Echinops_telfairi Locus TMEM56
snOPY snoRNA Orthological Gene Database
Echinops_telfairi TMEM56
Echinops_telfairi
TMEM56
GeneScaffold_5113
SNORA76
10186..10314
114704
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGGCTAAAGAAAAATTTCTCCAACGTTGCCGTGAACTA
AAGTTCAGCTCAGGGATAGAAAATATGGATTGTGGATGGATAGCTGCACACTGCGCTTTA
ATGCTAAGCTCTAATGCCTGAAGCTCTCGTATAAACATATCTTTTAGAGGTGAAAAGTCC
ACAGGGCTTTTGATCCAAGAATATGTGTGACTGCAGAATACATTTGAAAAACATTTAATC
TGAATTAAGAAGTAACTACAATATGGTTCTTTTCTAAGGCTGTGTTATTCTTCTTAAAAG
TTTAGTTGTGCTCTAAAGATTGCCCACTGTATAAATAGGTTTTATTTGGTAATATTGTTT
GTTTTGATTTTGCAGGTAATGTGGTTTCTCTTACAACCTTCAACTTGACTGGCCCTTAGC
AATGATCTAACCAATTCTTTCCTTTCCTAGGTGAGGAAATGGAGGCATAGAGAAATCGAG
TGATTTCTCCTAAGTTTAACTACTAAAGTTTAATAAAGGGTTGTCTTTATTTCCAGCACT
GTAGATTTCCTCGTGATGTTAAACTCTAATGCTTGAATCATTTTGAATCACATGATGCTA
ATTAAAATTGTATTAGAAGATTTATAACATTAAGATCTTAAAATTAATAGATTTCCCCCC
TCTATTACATACAAATGTAAGATACTTGACATATAGTAGATAAAGTTAAACAAAAGTGGT
TTAAAATCCTTATAGTTTCTTTGTATTCTTACATTTGTGCTAATTTTTTTAAAAGGACTG
AAAGAACTACATGCTCTTTAAAATCTAAGAAAATGTTCATATAGACTCTGTCATGAGATG
GCAATTCATGTCCATCCTTTCTTTTAACAGGGTGAAGAAAGATGGATGCCATCACTAAAC
TAAGCATTCTTTTTACCAGCTTTGTGGTCTTTCAGCTTCTTTTCCACTTTCTAAGTTCTT
GGTTTTCAGCAAAAGTTTCTCCAGCTTTTACGAGGCTCAGCTACGCAAAGAAGATCGAAT
GGAACTCAAGGTAAAGCCTATAAAAACAACTGGTGAATGAAGAAATAAAATTCAGTTTTG
TGATGTAAAGTAGCTCTTTAAAATATCTCAAAAGAGTCTTTTTCCTTGAGGGTATAACAA
AATCTAAAGTCACGTTTTAAAATTTGCCCGTAGGAATAAAAGGAAAGACAAGTAGATGCT
GTGCAAAACATTAAATTAATAGTCTGATGTTGAAAGGTATTGAGATAAAATTATTTAGCT
TTCTGGGAAGTATGTGGGTAAAGCTAGACACCCATCAGTTGCCTGTTTAAAAGTACTGTT
TGGGTAGGGATAAGAAAAGAAAGCATTTGTTGGCATTGTAAGTGACCTACAGGCAGAATT
AATAGGCTTTGGGCACACGGGAGAACACGGGACATCGTCAGTGCATCTGCACCTCTCTGT
CAGTGGCCTTTTTACTGGAATTCAGAGCCCTGGTGGAAAAAGAACAAATTATCTAATGTG
GAAAGCTGTTGGAGTTTTCAAAGAAATTGACTACACCCCCCCCCCCCCCCCTTGCTTCAA
TAATCTCCCACAGTGACTCACCAGACCCTAACTCCCAAGGGCTGCTTTGGCCTACTTTAA
AGAAATTTGGCATGCTCACACGTTGCTGTGCGTTTGCAAACCTCTGTGAATTGGAGCAGC
TATGGAAATGAAAAAGAAATTTGTGGTGAAAAGTAGAGGTAACAGAACCTTTTGCCATTT
CAACAGTTGAGTGATATTAAACATGTCCATTATGCCGTTCCACCACATCACCGTGAACTG
TTCCCGAAGTTTTCCATCACCCTTGAAAGACTCCGTGTCTCCTACGCATTGCATTTTCCG
TTCGTGCTCCCTCCCACCGGCATAAACTTTGAGCTCCACGTACTTGCCTGCTAGATAGTT
CATCTAAGTGGGGTCATAGAATACTTTTGTGTGCTTGTTTGTTGCTGACTTACTTCACTC
GGCATCACGTTCTCAAGGTTCATGTACGCCATAGTATCAAGACTTCTCTCCTTTTGATTG
AGTGATGCTGTATTTATCATGTACCACGAACGTTTGTTTGCTTATCCAGGAACATGTAGC
CTGTTTCCACCTTCCCAGACATCAATTTTTTTATCATTCATACCGTGAATAAGACATTCA
TTATTTTTGTGTGTACTTTACGCTGGTTTGTCTGGTTCATATATCCAACAGTTTTTCTTG
CCCTAAGCGCAAGAGTCATTTCTCCACGTGAGTTTAAAAATTAAGAGGTAGGATGCCTGT
CTTCAGAACAGCACACATCATGTTGTTCATATGTACACCCCTAAGGTACTAACCATTGTT
TTGTTTGTAAGAGTCTGACACAGGAAGGTGGATAGGATGACAGAAAGAGAAGAGCAGGGT
GGGAGCGTGGCATGTGCAATTCCGCTCCTACATTTTGAATCCTCCTTTTCTTTTTCACTG
TGGTTAGCGTAGGGTTTTTGAATCTTGGGTTGCTGCAAATCAAAGACAGAGGGAAAGTGT
AGAAGGATAGAAGAAGCAAAGCTAAAAGCGAAACAAAAGGAGGGAATTTTAAGATGCTAT
CCATTAGTCTTATCACTGCCACGCCACGCTATCCAGTTCCTGCATGAGAAGGGCGTCTGG
GGTTTTGTAAAATTCATTAAGCTATGCAAACGGCATGTTCTTTCTGCCTCTGTCTTTCTC
ATCGGTGCTTCCAACTCCTGTGAGGTGGACAGTGCAACAAAGAGCACTGGCTACATTTTG
AATAAAGTGTCCATTTGTGTCTTGAAATGCAGCCTTTAAGTCTTAAAATGGATGGATGAC
TTCAACACACAACATTCCTTCTATTAACACAAGGTCTCTGAAAAATGGGTGTTCTCAGGC
ATCTAACAGCAAATGGATAGGATGAAACACCTCTCCGGAAAACGCACACTGGAGGGCTCC
CAGTTTGATGATCAATGAGAAATTGCTGAGCTCAGTGGACGCTTTTTCTGAGAACATATA
TACTTGTAGGCTCTCTATAAAAATATAAGTTTATATTTTTACAAACAAGACTATTTTTAA
TCTAGCTGCTGTCAAATAGCTTACAAAGTCCCATTGTGTTGCTGAACACCTAATTTTTAA
ATATACTGCTCTAAAATTGAACTCTTTTGAGTGGTATTGTTTCATTTGGTAATTCATACT
CAGATTATTCATGGAAGATTAGATCATTAATTTAAATAGCTCCTCTAAAAATAGTCCCTA
ATTATTTCCTAGAGAGCCAGTGAACCTAGAGAATCTTACACGTAGGAAGATCATGCTAAA
CAGAAGTGCCAGTGTATAGACGTTTTTAAATACAGAAGACTAGGTCAATCGGGGTACCTG
CTTCTGCTCTTATAACTGGAGCGGTTTGGTCCACTTCCATTTTTGTAAGCACAAACATTT
ATTTTTCATCTTCTTTCTAAAGAATTGACATATTTTATCTCAGGCAGTATCTTAGTTACC
CAGGGCTGCTTTCACAGAAAGACCACAAGTGAGTGAGTTTAACCAAGAGAAATGTATTTC
CTCCTGGTTCAGGAGACTAGGTTTCTGTGCTCAGCATTGGGGCTCTGGGAAGGTTCGGAG
CCAGGTCTGGGGCAGGTCCGTTTCGCGTATGAGCGTCCCTCTTCCTCATCGCAACTCCTC
TCACTTGTTCGGTCTCCTTTATATGCAAAATACGCCCCGCATTCATCCTGCCTCATTAAC
ATAACAATGACAGCCTATTCCCAGATGGGATTATAACCACAGGGATAAGAGTGGTTATGC
TTTAAAACACATATTTGTGGGGCTTGGGACACAATTCAACCACAACAGGCAGCATTTTGG
TGTTTCTTTTTAGAAACTAAAGAATTTGCATCTAATCACATGTAGGAAGATCTTAATAAA
CAGAGAAGTGCCAAAGTATAGACTCCCCCCCCCCTTCAGCATTTATTTATTTTTTAAGTC
AATTTATTGAGGCTCATACAATTCATCACAATACATAGATCAATTGTGTAAAGCACATCT
ATACATTTGTTGCCCTCATTATTCCCAAAATTCGCTTTCCTCTTGAGTTCCCAGAAGTAT
AGACTTTCAATACAGAATACTAATAAGCTCAGAGTATCTGCTTCTGTTCTTATAACGAGA
GCTGTTTGGCCCACTATACAGTTCACTGCCCTTTAATGAATTATATGGAGCCCTGGACAG
CATAGTGGTTAAGCCCTTAGCTTGCACAAAGCTCGGTAGTTCAAACTCACCAGCTACCCC
GAGGGGAAAAGACATGGGAATCTAGTTCCATAAGGATTCATAGCCTGGGAGCCCCTACTA
GGCAGTTCTGCAGTGAACTAGGGATACGAGGAGCAGGAGGGGATGCACACCAATGGGTCA
GCGTTGGTTTTAATGAACTATATGCCAGTTCCATCAATTGAGGGTGGCAATCCATCGTAT
TTACTACGGAACATCTCAACAGAAAGGAGCATCTGAGGCCTCTTGAACATCAGAAGTAGA
GTTAGATTTCTTCTGAACGGTGACATTTTGATCTGAAGGTTATTGAACACTAAAACTAGC
TACCGACGGAGGATGTTTTTGTTTTGTTTTGTTTTTCCCTCGCACAGAATATTTAATAGC
AACAGAAAGCTGACTGTAGGACTAGTCACCAGGACTACACTGGGGTGATTCATTCAATCC
TCAAGGAGTTTACATTTCACCCTTCCATACTAACTGGAATACGGACTGGTACCGGTGGCC
TTGGCATGATTATTCCCGCCTAGTACATTGGATACGTGGAATTAATTATTCACACTTCAC
CTTACAAAGGCTCCTTGGTCAATGCCTTTAAATGAGTGAGCTTCATGAGCATTTAAAATA
ACATTTGAACATCTCATCTAGTAGATCAAATACGTTACAATATTTTTTTTACACCAAGCT
TGATTTCGGTGGATACACTTCCGTTGTTTTGGAAGATTTAGGGTCATAATGTAAAGAGGG
AGATCTTTTCTGTTCCATTCCTCTTTCAGTCTAATGAAGAGAAAAAAGAAACTCCCTGTC
TTGTAAGCTCAATCAAGATGCCAGAAACCCTAAATAATTGGATACAAACACTCCATCGTG
TCGGTGCATGCACACGGATAACCTGCACATTGCTCTTGACCATGGCCGAGTGTGGGGATC
CTTTCAGGCATCAAGTCACCAATGAGCAGACTATATGCCCAGAACCCGAGGAGCCCTGGT
GGCATAGTGGTTATGAGCTGAGTTGCGCAACCACCAGGTCAGCACTTTGAAACCACCAGC
CGCTCTTTGGGAGAAGGAGGAATTGTGCCCAGCCCACAGTTCTACCCTGCCCCACAGGGT
CACTGTGAGGGAACAGACTCCGTGACAGTGAGGTTTTTCTTTTCTTTTCATTCGTAGAAA
CAGATGTTTCTCATCTAAACATATTCCTTCTAGCAAAGAAAGCTGGGCCTTCATCTTGTG
AACATTTCTCTTTCACTTGAGTGGTTTTTAAAAAAGCCGATTTTCTGTGCAATTTCTCTA
GTTATAAGTGCTTTCGTAATACTTTCAAAGGGACTAAGAATAGCTGTCCTAGCTTTCCCA
CAGCCTTGTTACAAAAATCAAGTGCGATAATGCAGGTNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTATAAAAGCTGTACTAAAACCCAAATGCTG
ATATTTTTCAAACCATCATCTGGTACAGTAATGCCTGTCAACACCATGAGGCAATTCTTC
TGTAAAAACTCTCAAATGTATATCACCAGTCAAGTTATCCCAGACACAGAACTTGGAACT
TCTTAAATGAGTTCTTTAACAAGCTGAGACATGTGGAAGAACACCTCAGCTTGCTGGATA
TAGTAAAGGCACAAAGATGTACAAGACAGAATCTTTGTCTTTAAGCAACATCAAGTCTTC
TTGTGTTCAGCAATGAGACTCCTAGACCATAGTTGTGAGACTCACAATTGTGCTTTGGGC
TTGTCAGTCACTCACTGCCATTGAGTTGATTCTTAGAGACCTGTAGGACAATATAGAACT
ATCCTGGTGGGTCCCAAGACTAAATCTTCATAAGATTCTTTGGGCTTGAAGGCACCATAA
ATTGGCCTCATCTATTAGTGGTAATTTTTGGTAATGAGGCACAGTCTAAAGACTCTAAAC
GTGGGATGAATGATCTCATTCATTTGTGCTGTGCTTTTACTGGTGGAAGCAATAGAGGCA
AACACGATGGATGGATCTGGCAGCAAACGAGCAAAGGAAAGCAGTTTGGAAATGCTTTCT
CCTCTGAAAACACCTAAGTGTTTCTACGGGCAAGGAGGGCATCAAGGGCAACCTCCAGGC
CTCATAGTTGCTTGGTAAAACTTGTGAAGGCACAGGGTCAAGGGAGAGGAGAAACAGTTT
TGGTGGGAGTGGGGGCTTCACAAAGAAGAAGAAAGTATTCTATAAAAAAAGGGTCTGATA
AGGAGAAGGAAGCAGCTGTTAGTAAAAAGGAGGAAATGGACTGGGTGGCTAATTGCCTCC
ATGAATACCTGCCTTTTTTTACCATGAATTGTGGGAAACAAAGATTTCTCCCAAGTCATC
TCCCCCAAATATGTTAGACATAGGACACTGCTCGCAGCTAATGGTGACAGTTACTTCCCT
TGAGGCAGTGAGCTGCCAGACTGCTATCTCCTCCCACCACAGGTGGGCCTGCTCTCTGCT
GCTGGGGACAATGGGCTGCTTCTCCCTGAGGGCTGGCGACCATTAGCTTGGTTCCTGTAG
ATGGGGTTCACACCCTACTGATAATTGTTTCTAAGGAGATCCAGAGAACAGATCAGAATC
AGTGACATCCAAAATTAGACTGCCATCCTGAATCTAGGATCCACTCATCTTTTCACATGT
ATACCCCCAATCCCTCCTCTTCCTATTGTGTGTATATCCCTAGATTGCCCCCCTCTCATT
GCTGTATAACCTATAGTGCAACCCCCTTCCTGTGACGTATGTCTTCACCTGTAATTAGTG
GGATTGTTCTCCCCCAAAAAGGTAAATAGGCCTTGGTTAGCAATAAAGAGTCTCTCTCTC
AGGCTCCCTTCTTGGCCTCTTGTCTGCCCTCCCTCCTCTCACTCCCCTGTTCCCTTTCCC
CTTGTCCTCCTTCCCCTCCCCCCCTCTCCACGTGGACCACCAAGCAGGACTGAGGTGAGC
ATGCTACTATGAAATATGTCTGACTCCATTATTTCAATCTCTTTTATCTCTCATGCTCTA
TATGACTAATATAATATTTATATAACTCAACTATGCGATTGTGCCTATCACACCCGTGAT
TAGTGCTGTGGGGCTGGCCTCTTTCTACACATGATGTGCCAGCTACACTCTGACATGCTG
ATCAAGATGCTATAGAGATCTGATCTAAGATGAGCTGCAGAGGACTGTCAATGTCATGCA
GTCAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNGTCACACCATGTATGGAAACCCCTTATCTGTTTCTAGGCAGACTTGAAGGCTAAACTC
AGCCCGTCCCAAGGACAGGCTATTCAGAGGGGAGATAACCTAATCACAAAACTATGTCAC
CTAGGTGGGAATGGAAAAGTACTGCAAGCTCTGACAAGATATAGTGAAGATTGAGCCGAA
TGGCCCCGGACACTTTGTGACACTAATTACAAGCCCCACAGTCTCACAGCACTCTTCCAC
TTCCCCTTTTCTGTTCTTCCCTATCCCGTCTTGACTTCGGAGCTTTAAACCTGGGCAAAT
GTTGCCCTTTTGATTCCGTAGGTTGATTATAAGGAGTGAGTGCTTACCTTCCTGGGGTTC
CTGCTCTCTTTATAGGCTGATCTTATGGTTTGGCTAAAAAATGACCCAGGAGAGTAAGTG
CATTTCCAGATCTGAAGGGTGTCTACGGGTCATAGTCTTGGGAGTACTACCGATCTCTCT
CAGGCCAGTAAGCTAGTCTTTGATTTCCCTGACTTGTGTTCTACATGTGTCTCCCACTCT
ATCCAGGACCTTTCATTGTGACCTCTTATAGTGGTCAGCTGTGGTAGCCAGGCACCATCT
AGTTCTTCTGGTTTCACGGTACTGGAGGCGGGTTCCTGTGGCATCATGGTTTCCTTGCAT
CTTTTCTTTTTCTTTACTGTTGCTTGCTCTAGATGGGGCAAGACCTATAGGTGCGTAGAT
GGCTGTTTGTAAACCTGTAAGACCTCCTTTGCAGGAGGTAGAACATTGTCTTTTTACACA
AATGACTTTGGGACCATCTAGGCTCTGACCCTGGTTATGGCTCAGTTGTTTTCTTAGCTT
TTCCCCTTTATACTCTACTATGTCCATGAATATATTTACAACACATTAATACATATGCAG
AAACATCTGTCATGCCTCATTAATTATTTTGCGGTTTCTAATGTGGTATGTGTAGTAGTA
CGAATGGTGAAAATTGTTTTCCTTATCTCAGTCCATTTCACCCTACTTTGTGGTCATTAA
ATATTGTTAGGAGCATTATGAGTTTTCCAAATTTTGTTCCAAGATATATTTAAGTTTGCA
GACATTTCGGTGTAATAGTCTTTCAAAAACAATTTAAAAATCTTACACGCTGCGTTTGAA
CCCGCAATGCCTGCCTGTGACAACTGGGGTTAAGCTGCAGCACCTGAGCAGGTGCTGGCA
CATAACTGGGGCCGCCAAGCCTCTGCAGGAGGCCCTTTTAACTGAGAGGACACTGTGAAA
GAAAAAAATCCAACAATCTTGTACCAGGGGGATTTTAAAATATGAGACTGGAACCATACC
TTGTGTAAAATCAATTCCAAAAATATGATTCTTTTTTTTTTCATTTAACTAGATTACTTC
CTTTTAAAAATGTGAGAACATATTTTCTTAGTATATCGCAAAGTATTTAAAATAGGAACC
CAAGGGTAATTTTTCAAAATTTTTCATTCCTGTGGAGCAAATTTGTTTTTAGTAAAATGC
AAAAAACAGGTCCAAAGATTGAGAGAGTTAAATGCAGCATATGCACTTTCTAGGTGAATA
ATAATTAGAATGGTCATTCTTGAAGTTTCTGTCGTTTCTTAACATCGAATGTCTGACAGG
AGCTTTAGTAGATGACAAACATGATGCCAACATGCCATCTGATCATTGGATGAAGGAAGC
CCCGGGGTGGTGCAAACAGTAAATGCACTTGGTTGACAACTTTTTGTTGAAATGTTGAGT
TCAGAAGAAAGGCCTGGCAATTTAATTCCAAAAAATCAGTCGAAAGCTCAGTGGAGCGCA
GTTCTATTCTAATCACATGGGATGAGCAGGAGTCAGCTGACATAGAGGAAATTGATTTTT
ACAGGAAGTAGTTATAATTACATGGGAAGATCAATTTGATTGGGACATTTAAAGAAGGTA
ATTTTTAAAATAAAGTTTTATTGGCATATCCACCACATTTACAATTTAATCGTTTAGCCA
GATTAAGAAGAGTTGTACAATCATCACAATCAATTTTAGGACATTTTCTTCTCTTACTCC
CTGTTGTCAGCTTCTCATTTCCCCCACCCCCTCTGCCATTGCCCTAGGTAATTATTAATT
CAGTTACTGTCTCTATAGATTTAATTATCCTGGATTTTATAACCAGAAAATCATATCAAA
AACAAACAGGAAGCAAACAAACAAAACCTCAATGACAATGACAGAGCAAAATGGAGAAAC
CTCATTTAAAAAAAGAAATAAAATGTCTGATACTTGCATCCTTGGAGTATGGTCAGGAAG
GATTCACTAGAGACTTAATCCATATGGGGCTCTGGAAATGGAGTTTGGGCTTCTACCTTA
ACCCAGAACCTTCTGTAAACCACGCGTTCATAATTTAGCTCTGATACCAATCCTTGGAAT
TTGGATTTTATTATTTTTCAATTCTTGGATCACACAGGCTGGTGTGCTTCTTTGTGGGGG
ACCAGCCTTACTACAACCAAATGGGTCCTAAGGGGCGTTGTGTAATTGAGGGGTAAATTA
AAGAGACAAGAGATAAGGCATGCAAGGGCTCCCCTCTTCTATGGGGACTGGAACCAGAAA
GAGGCAGTAATGTATTTTCTCACAAGCTTATGTAATTTTGGGCATGCAAGCCTACAGTAA
GCACATACATAACAGGGATGGGGTGTATTAGTGAGAGACACCTAAAATGAATAGGACAAG
CTAGGGGTAAACACGCAATAGGAAGGGGAGGTACTAGAGGCACACATGTGACAGGAAGGT
ACATATGTAACAAGGGTGGATTCTAGAGCAGTGGTTCTCAACCCTCCTAATGCCGTGACC
CTTTAATACAGTTCCTCATGTTGTGGTGACCCTTCCCCCCCATAAAATTATTTTCGTTGC
TACTTCATAACTAATTTTGCTACTGTGATGAATCATAATGTAGATATCTGATATGCAGGA
TGTATTTTGATTGTTACAAATTGAACATAAAGCATAGTGAGTCATCACAAAAACAATATG
TAATTATATATTGTGAAATATTTATTTCTAATTACAATTAAATGAAATTTTGTCTTGAAG
CATGTTGTAGCATGGGTAGGTGAGCATATCTGCATGTGGGTGGACCTGCCTGTAGACAGA
GAGAGGAACAGTGTCCTGGTTCCTAAGACCATCAGAAATATGTGTTTTCCAATGGTCTTA
AGTGACCCCTGTGAAAGGGTCATTCGGTCCCCAAAGGGATCTCGACCCACAGGTTGAGAG
TCAAGATGGCAGCCTAACCTTGGTTGTCTCTGAGCTGGCTTGACCTTTGGTGTCTCTGAG
CTCTTCTCCAGGGGAACAATCTATGATCCTGATCAGAAGGGAGTGAAGGGTCCGATTGCT
CGTCATGGCAGACAACCTTCAGGCAAATGCCTTCAAGTAGTTGACCTTCAAGCATATATA
GTAGCAACCATGTGCTTGCAAGTAGCACCTTAACATTGGCATTATTGCTAGGGGTTGGGG
GGAGGCATCGTGGGGAATAACTTTTACTTAGGATAATATGTCTGGAACACATCTCCATGC
TCTAAACATGAAGGTCTCCCTCCATTGGAGCCCTAGCCTGCCAGTAGCCTTAACGTATAT
GCACAGAGAATTTGTCCCATACACTCTCTTCCCAGTTCTGTTTCCCACACTTCTTCCTTG
TGGTCAATTGACACTTCACTTAGATGGCTGCTTGTTGTAAGACAACCCTTTAAGACTGCA
GACACTATTCTTTCTGATAGACACTATCTTGTTTCTTCAACACACTTTGCTATAATACCT
GTATTTTCATTGTTTCATGAAGGCAAGTACTGACTAGGACTGTGCCATAAGAACTAGTTG
TTTTTAGATGAGGGCTAGAATTAAGTGTGAGCCCCGAATCCACTCATATACCTATGGTTT
ATGTATATCTCCGGTTCATGGGAGCTAATGTGTTTTTTTTAATTGTAATATATATATTTT
AAAATTTCAACTTAACTACAATTTACAAATATAATACANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACAT
CAATTGTGTAAAGCACACTTGTACATGCGATGATGCCCTCATCATTCTCAAAATATTTGC
TCTCCACCAAAGCCCCTGGCATCAGTTCCTTATTTTTATCCCTCCCTCCCCACTCCCCTC
TCCCTCATGAACGCTTGATAGTTTATAAATTATGATTATTTTGTCACATCTTACACTGTC
CGATGTTTCCCTTCACCCACTTTTCTGTTGTCAGTCTCCCAGGGAGGAGGTTATATGTAG
ATCCTTGTAATCGGTTCTCCCTTTCCACCCCACCTCCTTGGACCCTCCCGGTACAGCCAC
TCTCACCACTGCTCGTGAAGGGATCATCCACCCTGGACTCCCTGTGTTTCCAGTTCCTAT
CTGTACCTGTGCACATCCTCTGGTCTAGCCAGATTGGTAAGATAGAGTTGGGATCATGAC
AGTGGGGGGTTGGAGGAAGTTGGCATTTGGGAACTAGAGGAAAGTTGTATGTTTCATCAT
TGCTACACTGCACCCTGACTGGCTCGTCTCCTCCCTGCAAACGACCCTTCCATAAGGGGA
TGTCCAGTTGCCTACAGATAGGCTTTGAGTCTCCAATCCGCACTTCCCCTCATTCACAAT
GATATGATTTTTTGTTCTTTGATGCCTGATACCTCATCCCTTCGACACCTCCTGATCACA
CAGGGCTGGTGTGCTTCTTCCATATGGGGCTTTGTTGCTTCTGAGCTAGATGGCTTGGCT
TGTTTACCTTCAAGTCTTTAAGACCCCGAAGATGCTATATCTTTTGAGAGCTGGGCATCA
TTAAGCTTTCTTCACCACATCTGCTCATGCACCTGCTTTGTCTTCCAGCAATTGTGTCGG
GAAGGTGAGAATCACAGAATGCTAGTTTAATAGATACAAAGTATTCTTTCATTGAGGGAG
TACTTGAGTGGAGGCCCAATGTCCATCTGCTTCCTTAATACTTAATCTATACATATACGC
ATATAGATCTATTTCCTCATCCTCATATATAAATAAATTTATATATGTACATGCCTTTAT
TAGACCTCTATAAATGCCCTTTACCTCCTAGCTCTTTCCTCTATTTCCTTTTACTTTCCT
CTATTTTCTTTTACTGTCCTCTTGTCCCACTATCATTCTCAGTCTTCATTTGGGTTTCAG
TAATTCCTCTTGGTTACATTACCCTTGATCACGCCCTACCAGGTCTCCTACACCCTCCTC
ACCACCGATTTGGATCACTTGTTGTTCCCTTGTGCCTGGGTTTGTTAACACCACTACCTT
TCCCCCCACCTCCCCCTATCCCATGTCCCCCTGGAACTGTCGGTCCCGTTGTTTTCTCCC
CCAGACTGTTCATCCAGCCTGTCTTATTTAGACAGACTTGTGTTTGTGTTTTTTAGAATA
GTTCTCCCTATGTATAACCCTTGAAGTAGTTGATTCATATCACTACAATTTTTGACTTTT
TGACGTTGAGTATTATTGGAAGAGACTAGCAGCGGGCCAGGAAATATTTATATTAATGCT
GAGCCGGCCTTGTTGTTAGCAGTTCAATATTTACTGAACATGGCCACTAGGACTCTTTGT
CCAGCAGTAATAAAGAAACCCAAACTTACTGCCCAGTTGATTCAGACTCACAGTGACCTT
AAATAAATTGTGGCACATGTATTAAATAGAATGGTTAGAGCAGTTACAAACCAACATATA
TTCTTCTAGCCCTTTTTATTGTTTTTTTTTTAAAAAAACCTGATGCATATATGAAAAATG
GAAAACAAAAACAGGCTGAAGTATATGTTTTTGTTTAAAACATTTTATCGAGGGCTCATA
CAGCTCTGTAACAACCCACACACCAATTGTTTTAAGCACATTTATATATATATGTTGCCA
TCATTATTTTCTATTGAACCCTTGGTGTCAGCTCTCTTCTTCCCCTCCCCCCGCCCCTGG
TGGCCCTTTGATAAAGTATAAGCTATTTTTATTTTCATATCTCACACTGACCCCTGTCTC
CCTTCGCCCACGTTTCTGTTGTCCATCCCCCTGCGGGGGTGGGTTGGGGTGGTGGTGTTA
TACGCAGATCATTGTAATCGGTTCCCCATTTCTCCCCCTTTCCCCCACCACATTCCCCCT
ATCCTCATGGGATCACCACTCCTATTACTGTTCCTGAGTGTATCTGGAACAGTGGATTCC
ATGTGTTGAGAGCTTTTACCTGTACCAGTGCACCTGCTCCAGTCTAGCCAGATTTGTAAG
GTAGAACTGGGGTCATGGTCAGGGGGAGGGGGGGAGCTCTAAAGAACTAGAAGAATGTTG
CGTGTTCCTTTAGGGTGCTATGCTGCAGCCTGGCTGACACGTTTTCTTTCCTTTGGAGAT
CACAAATTTGCTTATCTGGATCAAGGAGTTTATCCTCTGATAAGAATTTCCATTACAAAA
GATAGGTCTCTTGGAAAAGGTCAAGAAGCTAAAAATCGAGAAGATTCTTCTAGAGCCCTG
ATGGCATAGTGGTTACGGACTGGGCAGCTAATGGCAAGGTCAGTGGTCTCCAACCACTGG
GCAGGCACTCTGTGGGAGACAGATGGGGTTTTCCACCCACCAAGGGGTACAGTTGGGGAA
GCTCATAGGGCAGTTTTTCCCCGATCTACAGGATCACTGTCAGTTGGCATTGACCCCATG
GCAGTTTTTGGCAGTGAGAGGGCCTCTCAACCTTATCAGGACCAGCATCTGGGGGCACAT
ATATTTGTCTTGGGAGACTGTCTTGAGCATGGGAAGATGTTTAGCAATATCCCTGATACC
TGCCCTCTAAATGCCAGCTCACTTCCTTGCCATTTTGATGACAACCAAAAGATTCTCCAG
ATATTGCCAAATGTCCCCTGGGGGGAAATCAGCCTCCCGCTCCAAGCTCCTGACTCTGAT
AATAGAAAAGGAAAATACAGAGGATGGGAAGATAATGCCCAGAACAGAGGAGTCCATTCC
AAGGTGCAGGGCGACAGTGGCTGCAAATCTGCAGGGAAGTAGCCTCATCTCTCTCCCTTT
GGAGATGGCTGGTAGGCTTGAGTTGCCAACGTAGAGGCTAGCAGTCAAATGTTTATATGA
ACTTACATAATAATAATAATAGTAAAGAGTTCTCCTTTGCCCAAGCAAGAGTTTGCAAAG
AAAGAACAGAGCAAGCAGAAGGGAGGGAATTATTAAAGAAATTTTTTAAGGCCCAGATAA
ATGGATCCCTGCATGTCCAGCACAATCCATGGAAAAAGAACTATTCTATAGTACCTCATT
ATAATAAATGCCAGATTATGAGGTATAATGGGAGGTATATAGTAGAAAGATAAACAGGGC
AAATTCAGAAAAGCATTAGTCATCTTAGCAATAATAAGGAGCTCTAGTGGCACTGTGAGT
AGGTTATGAGCTGGACTGCTAACTGCAAAGTCAGCAGTTCGAACCCACCAGCCATTCCAT
GGGAGAAAGATGAGGCTTCCTGTTGCTGTTGAAGATGCAAGACAGAAAGTTGTATTCACA
TTTTAAAAATGTGAATCCTCAACCTATCTGAATTACCTTTTGGCTGACAATTGCCATTTT
CAGACATGCCATACTCAACAATTTACCTCCTACGCACCTTCTCTAGGAAGGAGCCCTGGT
CAATGTAGTGGTTACTAACCACAAGATCAGCAGTTCAAAATCACTAGCTACTCCTCGGGA
GACCGAGAAGGCTTCTACTCCTCTAGAGAGCTACAGTCTCAGCCATCCACAGGGGCAGTT
CTTCCTTGTCCTATAGGATCCCTAAGAGTTGGAATCAACACAACAGGAGTTGAGTTTTTG
AGTTTGCACCTTTAATGGGCCAACAACTGGAGATCATGATTCAGCAAAATGAGAGTGTAT
ACTAAAAGTCAAGGTGCTTGTGAAGTTGGAAGATAGTATTGATGGGCATTTGACAGATAT
GCTGAAGCACTTGGATAAAATTCAGGGGAGATACATAAGTAAATGGAAAAGCAAGGCAAT
TATTAACTCCAGGGGAAAAAAAGAACTTCTTCAAGGAATGTATTATTGAGGCACATTACT
TGATTCAGGAATGCACTATGTTCACATGGCCGGGATGAGGTAAACCCTAATAATTGAGAG
CTGTAATGTGGCTTTGTGGGAAGGGCTAGTGGAAAACAGTACTGGCGTTGATCTGTAGTG
AAAGAGCTAAATCCACAAAAAGATGTCAGCACAAAATCGAGAAACACCTCATAGGAGCAT
ACCATTTGGGAAATGAAGAATGTTCTAGAGCATGGTAACCTGTAAGGAGCTTTACTGGAT
TGTGGGTGGAGCCGTGAACAGAAGGGCATTCATGGTTGTTCTTGTCAAATATATATCTTT
TTTAAAAAAAGAATTGCACTGCAGTGAAGTGCCTCTTAAAAATATTTTATTGATTTTGGG
TGAAAGCTGAGAGAGCAAATTGAGTTTCCTCTTCAACAACTTCTGCATGTGCGGTTTTGT
GGCATGCCTTGGGATCCCCTCACCCTCACTGCACTCTTCCTCCTGCCTCCCTGGGCCTCC
CTTTGCAATTGCCCTTCTTTTCTATTCTTCCTGCCTTCTAACCTTTGTTTGGGGGCCAAG
GGGGGAAATGTTTGGGGGCAAATGGAGACCACCACTGTGGTCTCATGGCTTTTTATTCTA
AGGAGCACCTTCCTGAGGAGTGTCTCTTGATTGGCTGAAGGATGATCTCTGAGAGTGGGT
TCCTTTCCATGTTTGAAGGATGTCTCAGGGGTTCTGCCAATTTCTATCAGATCAGTAAGT
CTTGGATTTTTATGATTTTGAATTTTGTTCTGCATTTTTCTTCCCCTCTGTCCAGGGCCT
TTGATGGTGATCATAGGCAAAACAGTCTGGAGTGGTAGCTGGGGACCAGCAAGCTCTGTT
TTCAGGATCATGGATGGAGGCTGTAGCTCATGTGGTCCTTTAGCCCTTGGCTTTCCTGTT
TCCTTGCATTTTTCTCTCACTCTTCTTTGCTTCATATGCAAAATGACCAAAAACTGTACC
TTAGATGTCTGCTCACAAAATTGTTCAGACCCAGCAGCTACTCACCCAAGTATGAGGTAG
ATCATTGTCCCACACGATTATATATTACTTTCATTAACTTCTTTTTTTAAATCATTTTAT
TAGGGGCTCATACAACTCTTATCACAATCCATACATACATCAATTGTGTAAAGCACATTT
GTGCATTCATTGCCCTCATCATTCTCAAAACATTTCCTCTCCACTTAAGCCCCCGGCATT
AGGTCCTCATTTTCCCCCTCCCTCCCCACTCCCCCATCCCTCATGAGCCCTTGATAATTT
ATAAATTATTATTTTGTCATATTTTGCCCTGTCTGACGTCTCCCTTCACCCACTTTTCGG
TTGTCCGTCCCCCAGGGAGGAGGTCACATATAGTTCCTTGTAATCGGTTCCCTCTTTCCA
ACTCACTCTCCCTCTACCCTCCCAGTATCGCCACTCACACCACTGGTCCTGAAGGGATCA
TCCGCCCTGGATTCCCTGTGTTTCCAGTTCCTATCTGTACCAGTGTATATCCTCTGGTCT
AGCCAGACTTACAAGGTAGAATTCGGATCATGATAGTCGGGGCGGGGAGGAAGCATTTAG
GAACTAGAGGAAAGTTGTATTTTTCATCGTTGCTACATCGCACCCTGACTGGCTCGTCTC
CTCCCCGAGACCCCTCTGCAAGGGGATCTCCAGTGGCCTACTGTAATAGTCTGGGTACTT
TGGAGAAACAAATCCACAGCGACTCATGTATAAGAGAGAGTTTTATGTAAAGAAAAGGTG
CATCACAAAAACATCCCAACTCAATGCTGCCCAAGCCTACAAGTCCAACATTAACCCACT
AACCCAATACCAGTCCACAAAGTCCTTCACCTCACAAAACAGAGGCAATGATGCCGACTG
CAGGAGGAAAGCTGAGTCAGTGAACGAACAAGCATCTCAGCACTAGCAGGGGTCTCCACA
TGGCTGCTCCAGCACCCAGGGCTGCATCGGGATAGGTCATGCGGCTTCTCCTTGGGGATG
TCTTGTAGGAAGTCAATCTTGCAAGCTGAAGCAGGGAACTGCTAAGGCAGCTGCACCCGA
TGCAACCATCACAAAATAAGAGACCCGAGAACTAGAAAGGTGAGGCTCACCACCCATTTA
TCCCTCCGCCTTTCAATTAGCCCCGCACGTGATTATTGGCCAGGCTGGCACAATTAACTA
ACTCACCTACTAATGGGCTTTGGGTCTCCACTCCGCACTCCCCCCTCATTCACTATGGTA
AGAGTTTTTGTTCTGATGATGCCTTATACCTGATCCCTTCGACACCTCGTGGTTGCATAG
GCTGGTGTGCTTCTTCCATGTGGGCTTTGTTGCTTCTGAGCTTGATGGTCACTTGATTAC
CTTCAAGCCTTTAAGACCCCAGACGCTATACTTTTTGATAGCTGGGCATCATCAGCTTTC
TTCGCCACATTTGCTTATGCACCCATTTGTCTTCAGTGATCCGTTGGACACCTCATGATC
ACACAGGCTGATATGTTGTTCCATGTGGGCTTTGCTGCTTCTGAGCTAGATGGTCGCTTG
TTGGCCTTCAAGCTTTTAACTTCTAATGAAAATAAATGTCAATAAAAATATAAACAAAAG
GCATACATATGCACAAGAAAGAGATCATCACAGAAAAATAAACAAAACCCCACAAAAGCA
TCTAGAATCTCACCTGCCCAGAGATAACCACTCCCAGTATCTTTCCTGGAATTCTGAAAA
ATATGAAACATTCTTAAATATTCACCAAACCTTAAAAGCAATGGGTATCCATGAAACCAA
CAACACAAGTGCTGGAGGACACGTGCACTGCAGGAACCAGTCTTTCTGATGAACGTGTTT
GCAGCAAAGGGGGTTGTCTTCACTAACACAGTAGAGGGCTCCATCCCTGCACTTTTGAGT
TGGGCTGTGATTCAGCATGGTCGGCAGTTCAAAAGCACTTGCAATTCCTTGAGAGGAAGA
CAGGGCTTTCTACTTCCCTCAACAGTTATAGTTTTGAAAACCCACAGGGGGTCACTGTGA
GTCAGCCTTGACTCCATGCCAGTGAAATTTTAGTTTATTTATTTATTATTTTTAACATAG
ACCAGAGAATTGAGGCAGTGTACAAACAAACAAAAAAGTCATTTTTCCTTCTAGTATCTT
GTTATTTTAGAAAGAAGCATTTTTTTCAGTCTTTGTTTCCCAAACAATTGGCTCTATTTA
GAAGATTAAGAATTTCAGGGAAGAGAAATTCATTAGAAAAGTCTACCCCACCTAAAAGAA
TGTTTGCATTTTTTCCCTTAAGTGTGGGTGACTAGTTTCATTTTTCTGAAATGTTTCCTT
GTGCTGTTTAAATGAACCCTGTAAGTGAAATTCAGCCATAACACATCGTTTTCACATTTA
AAATGCAAAAGCAGGGAGGGAGGGGAAAAAAGAGGAACTGATACCAAGGGCTCAAGTAGA
AAGAAAATGTTTTAGAAATGTTGATGGCAACATATGTAGGAGCCGTGCTTAATATAATTG
AGTGATGGATTGGTCATAAGCCTGTATAAGAGCCCTCCTAATAAAATTATTAATAAAAAT
TTAAAATATAAAAAAGGACCACCAGAAAGAGTAAGAAAATAAAATAAAATGCAAAAGCAT
TTATGTCATAAATACACATTTATTTTTTTTTTGGTTTTGTTTTTAATTTCTTATCAATTG
AGGTTGGATACATATCTCCTATCATTTCTTTTTTTTTTCTAAACGGTTTATTAGAGGCTC
ATACGACCTTTATCTGACTCCATACAAACACCAATTGTGTGGAGCGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNAGCTTTGAGGCACAGATAACAGCCGTGTCTGCCAATGCGACGGTGTGATTTGT
AAGAGGATTCCTTTGAAAACTTTTGAATGACATTTTAATGGTAGACGTCTTTCAAACTGT
ATTTCCTAGTGCTGTATGAAAGGCTGAGTTCAGTTCAACTTGAGAGATGAATGTAGTTTG
AGAAAGCACCACACTGGCTTATGGTACACATGGGCTTGGGGACAATTTGACCAGACATTT
CAACCACTATATTTGGAAGCAAGGAAGCGGTTTTTATAATCCCATCCGAATTGCACCAGC
ATTGAATTTGAAACTATTTCTCAAAGTGAATCAAATTTAGTGAATTTGCCCAAGTTTCTG
TATTTTCCAACTAAATAAAGCTCTCCCCCACCCTCGCAGTTTTATTTTACTTAGATAATT
TTCAAAAGGACTAATCCCTTCAGGAAGTAGATATTACAACAAAGATTAGTATTTAAAAAT
ATATTTGGATTTTTTTGTTTGTTTACATTTGGATTTTCATGCCATTATTTATCCCAGGTC
AATTTTTTGTGTGTCGTTTTTCAGATCCAGATTTGTAAAGAACTTGAATTGTGCTAAATA
TTTCCATTTGCAGGTGTAATTTTTGATAATTTTATTTTGCTGTATGACATCTACTTTTCG
TTTCTACTGAGATTTAAATATTTTACCAGTAGCTCACATTATAAATTAGATAAAGAACTG
ATAATTCTGTCCTGAAGCAAAGAGCTCTGGAGAAAAGTGGAGGCCATTGTTATGTTAACC
CCCCACACCTTTTTCTTGAATGATAATAGGTGAGTCTCTAATTTTTAATATGATGGTGAT
GTTCATACCATATTGCTGCAAAATCAGAGGCTGGATCAGATGATTTCTCGAAGTATTTGT
GTTTCTGGTTTAGAATAAAGTGTTAAGATCAGCATCTGCAATTCCATTTGGATCTGCTTG
TAAACCAGCAATTTGAGAACACGAGTGTAAAAGTATCTTTTGGTTATTTTACCTTAGTAA
AAACATGTAGCTACTGTCTAGGAGAGACTGGTTATTTGTGTAGTTAGAAGTATTAGCATA
GTTAATACAGTATTTTATGTTTTGTGCATTGCCAGCCTTAGATTGGGATCCAAGATTTCT
AATGAGACACTCCTCAGGTGACTAAATATGTGGGAGTATAGGTGGGAGTGGGCTATTCGA
TGTCTTCCAAAGCCATCATAAATTCCACTGGTAGAATGGTTAATGCCTCCCAAATTCTAG
AAAGCGTGAAAAACAAAACCAAAAAACCAGATCACCTTTAGTTTACTCCCCCCGCCCCAC
ATCCAACTTGGAATGTGGAGATTCTAGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNATCACTTGTGAATGTGAATATTTCTGTTGCTTCAGG
CGTACCTCATTTCTGGTATGTGATTTGTGTTTTTCTTTTTAAAATGCTTATGATGTGTAC
AAAGATGATGTGCTGTATGCTTTTAGTTTATTTACTGGAGGATATAGCCTTTAGAGTCCA
TACACAGAGAAGAAGAGCTGGTAGTTGAACATGAGACATTCTTCCTGTTGGCTCTCTCTC
AGCTGCAGACTGGAGTCTCACATGACAGACTCTAGACATTGCTTGCTAGTGATGGTCCTA
TGCTGTTCTCGGCTGCTAACCAAAAGGGGGGTGGTGAAGCCCACACTGTGGTGCCGTGGA
AGAAAGGCCTGGCAATTTATCTCCATAAAGATTCCAACAGTGCTGTGGAGCTCTTTTCTA
CTCTGTAGCACACGGAGTTGCCATGAGTGGAATCAATAAACTCCATGACTTGATACTTGG
GTCTGAAGAGTCTCTCAGGTATAATTACTGTAAAGCCAAAGAAGTCTACGTTCCTCCCTT
GGAAGGGCCCTTGAATTGTGCCCTTTTGATAGCTTGGTTAAAATCTGCAAAAGAAAACTG
CTTCAGCCAAGACCAGTTACATCCAGACCTTTTCTGCTCCACAGCTCCCTCGTGTTTGGT
GGAGTTGTAGTGGCCAAAGGCATTTATACAATTAGCTAAAGGAGAAGTTGATTTAGGAAT
ATGTAATTTTAATGGAAAAAGAAATGTTTGGACCACCTCAATAAAACAAGAGACAGAATG
GATTTCCTGATTTAGATAGTTATATAGAAACTTTATTTAGTAGATTATACATTTATTTAA
AGATAGAAAATTTAAAAAGAATAAAATATGAAATGAACCAAAAATGAGAAATAATAGTGG
CAACAAACTTTTTTGCCAATGGAAAGTAAATTGTACAAAAATAAATCATAACAAAATGCA
GTAATTCGTGAAGTGGAAGAGAGAAATTTTGAGTAGAGATGTTAATAGGTCGGTGAATTA
CTTAATCCTTTTAGGACAAGTGTGTCACATGAATACATTGGAAACGATTTTCTAGTTTGA
CCTAATGTGCTTTCCTTTCCAAGGATAACTTGAAATTCGTAATACATCACATGGGAAATT
ATGAATGGGGTCCATTCAGAGAGAGGTAATATCCAGGCTACTTCACAGTCTCATATGGAA
GAAATGCCACAAGGTGATCCAAAAAATTTGCAAATAAGAGCTATGAATTTGAAATAATTT
TTTTCCAAACACTCGAACATTAAAAAGCTGAGCGAAAGGCCAATTCATTTTATCTCCCCA
CAGAAAATATTGTAAAACCACTGTCATAAAACAAACGACCGCGGAGTGTGCGGTCCGGGT
TTGTAGGGAAATGTCCACCAAGAAGGATTTCTGACAGCTCATGAAGAGTGGCACAGTGCT
TTCCTGGTTTGTTTGTTTTTTAATTTGTGGTGTTTATGGCAAAATTTATAATTTGAGAAT
TTCTTTTCTCTTTTTAAATAGTAATCTCTAATTTCGTATTGTACTTTTTATTTTTATAAG
AGAAGGGTCTAACTTATTAAAAACTTTAAAACAAAACACCTATTCTCATTGAATGGATAC
CAACTCTGAGCGAGCCTTAGGGCCAAGTAGACCTACTCCCTATAGAAGCAGATGGCCCCA
TCTTTTTCCCACAGAGCAGAGGGTGGGTCTGAACTACCAACCTTGTGGTTAGCAGCCCAA
CACTTAACTCACTATGCCCTCAGGTGTCTGGCTGTGTTAGACATTTGTATACATGTCTAA
ATTTCATGCTTAGCCAAGAGGTAAAAAAAAAGACAGAAAATAAAACTTACATCAACTTTT
TAAGAGTTTTTGCTCGTGTTAAAAGAAACTATTTCCTAAATCGTGGTTTTAGATTCAAGA
CCAAAGAAAATGGATACCCTGACTTCTTGCCATGTATTTTTATTCATCACAGTTCTTTGT
GGTTTTGCCATTTTAGACTAATAATTAATTTGTCACTCATTTTCTGTTTGTTGAATTTGC
TTTATCTACCACCATCTTATCTAAGAATCAATGTAATAATGGAAATCAATCATTTAAGCT
TTTAGAATTTGATACCATTTTCATGTGATTTACCTTAGAAGCACGCTGTTCATATATCCG
CGAAACGACAGCCACCTATATTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGCACTGCTGCTGTTTTAGAAGCAGGTTGCCTTGGTCTTGTCTTCCTAGTCCCTCTC
AGTCTGAAACCTGTTCCGCCTCCTAACGATGCCTCCACTGACAGGCAGTTGATAGATGAA
CATGGGCTTACTGACTGATGATCTACTTGGATCTCTCAAATAGAAGGCAAGGACCTACCA
CGGGATCATCAATGCCCCTCACGCCCAAAGTGAGGGGAGGCAGTTCTGTCAAAGCAGATC
ATTTACAATAAAGTGGGTTATTGGACTAGCTGTGGTCTGAACAAACTGCTGTGGACTGAC
AGTGGTGAATTGTCAGAAGAAAGTCAATACATTTGGTAACAATGAGGCTTTCTTCCTTAA
TCATACCGTACTAATTTTTTCTTCTTATAGATTTGTTGCTTATCATTTTGTATTGGAGAG
TGATCGGTGACAAAATATTTGTCATTCATCATTGTACAGTGCTGTACGCATACTACTTTA
TCCTGGTGAGTACCATGCTTCGCAGTCTCTTAACAAGCAGACGAGCTTGGGTATAATGAT
TTAAGGGGGAACACAAGTCTAAGCGTGCATTCTTAATTTTATCAAGACCAACTCAAGACT
TGTTTTGTAATTAACCAAAACAATCACTTAGTGTAGATCTGTATTAGTTTGACTGTTTGG
ATTTTGCTAAATTTTGAGACATACAGATGACTCTAATATTTTGGAATTTTGGACTATTAG
AATTAGGTAAATATAGACTGCCTTTTAAGATGCATTTATGATTTAGCAGCCAGGTGAAGG
TAGAGATTTCTGTCAAAACTCATAAATTATGTTTCCCTGCTTAATCACGTGCTCCCTGGT
TCAGCAGCTTGGTGCACTGAGAGGCGTCTTGCTCGGAGGCTTCCTCGGGATCACAGAAAG
GAGCTTAGAGAGGGTCACTGTAACAAACCTTAGGCAGTAAAGCACTTTCAATTTCATATA
GGACATTATTTTTCTATATGCCCACAACAAATCCAGTGCCATTGAGTTGATTCTGATTCA
TAGGGACCCTATAGGATAGAGTAGACCTCACTCCCTGGGATTTCTTCTCCCACAGAGCAG
CTGGTGTGTTTGAAGCTCAGCATTCAGTTAGTAACTCAGAGCCAAACTCAGGACACCACC
AGGACTCCTTATCTTTTTTGCCCACCTGTTGGTAAAATAGCAATTTTAGATCCTTTGTAT
GTTTGGTTGTCTTTTTGACCTTAGATAAACCAACCAAGCTGAAAAAAATATATTTGGAAT
CCAGGTATCTGTATAAACTAGAATTTAATCAATTATATGTAATAGACATGACGTAAAATT
CCATGTTTTAAAACTTGAATGTAACTTCTGTTAATTACAGGTAGTTAAAAATTAAATCTA
ACAATGATAAATTAAAAAAAATGTTCTGATCCTATGGGATGGTCAAAATTTTACTCTTAA
ATATTATAACCATTAATATAGAACAATTTTAAGATGCATCAAAGGACTTCTTTTTAGATA
GCTGGTATATAGGTACCTTGCTTCTTTAGTATTTTTCATAAAAAGGAAGGCAAACTGTTG
GCAAAATGCAGGTTCCCTCTGTGAAGAGCGTATGTACAGGTACAATTTATATGTTCTCTA
AACATGAGTACAGGAGCCCTGGTGGTGGTGTGGTTATGCATTGGGTTGCTAACCCAAGGT
CAACAGTTCAAAACCACCAGCAGTTCCTCAGGAGAAGGTAGAGCTTTCTACTCCGATAAA
GAGTTATAGTTTCGAAAACTCACAGTTCTACCCTGTCCTTTTAAAGAAATAGTATAAAGT
GGAAATTCCTTTGATGTACAGTATTATAGCTTATATAATATGTTGATGACTTTTTTTCTT
CTTTTGTACCTCTAACATAGTTACTGGTGGTTTATGGGTCTCTGGTGGAGTAATTTAAAG
CTTAAGGAATCCTCTTCTGTCTGTACAAATTAAACCAAATCTGTTGCCATGAAATTGGCT
CCAACCCATCACCATGCCATGTGTTAATAGAATAGAGCAGCTTCCTAGACTTTTCTTGTC
TGTAATCTTCACAGAGACAGTTGGCCAGGCCTTTCTTCGATGGCATGTCTGGGTGGGTTT
GAACTGCCAACTTTCAGGTTGGCAGTCAAGTGCAAAGCACTTATGCTACCCTGGGACCTT
TCTATGAATGCTGTTGTTGGTGCCCTTATGTTTGTCCGGACTTAGAGTGACCCGGTGTGC
AACAGAATGCCGCGATGCCGGGTTTCTGATTATCTTCACGGTCAGGCTGTGTTTGAGCCT
TTGTTGCGTTGAGCCCCTGTGGGGGGCCCATTCTCTTTGGGTTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNACACTTTTTTCGAATGTTTAGGTTTCACCTCTTCTGGACAGGATA
CTAAATATCATGAAAACCCAATAAGCTCACCTTTTCCTTGAAGGGAAATAAGTACATTTA
TGCTTCCGTGTTCTGTGTTGAAGGCTACATCACCGTCCTTTGGCTTCTCTGGGGCTGCAT
CTGTATTTCCGATTCTGAATCGTCTCCTCTCCCCAAACCATAGCATGAAGTGAGCAGCAA
TAGCCTTCATTAGCTCTAGGGCAGACCCCCGGGGATGCAGGTCCCCTGTCTCTCCCGTGC
CACCACATCCCCTGCGCTCCGATCATGCAATGACTTGAACGTCGAACATGTGTCTTCAGC
TGGGCCTTGGGGCATTTATTTAGGTGTGCTTGTGTGCTAGGGGCAGTGTGAGCCTCGGAA
GTGAGAATTACAGTCTGAGCATTGTCACACTTGATCTCAGTCAAGTGTGCGTGAAGCGAT
ATTGAAAATGAAAGGCTTGTGTGTCAGCTACGATAAATGTTCAGTCGGCAGGCACGCATT
ATAAAAGCAGTCTTGGGTGTAGCCTGAGGAAACATTTCTCCACCACATTGCCATGAACTC
ATGCTATGGCTCACTAACATTTTGCTGTTGTGTTAAAAAAGGACTTTAATTTATTTTCTG
CTCTTACTTCCCTAAATGTTGTATGGAGGGGCCGTGAAAAAGAGGACGGGCACCACGGAG
ACGGATTGATGCAGGGGCGGCAACAAGGGGCTCAAACAAGCGGGTGATGCAAGACAGGCA
ACAGCCCGCTCTGTTGTACATAGGGAGGCTACAATCACAGCGACCCCGTGGCACCTAACA
AGGACAGTGTGTGTGTGTGTGTGTATACACACACATATGAATACATATCACGGGCACTTC
ATTTTTTTAGGAGCCCTGGTGGCATAGTGGCTATGAGTTGGGCTAGTAACCTCAAGGTCA
GCAGTTTAAAACCACCAGCATCTCCCTGGGAGATGCTTTCTACTCCCTGGAAGAGTTACA
GTCTCAGAAACTCGCTGGGGCAAGTCTGCCCTGTCCCATAGGCTCCTGTGAGCTGGCATT
GACTCGATGGCAGTGAGTTTGGCTTTTGGCTTTTTAATATTTTTACCCTGGCTAGTCTCT
CATTTAGTTGCGATTAGCTAACTATATAATTTGCTTTTAATTAGATTTGTAAAGTTAGGT
TAATACTAATGAAGCAATTCATTCCCCAATTTAAAATTCTTCAAGTTGATTGCTCACTAT
TGTAAAGAAAAGAGTTGAAGATCTCCCTTTTTAAGTAGGAAAAAGATTAATAGGTGCTTC
AAGTTTAAAAAAATATTTTTCTGTCAGTATTAAACATATTTTCTTTTTTTGCTGCACAAG
ATCTCTTTATTTTATTTTTAAAAATCATTTTATTGGGGGCTCTTATAGCTCTTATAACAA
TCTATACATCAATTGTATCAAGCATATTTGTACATATGTCGCCATCATTATTTTATAGAT
CTTTACTTTCTATTTGAGCCCTTGGTATCAGGTCCTCTTCCCCCACCCCACCCCCTTGTG
ACCCCTTGATAAATGATAAGATATTATCATCTTCATATCTTACACTGATTGCTGTCTCAC
TTCCCCATTGTTTGTCCCCCCGGGGTGTGTGTGTGTGGGGTTATGCGTTGATCATTGTGA
TCGGTTCCCCCTTCCTCCCCTTCTCTCCCCATCCTCCCCTAACCCTCTGGTATCACTACT
CCCATTTCTGTTCCTGAAGAGCTTAGCCGACCTGGATTCCGTGTGCCGTGAGCTCTTTTC
TGTACCAGTGTACATGCTCCCATCTAGCCAGAACTGAAAGGACTGGGGTCATGACAGTGG
TGGGTGAGGAAGCCTCAAGGAACCAGAGGAATACTGTGTTTCATCGGTGCTGAGCTGCAG
CCTGGTTGACTCATCCTTTCCTTATAACCCTTCTGTGAGGAGATGTCCTACTGCCTACAG
ATGGGTTTTGGGTCTCTGTTCCGACTTCCCTCTTTCTCAACAATATGTTGTTGTTTGTGT
TGGGTCTTCTGATGCCTTCTGATATCGATCCGGTCAACACCTCATGATCACACAAGCTGG
TGAGCTTCTTCCATGTGGGCTTGTGGCTTCCCTACTAGATGGCCACCTTTTTTAAACTTC
AATCCTTTAAGACCCCTGATGCTATATCTTTTGGTAGCTGGGCACCATCAGCCTTCTTCA
CAACATTTGCTCGTGCACCCATTTTGTCTTCAGTGATCATGCTGGGAGGGTGAGTGTCAC
AGAATGCCAGCTTATTAAAATAAAGTGTTCTTTCATTGAGGCAGGGCTTGAGCAGAAGCC
CACATATAAATTTATGTACACAGGCCAATACCTCTATTGTTATGAATTAATGTATTTACA
TATGTATACACCTGTGTGCACACCTATGTTTATACCTATATCCATAGCTTCGCTTCCTAG
CTCTTTCCTCTGTCTCCTTTTACCTTCCTCCTGCCCCACCATCAGCTCACCCTTCTTCTG
CCTCTTAGTAATTCCTCTCAGTCATGTTGCTGTCTCTATGTTCTCCTCGTTGTTGATTTG
AATTCCCGAGTGGTTCCTGTCTATGGCGTTGTTGGCTCACCACTCCCTTCTGCTGCCTCC
CCCTCCCCCCAAGTCCCTCTGGAACTACCGGTCCCATTGCTTTCTCCTTGAACCTGCTTC
CCATACCAATAGTGATGGAGACAAAAAAAAAAAAGGAAACAAGAGAGATTAAAAAAACAA
TAACTAGCAAAAGAACCAAAAAAGTATACATAATTCCCAAGTCTGTCTGCTGACCTTTAT
GACTCTCCACACTGGTCCTAGGGAATTTTGGGCACTGCCGCTCCTAGCCTGAAGTCTATA
TTTGGGGCTCCTCGGGGGCTTTGTGGCTTTGCTTTGCTCCTGTTGCTGATCTGTTATGTT
CCCTTGTTCGCTTGCTCAGCTGTGGGGAGTTCAGACCAGACAACCTCCCCGCAACGTGTC
CCCTGTATGGTCCTCTGTTGCTATGTGCTCCAGCCAGGGGACATCGGGTCTTGAGCTGTT
GTCAGTCCTCCAGTCTGCTCTGTGCCTTAGGAGCTCTGTGTAGAGACATCATCCTCAGGG
CTCGGTGTGTCCATACTGGGTCTAGACCCTCACACTCTCTTTTTCCTTCTTGGTTTGCTT
CTGTGTGGGTGTGGCAGGCCAGCCCTTCTCCCCAATCTGTAGTTTTAATGTTGTCCTCTG
TAGCACACACTTCCAGGGAGGCGGTCAGTTTATTTTGATAAACTGATTGGACCTGGCAAG
GGGCTAGCAGAACCCTCAGGCAGACATGGTGAACTTAGAGCATTCTTGAATCGCTTCATG
AGTAAAAATCACCAGTGGCGGGGGGTGGGGGGGAACTAACCCAGACCCTAGTACACTGAA
CCCATTTTTAGCACCCAGTCTCCCAGTATTAGCCTGCTTGGTTCTTAATTTTTTGGTCTA
ACAGCAGGAGCGCCGTGGATGCCGTCTTGCATCCTCCCCCAAATATGTTTTATTATATGT
TAATTTAGTGGGAAATATTGATCACACAGGTCTTAATATTAAATCTTGCTTTAGTAAGCT
ATATCAAGTTGCTGTTTTGCACACTCACCTAGTCCACAGAACGATTATCCAAAATTGGAT
TATCCTTTGAAATGTTGCTATTTGCACAATTATTATAAAAACAAAAACCAAACTCAGGGA
CACCTAGTCGATTTCGACTCAGAGACGCGATTGGACAGACTAGAACTGCCCTTGTGGGTT
TCTGAAACTATAAATCTTTATGAGAGCAGAAAGCCTCATCATCTAGTGAACTACCGTTTT
CCTTTCAGGCTACTCCAATTGGAGAAAAGAAGGCTTCAAAAAGCTTTCCCCAAAAATGGA
ATGATAAGAGAATAGACTTTTTCCATGTACTATTTGAAGTACCCTCATATATGTGTAACT
CATTAAATTAGTATGTATGTATATATATATATGCATATGTGTATGTATATTACATATATT
TCCATTTTCTTTTGGAATGTATTATCATATATTTAATAGTGATATCTGATATTATGGTCC
TCTATAGTTTATCAACTAGGTAAGGCCTTCCTCACTTTTGGGTCAGGGGCAGTCCACACT
CGCTCCACACTCCTTGTTCTTTGGTCACTGCTTCCTCCTTGTCTGTGGGCACACAGCGTC
CTCTCCGCTTTTTGCCTAGGAATTGCCTTAGCAGTCCCCTTTGCTGCTCTCAAATTCTCT
CACTCCCTCTCTTGTTGATAGATTGGACTTGGTGTATGATGATGTCAGAAAACTGTTTTG
GCCATCCTAGTTAATATTTTATTCTTAATTAAAAGTTTTTAAAAAAGAAATGTTAACAAA
GTTAGGAAAAGGGATGAATAATCCTTATTCTGGGCGAGGCATTGCCTTTTGCACAAAAGC
GTCAGGCTTGAATAATAGACTGGAACACATAGGTAGAATTTGCTAGTGGCAAACATTAGG
TGTTACTTTTAAGTGTAATAGGAGTGTAAGAAGTGAGGACTGACCTGAAGGTGGTAGATG
AGCTCAACTTTAATTGAGCCAATCCCTTGCCACATCTGCTAAACCAAGAATACAGTGTCA
AGTTTAGATTCTATTGGGAAGCGCAAATCCAATTCAAGCAAACTTGCAGTTTGTCTGCTC
ACCCCATGCTCAAGATCACCATCTTCTGAGGTTCCTGAGCCTGCCAGTAGTCGGAGGAGG
CCTTCCTGACAGCTGTAGAGAGGTGATTAGAGTAGGCCGCTGTTGTCCTACCACAGGTAA
TCAAAGGGCCTGGAAGATCAGCCTCAAAGACTAGGAGTTGGGAATACAGTGGTGTTGAAA
TGTGAAATCACTGTCGGTGTTCTTGGTGTTAGGTGCCTGCGAGTCAGTGCTGCTTCACAG
CAGCAGTACGTACACTAGACCAAAACCCGCACACACCCGCCGGCCTCCCGAGTGCTCTCC
TGTGTGAGCCCACTGTTGCAGCCACTGTGTCAGTCCATCTCGTTGAGGGCCTTCCTCTTT
TTCGCTGCCCCTCCACTTTGCCAACCATGATGTCCTTCTCCAGGGACTAAGAGAAACTAC
TAGTCAACTTAAAAAGGAGAAGACATACTCTGGTTATTTTAGATCTTGGAACTAGGACCA
ATTGAGGATGGTAAAGAGAGTAGGGAGACTTCCGTTTGTGTTAGTCTGGGTTGACTAGAA
AAACAAATTCTTAGACCCTCATGTGTATCAGAAAGAGCGTTTTATATACAAGGGCAATTG
AATATTGAGCCCAGTCCAGATTAGGTCCATAAGTCCAATATTAGCCCATATGTCCGATAC
CAATCTATAAAGTCCTCTTCAGACTCACAAAACAGATGAAATGATGCTGAATGCAGGAAG
AGTACAGGCTAGTGGGCGCGGAAATCTTGTGGATCCGGTGGCATTATTTCCCACCTCCAA
GGAGGAAATATAGGAGTTCCCAGAGTCCTCAGCAGAAGGGCATGCCCACTCAGACGCCTC
AATGGGCTATATCCCTGATTAACAGGCTAGACTCCACCACTACACTCTGAATCCTCAAAT
TGACACCAGATTACGTAACTACCACAGACACTCTCAGTGANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNATCCCCAATCCCATAACACACATCAATTGTGTAAAGCAC
ATTTGTACATCGTTTCTCAAAACATTTTCTCTCCATTTAAACCCCCGACATTAGGTCCTC
ATTTTTCCCCTCCCTCCCCGCTCCCCACTCCCGCATGAGCCCTTGATAGTTTATAAATGT
GTATTTTGTCATATCTTGCGCTGTCCCGACGTCTCCCTTCATCCACTTTTCGGTTGTCTG
TCCCCCAGGGAGGAGGTCACACACAGTTCCATGTAATCGGTTCCCTCTTTCCTACCCATT
CTCCCTTTACCCTCCCTGTTTTGCCACTCACACCACTGGTCCTGTAGGGCTCATCTGCCC
TGGATTCCCTGTATTTTCAGTTCCTATCTGTACCAGTGTACATCCTCTGGTCTAGCCAGA
CTTGCAAGGTCGAATTCGAGACATGGTAGTGGGAGCGGGGAGGAAACATTTAGGAACTAG
AGGAAAGTTGTATTTCTCATCATTGTTACATCGCACCCTGACTGGCTCATCTCCTCCCCG
AGACCCCTCTGCAAGGGGATCTCCAGTGGCCTACTAATGGGCTTTAGGTCTCCACTCTGC
ACTCCCCCCGTCATTCACTATGGTAAGATTTTTTGTTCTGATGATGCCTTACACCTGATC
CCTAAGTTATTTTCTTGAAATAGATGAAATAACATTGACACTTTAGGTGGAGCTTGTGTT
AAATATACTTTTTAAATCATTTTATTGGGTGCTCGTACAACTCTTATCACAATCCATACA
TCAATGGAATCAGGCATGTTTGTTACATATGTTGCTCTCATTCTCTTCTAGACATTTACT
TTCTTTTAAAAAAAATCATTTTATTAGGGGCTCATATAACTCTTATCACAATCCATACAT
CAATTGTGTAAAGCACATTTGTACATTCATTGCCGTCATCATTCTCAAAACATTTCCTCT
CCACTTAAGCCCCCGGCATTAGGTCCTCATTTTCCCCCTCCCTCCCTGCTCCCCCTCCCT
CATGAGCCCTTGATAGTTTATAAATTATTATTTTGTCATATCTTGCCCTGTCCGACGTCT
CCCTTCACCCACTTTTCTGTTGTCCATCCCCCAGGGAGGAGGTCACATATAGTTCCTTAT
AATAGGTTCCCTCTTTCCAACCCACTCTCCCTTTACCCTCCCAGTATCGCCACTCACACC
ACTGGTCCTGAAGGGATCATCCGCACTGGATTCCCTGTGTTTCCAGTTCCTATCTGTACC
AGTGTACATCCTCTGGGTCTAGCCAGATTTGCAAAGGTAGAATTCCGGGATCATGATATG
GGGGCGGGGAGGAAAGCATTTAGGAACTAGATGTATTTTTCATCGTTGCTACATCGCTCC
CTGACTGGCTCTGAAATTCTGTGGTTTGTTGAAGTTAATTGATTTTAAGTCCAATACCAA
ACGCTAGACAACAGGCAAAGAAGAATAAACTGCATTATGATGCTTTTAAATAACACTGAA
AAGGAAGGCATGCAGGCACCTGGCCTGCCAACACATTCACTTCCTTGGAGGAGAGGGAGA
AGAACACTTACTTGTCAACAAGAAACCTGGGGAACAAATGTGTCTGTGGTTTGTTTGCCA
CCCTCCCCCGCCACCCACGTGTGCAACCTCATCCACAGTAGGATCAACGGCTCAATTCTG
CATCAGGCCCATGCGTGGTTGTAGGTGGGACCGCCGTGGTCCCCACAGGGTTTTCACTGG
CCAATGTTTGAGATCAAATTTCCAAGTTTTTCTTCTTTGTCTGGAAGTTCTGTTGAACCA
TGTTTCGTGTCCTAGCAACATGCAGGGCTCCACGGGTGGATGATTGCTGGCTGCTCATGA
GGTGCACTGTCAAGAGATGGAACATGACCTTCCACCCAAACCAACCAGTTGCCTTAGAGG
TGATTCTGACTCCGAGGGGAGTGGCAGCCTCCAGAGGGTTTCCTAGGTGATACCCCTTTA
GGTTGCCACATCTTTTTCCTGCTGGGTGAGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCTCTTTCCACCCACTCTCCCTTTACCCTCCCAGTATCGCCACTCACAC
CACTGGTCCTGAAGGGATCATCCGCCCTGGATTCCCTGTGTTTCCAGTTCCTATCTGTAC
CAGTGTACATCCTCTGGTCTAGCCAGATTTGCAAGGTAGAATTCGGATCATGATATGGGG
GCGGGGAGGAAGCATTTAGGAACTAGATGTATTTTTCATCGTTGCTACATCGCTCCCTGA
CTGGCTCTGAAATTCTGTGGTTTGTTGAAGTTAATTGATTTTAAGTCCAATACCAAACGC
TAGACAACAGGCAAAGAAGAATAAACTGCATTATGATGCTTTTAAATAACACTGAAAAGG
AAGGCATGCAGGCACCTGGCCTGCCAACACATTCACTTCCTTGGAGGAGAGGGAGAAGAA
CACTTACTTGTCAACAAGAAACCTGGGGAACAAATGTGTCTGTGGTTTGTTTGCCACCCT
CCCCCGCCACCCACGTGTGCAACCTCATCCACAGTAGGATCAACGGCTCAATTCTGCATC
AGGCCCATGCGTGGTTGTAGGTGGGACCGCCGTGGTCCCCACAGGGTTTTCACTGGCCAA
TGTTTGAGATCAAATTTCCAAGTTTTTCTTCTTTGTCTGGAAGTTCTGTTGAACCATGTT
TCGTGTCCTAGCAACATGCAGGGCTCCACGGGTGGATGATTGCTGGCTGCTCATGAGGTG
CACTGTCAAGAGATGGAACATGACCTTCCACCCAAACCAACCAGTTGCCTTAGAGGTGAT
TCTGACTCCGAGGGGAGTGGCAGCCTCCAGAGGGTATCCTCGGTGATACCCCTTTAGGTT
GCCACATCTTTTTCCTCATGAGTGAGTAATGGCTTTGACCTACTGGTTGGTAGCCGAGCA
CTTGACTTCTGGGTCACCAGGACAACCACTAAACTACCAGTATGCCTCTTGAGTACTCAG
AGCCCCTATGTGTACTCGAATACCGTAGCTCTGAAATGCCCTGACTAGCGTTGCAATTGC
TCTGGGGTGTTGGGGCTCTCGGTCTTGAGAACTGTAGAGTGGAAAGTACAGACCACAAAA
GGGCCAGTAGAGAACAGAGCTTATTTGGAAAGGGGAAAAAAAGTACCTGGTGACGCAGGT
GGGGACTCCATTGAGTGGCTGCTGAATGAACTGTGTCCAGGCGTTTTTATCAGGTGTGAG
GTACTTGGTCTGCATCCTTAGGTTCTGAACAGACCAATCTGAGGTCTGGGTCCAATCATG
AACTGGGTCCTGCTCTCCCATGGTCGGGGCTGGCTTACCTGGGCTTGCACAAGGGAAGTA
AGCATGCAAAGGTGAGCAAAGAGTCTTTGGCCTGCTGATGACCTTGGGGTTTAGAATCAG
CCTGGGGATCTCATGCCTGTAGGTTTAAGATTAGATTGTCCCAGGCTGAGATCACCCTTC
CAGATATCCTGCCACTCCCAAAGCTTCTGGACACCTTGCCTCTACCTCTCTCCGCCTGAG
GGCTCTGTATCTCCTCTCTCTCCTTGGAAACTCAAGGGCCTCAACTCGTCCACAGTAGGC
TTGCTGTGACTTATGGTGGCCTCAATATGACAGTGGGTAGGCAGCCTCTAAACTGGGTCT
TTGTATTGTTACTGTAGAACAGAGTCCTCTTTTTACAGGGCAGGACGGGCTTTTATAGGG
CTTGACAGGGTTTTAATTTGGGATGCTCAGAGCTTGTCTTCTACCAATATTCCATGGTGG
TGCAATAGTTAAGTGCTAAAGCTACTGCTTCTAATAGATAGGTTGATGATTGTAAGCTGC
TCAGCAGCTCTGTGGGGGAAGGGACCCGAAGCTCTCCTTTCCTAAGATCACAGCCTGGAA
AACCCATGGGGCAGTGCCATTCTCTGACACAAAGTCAGAGTTGCCTCCCAAGGCACAGGG
CAGCAACAGTGATGCCAAAGAGTACCATTCAAGTTCTTGTTGGCAGTACACGTGTAGGTG
CTTAATAATTGGACTTCCCGTTCCCGTCCACCTTCTAACCCCCTGGCCCTCGCCACTCAC
AGCTGTATCTTTCCTAGGTTAAAAAAAATCTGGATTTTCATAATCCCTGGATAGGAAGGA
ATTTTCTTGTAAACTCTGGAAGAGCTCAGACCAATCCGGCCTGGTTTGCCCTGGTTGGAG
GCGGGGCAAGTGGGGATTTTCCTGAAGACAAAGCTCCTTAGAGGAAGACCGCAAAAGCGA
GGACAACACCTTGTTGAGAAGTCACTTGGGAGACTGATTTCCATTGGCTGGCAATAAAGC
CGGAAATGACTAGTAGAGCAATCTTTTTAACAGTACGTCTCTTGTGGGCGTCCTAATGGT
GTAGTGGCTATGGGTTGGGTTGGTAACCTCAAGGTCAAGTTTGAAACCACCAGCCATTCC
ATGGGAGAAAGAAGAGGCGTTCTATTCCGTAAAGAGTTCCAGTCATGGAAGCCCACGGGC
ATTTCTGCCCTCTTTTCTTTCATGCCTACCCTATCTTGCAGGGTTACGCTGAGTCAGAAT
TGACTTCATGACAGTGAGTTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGTTACCCATGCTACACCACGCTTCAAGACAAAATTTCATTT
ATTTTTAATTAGAACTAAATATCTCATAATATATAAGTACATACTGTTTTTGTGATGAAT
CACTATCCTTTATGTTCAATTTGTAACAATGAAAATTCATCCTGCATATCAGATATTTAC
ATTACGATTCATAACACTAGCAAAATGACAGTACTGAAGTAGCAACGAAAATAATGTTAT
GGTTGGCGGTCACCACAACATGAGCAACTGTATGAAAGGGTCACGGCACCAGGAAGGCTG
AGAGCCACTGCCCTAAAGGATCACGTTGAGTCAGAACTGACACACTGACAGTGTTACTCA
TGTAAACACTGTATTTCAGTAGTTATCCCAGGAGATCCCTGGTGGCAGAGCGGTCCTGCG
TGCAAGGTCTAGCTGTTTGAAGCCACCAGAAGCTCAGTGGGAAACAGATGGGTTTTTTAG
ATAGTTGTTTGGGAAAGGAAGAGGTAAAGTAATAAGAAGGAATTAAACGCAACCTGCTGC
TTATCTAATGGCTGGCCATGCCTCTAGAATTATGTGAGGGCTGTTAGGGGGTAGTGGATT
CAGATGATTGAGGTAGGGAGCCTGGGCGGCGTAGTGGACTTTTCATTGAGCTAGTAACTC
CCAAGAGATTGAGAGTCACTGATGTGCAAGGCCAGAAAACGCAGACACAGACTAACAACC
AGTTCCTGTTGGGTCTGTTCCTCCTCACAAGGATCCCGTGTGTGACAGAAGAGGGCCGGG
CTTGCTAGGGTTTTCCATGGCTGACTTTTTGGGCAGTCGATTGGCAGAACTTCTGAGGTA
ACTTCCAACCTTTGGTCCACAGCGGAGCTTGCTATCATTTCACTGCACAGGGACGCCACG
GGCGAAGGCTGAAGCGCTGAAGCTGCGCTGAGTGTGGTTCAGAGGTGTGAACTAAGAGGA
TCGGTATCAGGGGGAGGAGTGTAGTACACCGATGTTTTCACCCAGTGAGCTAGGATTTAA
TAGAGGAGAATATTTAAAAATTACACACAATATATAGCACTTTATGAATCGGTAATGCTG
TAGTAAGTCAGAGAATGGAAGGACCAGTGTCTTAATTTCTGTTTTTTGCCCCTTAATTAT
TGATTAAAAAAAAAAGAGTTTGTAGAGATAATCTAGTAAGTATGAAGGCATAAATGGGGT
TCTCCCCTGTGAGGCTAAGTGGGGTGCTTGTGGGTGTGGATGGGACTGATTCACCCCAGC
CTTGCTTCTGTGTGGACTGTTTACCTCCCATAAACAGTGAAAACAGCTACCCACTGTCAG
CTTCTTGCATGTGCCACCCAATCCAGTTGGATAATGGACTCTTTTCCTAGCAGCTTTGTT
TGCATGGGATTTAGAGCACGTGTGTATACACACATAATGTACATGCGGACATGCATACAG
TTTACCTAGACAGGGAGTATAAGAGCAGGTACCGAGGCATGGCAATGAAATGACTACATA
CGTCTTGCTCCCTCCCTCTCGGCTGTAACTGCAGCTGAGCCTTCCTGCTCTTGTGTGACA
GTGTGTCCCAACCCTGCTTGCACCTTGAAATCACTTGGAGAGCTTTTAAAAATACCTGCC
AGTGAACCAGGCTCTCCCCAGGCAAAATGAGTCCGAATCGGAGTCGAGCCAGACATTTAA
AAATCCTCCCCATGCGGTTCTGTTGCACACACACCATTGACCTAATGCTTTGAACAAAGT
AGGTATAAACAGTTTCAGAGATCAAAATAGGTGACCAACCACCTCAATTTGCCTGGAACT
GTCCCTATTTTCGGAGCCTTGTGGCACTTTGGGTTAGGCATTGGACTGCCGACTTCCAAG
TCAGTCATTGTCACCTAGCAATCCCTCTGAGGGCAAAAGATGCGTAAAGATTTTCAGCTT
TTAAAACCCTCCCTGTCAAGGGCCTGGTGAGTCAGATTTTACTCAGTGGCAGTGTGGGGG
TCCCTGTTGTAGTGCTGAAAATCCCACAACCCAGGCAAGTCCTGCTGAGACACCAGACAC
CAGGCATGCGTTCTGTTGTGGAGGTAGAGCATTTCCTGGTGTGCACCCCTGATTCCAATT
TAATGGGGAGTGCGGGAGTGGCTTCAGTTGTCTAGTAGCAGTTTTTAAGTATGCTAAATA
AAATTGTTGAAACGTGTATGGAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACT
TGAATCTTTCAGCAGTCCTGGGAGAAAGATGACCCGCTCTGCTACATAAACACTTCCAGC
CTCAGAAGCCCCGGCCGTACAGGGTTGTCGAGTGGGATCCACCTGATGGCAGTAGGGTTT
GGGTACTAGGTGTAATGCTTCTAAATTCAGACAGGTCCCAAAGGTAGGTGTTTAAGTTTT
AGGAACATCTGATTGACATACATTTTTTTCATGTCAAATATGGTATTTGAATGTGTTGCT
TTGTTAGACATGCACTGACTCATAGGCTTATATATTGGTATTTAGGGTGCCATTAAATAC
ACTTCGGAGATTTCTATTGAATAGTGGCTATAAAAATTACCTTCTCTTAGGTGTTTCATT
GCCGTAGAATCCCTTCTGAAATCCACACTCCATCATCATTTTTCCACAGTAATTAGAATA
ATGCTTTTACTAATGGTTATTCACATCCTTTTGTTCAACTTGAGACCACTATTTGAAACC
TGTTGGTTTAATTATGTGCAGTCTGCCAGTTTTTGAAAAGTACTGTAGAATTCCAAGGAT
ATGCGTAAATCCTCAAAAAGAACATCTAAAATCCTTTGGACTGTAGAAGGTAGAGCATTC
CCTTGTTTCTTTTGATGTTGGGAGTGTCCTTTGGCCCTGAGACACACTGGGAACCCCCTC
CGTCTTGAGTCCGGAGTAGGAATGTGATCTCTGATACGTGCACTCTGTCTCTTCTACAGA
CCTATGGAAGCCTCGGGTGCATTGGGAATGTTCGCCTGTTGGCCGAGCTCTCCAGCCCGT
TTGTGAACCAGCGGTAGGTGACTGATGTTCATTATTGATTTATTTTTAAAATCATTTTAT
TGGGGGCTCGTACAATTCTTATCACCATCCATCCATCCATCCATCCATCCATCCATCCAT
CCATCCATCCATCCATTGTGTCATGCACATTTGTACATTTGTTGCTATCATCGTTCTCAA
AATATTTGCTTTCTACTTGAGCCCTTAAGATCAGCTCCTCATTTTTCCCCTTCCCTCCCC
ACTCACCCCTCCCTCATGAACTCTTGATAATTTATGAATTATTATTATTGTATCATGTCT
TACACTGTCCGTCTCCCTTCACCCACTTTTCTGTTGTCCGTCCCCCAGGGAGGAGGTTAT
ATGTAGATCCTTGTAATCAGGTCCCCCATGATGTTCATTATTTTAAGGTGGTGTAGTTGA
TTTTTATTTGGGGGAAAGCCTTTTTTCGTGGCCTTAAGAGTTATTCAATAAAAAAGTAAA
CACACACAATACAAATTACTATGCAGTTGTACAAAAGAGTAAACACGAGGCGTGGCAAGT
GTGGGGCAGCTTTTCTGCAGCATGGCAGTGCCTTACTACCCTTCTGGGCCATTTGCACAA
TCCCATAATTTCAGCTGCCGCATGAACTGTGTCTCCTGAATCTTGGGATTCAGTGAGGTT
CTTCAAAGAAAAAGGACTTTTAACCGACTTCCATTCATTTGGGGGTCATTCACATGTCTA
CAACCAACTTCCTCCTAACCCAAGTTTGCGATATCAACGTACTCCTGGCGCCTCGCTTTT
TAAAGATAGACTCTTTATTTTAGATCTGTAGGCAAATTGTGCTCCTTTCTGAGTTCTCCT
AACGAACACTGGTGCCACAGTGGTTAAAGCACTCACTTAAAACTTCCATCTGGGAGAAAG
GTGTGGCAGCCTGCGTCCAGAAGAATGACGCGCTTGGGAATCCTATGTGGCANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAATTGCCTGTGGTCTTAGTTTTATCTGGCGCCTTGTTCCTATTAAT
ATCCCGTCATCCAGCGACAGAGCACTAATTGAACAGAATGCAGAAGTGGCTTGGCCTTTG
GAGGGTATCGTGACTCATGCTTCTGAACATGCCTCAAATGTTGTGTCAAAACTGGCAGAG
GAACAGCTGAATCTCAAAATTAAAATAGGCACAGCTGTCAGTTGAGATGGCACAGGTATA
ATTACAAGGATTCCAAACCAACCAGGCAAGTGTAAGTGCCCCTGCCCCAGGCTCTGGGCT
GCTTTGAAAATTATCTACCCCAAATCCTCCCATCCTCTGGTCTGGACTTCAGGCTTTCTT
TCTCTCTTGATATTCCTTAAGCATGTATAAAGTCAACAGTAGGGGAATTTGGCAATGCTT
CCCCATGCTAGTTAACTGATCCCTGACAGGTGTTTCTGTCTTGAGTCACTGTGTCTGATG
CCATTTATGACAGAGCTTCTAGGGGCCCCCTGTCATTGCTAAATATCCCCTTCCTCAACT
ATATCCTGCTAGATTCCACTGCCACGTCGAGTCCTGTCGTCTTCCCAAATCATTGATTAG
CCCACCCCAGGAATGACCCGAGTGGCACATTTGAAACCTACGACTTGTAGGGAGAAGGAC
TAATATGGACGATAAGCTGCATTCGGATTGGAACTAAGAATCAAGGCTACATGGAAGTTG
GAAAAGAATAACAGGAGGAAACGACTTAAGAATGCAGAAAAAATAATAAAGATTTTAAAA
AATACATTGCCTTCTGATGCGGGAAGTTTGAAATGTGGATTTAGTGGAATTCACTACAAA
GTATCAAGGAGTTTTCATGACTTATTTTAAGATGAAATATGTATTACATTATGTATCTTA
GCAGATATACGTGTGTGTATATTAGTGATTTTTATTTGTATACACACATAGGAGAGACAT
ACTCTCCGATGTATTGGGTATGTTTTGCTTTCAGTTTAAAAATCGTTTGTAGACAAGAAT
GCCTGTTTTGATAGGAACTGAAAATACAGGGAATCCAGGGCGGATGAGCCCTACAGGACC
AGTGGTGTGAGTGGCGAAACAGGGAGGGTAAAGGGAGAATGGGTAGGAAAGAGGGAACTG
ATTACAAGGAACTATATGTGACCTCCTTCTTTGGGGGACAGACAACCGAAAAGTGGGTGA
AGGGAGACGTCGGACAGGGCAAGATATGACTAAAATACTCATTTATAACTATCAGGGCTC
ATGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNAATGACATCAGGGTGATTTTTCAGCGTCAACTTACATGCTGGGGAGTCCAGAGCTA
GCTGGCTGAGGAGCTGCAAAGCCGGGCAGCCTTAGGAAAATGAGTAAAAGGGCGGATCTG
TTAGGTATTTCCGGGGGAGGGGGCCCAAGGAACTCAGGAAAACGGAACATAATTTGCCAA
CAGGGCTGAGAAGTGGTGATGTCAGGACGTGGAGGACCACAGCCTAAGAAGTCAATCAGC
GGGCGAGGCAGCATGCCCTGTGGCTGCCTGGGGGGGAGAAAGGAACGTCAAGGTCCCAGG
CACTAAAACAGGGTTGCAGACAGGGATGGGTTAGTGGTTAGGAGAGGAGCTTAGGAGAAG
GCGTAATGGCAGTATTGTGCAGGATGCCCTGGGAAGGAGTGGAAAGCTTCCTCAGGGCTC
CACTGCCAAGGTGTTCGTTGCTTCTCACACTTGCTGTGAGTACTCCAGGTTCCCACCCTC
TCCCCTAGGGAGGCTTGCTTCACAGCGGTTCCCAGATTCCTCCAGCGTCAGCTTGGTCCT
CTCAAGGCCTCAGGCATGATGGTGATGACACCCCAAGGCGGGTCAGTGATAGAGTCCTCA
GCTTCCAGGCCAGAGTCCCAGTCTGCTAAGATGCTGACCGGATTTCAGCTGAGCTCCTAG
ACGAAGACCAATTAGGCAGAAAGGCCTGGTGGTCTAAGTTTGAACATCAACCAGTGAAAA
CTACGGATCACAGAAGTCTGAACGTCAACTGAGAAGGCAAAGGATAGGGTACCTTTTTTT
TTTTCCCTTCTCCCTGCTGTGTAGGAGGAGGTCCTGGGGTGGAGCTCACTGCAAGCGCTA
ACAACAATGGGATTTTAGACCACACGCTCACGATGTAGCCACAGCGGTGCCGGGGCAGCC
GTGTAGCACGTTAATGAGTTATGTTCCCCAGGTCATCTTTCGGATAGTGTATGGAAGTCA
CAGGTTCGAAGCAGGGCTAAAGGAGCAAATGCATCTTGAAGCACAAGCAGAAGTTACCAT
GCTGGGGTTAAGTGTCTCATTTCAGCTTATGAATTAATTAGGGGGTGAGAGGCACCCTTA
AACGTGCTCATCTTGGACTACCTACAGTGTCTCTCTCCCATCCGTTACAGAAGCTAACGA
CTGACCCAGCACGGGACATTTGCCATCATGTTAGGCGCAGTCCTGCTCTGAGAGTCACAT
CGACTCTCAGGTTTTGACAACTTCGCCTTGCCCCAGCTCTTCAATCCCGCCTTCCAGGTG
AAAAGTCTCCACAGAGGGTGCCACTCTCTGCCCTATGCGCACTGAACTTCCAGCCCTTGC
CCCGACTTGAGACACTCTTCTCTTATTAATTTGGATTTTACTCATCTTCAAGGTGAAATG
TTCAGGGATTTGGTTCATTCCCCCACCCCACCCTCCAAACCAAACGAATGGACTGACAAA
ACCAAATGCATGTGCAGGTAGAATGGGCAGAAACAAGCTCATCAAAGACTTAAGTTATTC
AGTACCTGGTAGATTTCCAAGATGTTTCTGAAACACCAGGATAAATAAATGCTTTCTTGA
TTGACAGCCTGAATCTTTGAACTTCTTGCATGGAATCAGCTTTAAGTTACAGCTGACCTT
CCGTGTCTTCTTTCGGCCTCTTCTCTTGGCTGCCATGGTGTTTATTCTGACCCAGGTCAA
AAGAGTTCGTTTCCTCACCCCACTGCTATGCCGCGTACTAAAGTAATATTACTCCAAGCC
TCTTCAGGCTATAGCTCAGATTTGCTCATGTTTTAGTCCCCAGTTGTGCTCCCCTCCAAA
ATATATGTTGAAGTTACAACCCTCAGTGCCTGTGAATATTACCATGTTTGGAAAGAAGCC
TTTGAAAATGCTAGCAGTTATTTATTCTCTTGGAGTTGTGCCACATCAGCACATGAAGGT
CCTACAAATTTTATATCATTAAGGTTGGCTCTACTTTGAAGAGGCAGCTTGGGCCCAGTT
GTATTTTGCGTGTCTTCCAATATGAGGGGCTCATTTGTCAGCACAGTGTCGGACAATAGC
CCACTGCTATTCATAAGATTTTTCACTGGCCAATTTTTTTCAGAAGGTCTGTCTTCATCT
GGAAGCTCTGTTGAACCCTGTCCACTATGGGTGACCTTGCTGGTATTTGAAATAAGGTTG
GCGTAGTTTCCAGCGCTGAAGCAGCACCAAAGCTAGCATAAGAGAAAGTGGCATGGCAGA
TGAGTACTGGAAGTTGTTTTAGGGTGGGTTCTCTAGAAGCGCAAAAACAACGACACTAAA
ATGCATGTGTGTGTGTGTGTGTGTGTGTGCGCGCGCGCGCGCACAAAGAAACTTATCTCA
AGGAAGTGGCTACACAATTATAAAAGTAGATAAGTCCAGTCTTATTAAAGTCTATGGGTC
ACGCGTTAAGCTGGTTGGTTCTCCTGACTTTTGTAGCTGTGAGGTCTGTTGAACGAGGAG
ACAGGAAGCTAAAGCAGGGAGACAATGGATTGGTGGATGCAGAGTTGAATGAATCCACGT
TCAGCAGTCCACTGGTAGCTCCTGGAATTGGCAGGCAATATGGATGACCTTAGGCTCCAT
CAGAAAAACTGGAGGTTGACAAACAGGATACAGGATCCAGACTCAGTGGGAGGGAGCTTA
ACTTCCTCACAGCCTCAACTTAGACAGGAATAGATCATGCCTCTGATGAAGCTTTCTTCC
AATTGCATCATAGCTGTGGCCTGGTTAAGGGGGAAGCACTCCACTTTAATCATCTCATAA
CTGCCTAGCTGCTCAGAACAGATCCAGTCATGGAGTTGATTGTATTATATTAGATCACCT
TATGAGGGAGGCCTCCCCTGCCAAACTACTGGGAATCCTGGCCCAACTACGTTGAAACAA
AACCTAAGTATGACAGAAGTTATTAGCTATTGGTGAAGTCATCTTGGAATCCAGGAGACC
CTATTGGGGAAAAGAGAGCGAGAAAGAGAAATACAGAGGCTAGATGGCCATGGGAAGACA
GAAGTGCAGATTGGGGTCGAACACTGAGGCTTGCTAACAAGCAACTAAGCAAAAGGCATG
GAACAGATGGTTTCCTAGAGCCTTTGGAGAGAGGATGGCTTGGCTGACATCTGGATATCA
GATGCCTAATACACAGACTGTGAAAAAAGAATTAATTTTCTGTCTTCAGTGATGTGCTAT
GGCAGCCTGAGTACACTCATACACAGGGTGGAAGCACCTCATCTGGTGTCTAGAAACCTG
GATTCCAGTCATGGCCCTGCCAATGACTGGTGACCATCTCAGGTAAGTGCTTTCACCTAG
CTGACATCCACTTCTTCCTCTATAATGTAAGGGGTAGAACTAGGTAAGCCACACACTCTT
TTCTCTCTCAAATCCCATCATACTGTGATTATGATGATTAAATTCAATGACAGCGTATTG
CATTAGGTGCATAATTCTTGCCAGACAGCAATTCCAGAATATTGATTTCAGTTGCATTAA
GTTGCTGGGAGTGGTCCCCACCGTAGATTTAAACCCTAATTTCAATTGTCACTGTATGCC
CTCAATAAACAAGGCCACTTGTTTATAATGