTGTTAGA
TTAGAGCCCGTTGTTGCAGCCACGGTGGTGTCAGTCCATCTCGTTGAGGGCCTTCCTTTT
TTTTTTTTTGCTGCCCCTCCACTGTAGCAGTGTAGTGTCCAAAGTTCAAAGTCAGGCAGA
AAATCTAATAGGACGTGTTTTTGTCTTGTCAAAGGAAATACAACATGCTGAGGAATTCCT
TATAAAACCTGAATCCAAAGTGGCTCTATTGGACACCTCACAGTGGCCCCTCCTGTTAAA
GGTACGTGGCTAAAACCATGAGTCCATCCACAAGCTGCCACACGAGCAGAGACAAAAGAT
GTGGGATGTGCGCCCCATGAATTAGTCTTTCATTGGCCTGCGAGTTGCTGTCTGCCCTGG
AGCTTTCCCATCAGATTTCACTGACAAGCAAAATTGCTTGACATGCCAGATCAAGTCACT
GGAGCCTTACTCTTGTGCTGGTCATGTTACTGACCTGTAGCCTCATAGCCACCTTGGGAA
ACAGTAGACCCACCTGCTCCATGGGCCTAGATCTGAGCAGACAACCTCATCTTTTTCCTG
TAGAGCAACTAGTGGGTTTGAACTGCCGGCCTCGCCGTTGGCAACCCTTTGAAACCAGAC
CCAGGTGGTCCAGGTCAGCTGTGTGACTCTAGACCAGTCATTCCACCTTGTGCTGGGGTC
TCTAGACGGGTAGAAATTGGTGTCTGGGGGCAGGTGGGTGCAGAATTTGAATTACGTTGC
CCTTTCATTTGACCATTCAATATGAGCATCTGGTCCCGGGTTAGGACGAAAAGTTCCTGG
GATACCCATTTGATTGAGAGTTTGACTCAACCAGGAGACCGATCATTTCTGTTGTCTTTG
GGGCTGCTGGACTAGGGGCATCCCAGAAGCCAGGAGATAGGAACAGCTGAAGGGAGCGCA
TGCTGGCCTTGGAGAAACATTGTTGCCTCAAACCTGATTTTTCTGAGAGGGAGGGTCAAG
CTTGACCCTGCTTTCTGGGCCACCCTATTCTGTACTGCCTTCAGGAGCCTCCCCTTTCAG
AGCAGTGTCTAACACCATCTATGAACAAGCAGATGAATGAGTATGCTTTCCCCCCGATAC
TTAAGGAAATGTTTTCCAACAGGTGGGGGACCTGAAGGTTGCCTGGTGGTGTTTAATATG
CACCAACTACTGCTTCACAAGCTCAGACTGTGGTAATGTGATGGTTGTTCTGTGTATATT
GTCATTTTCTAGAATTTCGATAAGCTGAATGTCAGGACAACACACTACACCCCTCTTCCT
TCTGGTTCAAACCCTCTGAAGAGGGAAATCGCCGACTACATCAGGTTAGTGTCTGCTCTT
TCGTCTCCTGGGGGTGGGGGCTGTTCCTGCAGTGGTTTTCATTTTATTCCTCAGGACAGG
TGGTCGGTGAGGTTTTTTTTCTGCCTTCCAGGACAGGTTTCATTAACCTGGACAAGCCCT
CCAACCCGTCTTCACATGAAGTAGTGGCTTGGATCCGGCGGATACTTCGTGTAGAGAAAA
CAGGACACAGTGGGACACTGGACCCCAAGGTGACCGGCTGTCTGATCGTGTGCATCGAGC
GAGCCACCCGCCTGGTGAAATCTCAGCAGAGCGCAGGTATGTGCTAGTGGCCCAGGCAAG
GAACTGCGGAACTCCCAGTGGTTTTATCCTGCCTAGCTTTGGGGACAGTCTATTAGGAGA
AAAGGATCCCTAAAATAGGGTGTTCTCCATGGCACCAGTGCCTGCTGCCCTTGGGCCAGA
CAGACTCGGGTCCTGCTCTGGCACCTCCCTGCAGGTGTGGGAACAGAAAACTTCGTGGCC
ACCCCTGACTACTCTTCTGTCATTTCCCAGGCAAAGAGTATGTGGGGATTGTTCGGCTGC
ACAATGCTATTGAAGGGGGTGCCCAGCTTTCTAGGGTAAGTGCCTTTGCAAGGAGGTCCT
TCTTGGCCTGCTTTCCACGGAACTTTCCAGCAATGTCTTCTGGCAAGCTCCTCTCTGCGT
GGGTGTTTGCAATCAGCCCTGGGCTACCCACTGTTTTGAGGAGGCAGGAAAATCCTTTCA
TGTTCATGAGTTCTGATTTGTACACCTTTGTAGGCCCTAGAAACACTGACTGGCGCCCTG
TTCCAGCGACCCCCACTCATCGCTGCAGTGAAGCGGCAGCTCCGAGTCCGGACTGTCTAC
GAGAGCAAGTTGATAGAGTATGATCCCCAGAGGAGATTAGGTGTGCCATTTGGTTTCAGA
GTGGGAAACGAGTTTGCAAGTCCAGACTGCCACCCCCGTGGCGTCACCGCCTGTGTTGTG
GTCTGGGTTCCCGGGTACAGAAGAGCTCTGTCTCTCCAGCCAGGCTGAGTTTGCTTTGTC
TGTCTTAGGGATCTTTTGGGTGAGCTGTGAGGCTGGCACCTACATCCGGACACTGTGTGT
GCACCTTGGCTTGTTACTGGGAGTTGGAGGGCAGATGCAGGAGCTCCGCCGGGTTCGTTC
TGGTGTGATGAGTGAAAAGGTACACAGCTGGGGGATGGCATCTCACCCCTTGGTAGGACG
ATGCTCCCTGAAAGGGCAATTCCCAAAGTGTTGAGTTCAGTTCAGGGCTGCTCCCCTGAT
CTGGTAATTGAACTTTGGGATATCGAAATGGGCCTAGGGTAAATAAGTGGATAGAAAGCA
TTCCTCTCTATTCATCTCTACCCCAGCCTACAGCACTGTCTGCCGGGTTGAATCCAGGTT
AAATCCAACAGGAATGGCTTAAGGGCCTAGAGGCTATACTGAGCTGGGACTTTAGTGGTC
TGAGCGCATTCTATGCACGTCGACCTGGTCAGGTCTGATTGGCTGACAGCAGGCACTGAC
TGCTTTTCAGGATCACATGGTGACGATGCACGATGTCCTGGACGCCCAGTGGCTGTATGA
TAATCACAAGGATGAGAGCTACCTGCGGCGAGTTGTATACCCGCTGGAAAAGCTGTTAAC
GTCTCACAAGAGGATGGTTATGAAGGACAGTGCGGTAGGTGTGACCTATGAAGTTGGCTG
CTACTTTCCTTTGGGTTCGGTCTTCCTTGCTGTATAAATGGAATGCTGCATTTTGAAAAT
CCTTTGTTTATACTGGAAGTCTTTATTATTTAAAAAATGATTGAAGCCCTCTCACTTCCT
GCCATCCAGTGGTTAAGATGCCAAAGATCGTGTTCATACAAAACTGGAGGATGAGCACAT
CCTTCCATAGTCACAGAAAATGATGGCCCAGAGCCCTCACTCCCCCACCCAGCAGGAGGC
CTGGGTGGCGTTGACGTGCAGAGTAGCCAGGCAGCGGGTGTTTTACTCTTGTGAGTGTGA
AAGCAGACAGCAGGGCCCTCGGGAATGAGGTGGAGATGTGTTTTGAAGTCTCCACCTGGG
CAGACACGTGTTTTCAGCACGTCCCCAGGGAGTGCTGACGCAGCTGACCAGGTAGGGCCT
GGTTTGAGACCTCTGGTCCTCTGCTGTACTGCACAGTGGCCTCACTCTCAGCCCCGTTGG
GGTTTGAATCCATTGCTGGTGGGACTGAGATGGCCCGTGCTGTGCTCGACAGGTGAACGC
AATTTGCTACGGAGCCAAGATCCTGCTGCCAGGTGTCCTGCGGTACGAGGATGGCATTGA
ACTCAACCAGGAGATTGTTGTCATCACCACCAAGGGGGAAGCTATCTGTATGGGTAAGTT
CTTGAGCTACTACTTGGGTCCAGGGCTACTAGAGTGGTTGCCACCTGGGATTCTTTCGCC
CAATAAATTTGCGACCTGGACCAGCCAGTGCTGCCAGAAACACCTCAAATTCTGGGCGTG
TGTCATTGTGGATTAATTTGTGGTCAGTGCCTATTCAGAACCCTCCTGTTCCCAATGTTT
TCTTGCCCCACAGCATAAAGGAGCTTTGCTCTGTTCCACACCCTCACAGACTCCCACTGC
CCGAGTCCATTCTCCCTCGTGGCATTCCCGATAGGAGAGAGGGTTCCCGAGGCTGCCGAT
CTGCATGCCTCGGAGCAACTGGTGGGTTCTAGCCGCTCAGTGCCTAACCCACAATGCCAC
CAGGGCTCCTCCAGCTGGGACAGTGGCTCATGGAGATGTCGCCACAGGACACATGGCAGC
AGCCATCTTCTCCTGAATGTCTGTCATCTCTTTGTAACTCGGGGAGAACTTGGGTTCAGG
GCCCCACACTTGTTCTTGCTTTAGTTAATTTGTGTCATAACGTCTGTATCTAAATTGGGG
CTGATGGGCACGGACGGTAAAGTTGGAGTGAGGGCTCGTCCGGTGTCATTCTTCCCCTCC
TCTTGTCCCGATGCTGCAGCCATTGCCTTGATGACCACTGCCGTCATCTCCACCTGTGAC
CATGGCATAGTGGCCAAGATCAAAAGGGTTATCATGGAGCGAGACACTTACCCTCGGAAG
TGGGGTCTTGGGCCCAAGGTAAGTGGTGGGGGGAGGGAATGAGTGAGCTATGCGGTGTGG
GCCAGAATGTGTCTCCAGAGCTTCGGACTCCATGACCAGGGAAGAGAGAGACCTCATTGC
AGACCACAGCATTTCTGTTGGAACGGGACAAGCAGGTGGCCTCACTTGACTTGCCGGGTG
GGGGGTGGTGTTTAGGAGTGCAGACAGGTCCTTGGTGACTAGAGGAGTTTGCCAGCACGA
AGGGCAGACTAGGTGTGGTGAGACACAGGGTTAGGGCCCAGCAGGGCATGGGCCAAGGCC
ACCGGCTGACCAGCTGACCTGCCCATTAGGCAACTGAGAAGAAGATGATGATCAAGCAGG
GCCTCCTGGACAAGCACGGGAAGGCCACGGCCAGCACGCCCTCGGCATGGGTGCGGGACT
ACGTGGACTACAGGTGCGGGGCTGGGGCCGGATGGGCAGCATTTACCTTGGGGGAGTAAG
CTCTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCTTCCTAATGCCACAACCCTTTAATATAGTTCCTCATG
TTGTGATGACCCCCAACTGTAAAATTATCTTCGTTGCTGCTTCATCACTGTAATTTCAGT
ACTGTTATGAATCGGGCTACCCCTGCAAAAGGATCATTCGACACACACACACATGCCAAA
AAAAGGGGTCACAACCCACAGGTTGAGAACCGCTGCCCTACAGGGTCCTCTGTAAAGTCC
TCCCAGAAAACTGCCTCCTGGTGACTCTTCACACTGTAATTTGCTAACGTGCTGATCCTC
TCTCTTCCTGTATCATTCAAGACCTAAGTTTCCATCGTTTGTCTTCCCTTTAGCGGAAGC
GAGAGAGTGAGACTGAGAGTGACAAAGAGACCCCGCCAGCTGCTCCCCAGCTGCTCAAGA
AAGAAAAGAAGAAGAGTAAAAAGGACAAAAAGGCCAAAGCTGCTGCTCCAAGTGAAAGCG
AGCTGGGCCAGGTAGTGAGTATAAGCAGCCCCTGCCTTCAGATGGAGGTGGCTCTGGCCC
ACCCTCAAGGTGGTGGATGGATAGAGGTCCTGTTTGGGAGGGAGGGGGAGAGGACCCAGA
GTCGAGAGACGAGCTGGGACTGAGGTTGGTGGGTGCAGAGCCAACAAGTGTGAAGCAAAG
GGAGGCTGCATGTGACGGACTTGCCCTTCATGTCACGGTCCCTCTCTTCCTAGGAAAGTG
ACACAACCAAAAAGAAGAAAAAGAAGAAAGCCAAAGAAGTACCCGCTGCTTTGTGAGATG
TGGCCTCGGGGAGAATAACTAAAGCCTTACTGAGAAACCGAATTCCATCAGTGGTTGAGG
GCCGGCAGTTGGCAACCCCCTGGAGCCCGCTGCCCATGTTGTCCTGTTTTAAGGGCCTGG
GTTTCACTGGTTAGTGGCCAGCAGCCGACTTTCAGATCGGTGACCATCCAGCTGTTTTGT
AATTGCTGTTCTGATACAAATCGTATGGTTTGCTCTTTGCCTTCCTGCTTAACTTAAACC
TGTGTACCGCTCCTGCTCAGTGAGATGGACCAGAACCCGGAATCACTCCCTAAAGTGTTT
AATGCACGTTGTCCACTGCAGCCACCCTTTTCCCAAAGGTCATGAAGATACCAGGTCTCT
TTTCTGGTATGGGCCTGGCAAGGAATTTGGGCTGTCTCCAGTGTGCACGGGCAGTGTTGT
CCTGGCCCTGCCTGCCCACTTTGTGCGTGTGTGTGTGTGTGTGTGTGTTTCAGTGTCCTC
TTGTGTATGGTAGCCCTAGTGTACTTTTGGTGTTGTGTGTGAGCCCATCGTTGTAGCTGC
TGTGTCAACCCACCTCATCCAGGGGCTGCTGTTTTTTTCGTTGACCCTCTACCAAGCATG
TCCATCTCAAGGGAGTGGTCTGCCATTTTCACAATATGTAAGGTAAAGGCTCCCCATCCT
CCCTTCTAGGAGCAGTCTGGCTGTTCTACTTTGGGGACTGATAAGCTTGTTCTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 1580..1645, 2194..2280, 3252..3343, 3451..3635, 3870..3934, 4113..4239, 4388..4518, 4870..5013, 5572..5692, 6319..6437, 6749..6852, 7205..7283, 7913..8053
1001..1015, 1580..1645, 2194..2280, 3252..3343, 3451..3635, 3870..3934, 4113..4239, 4388..4518, 4870..5013, 5572..5692, 6319..6437, 6749..6852, 7205..7283, 7913..8053
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved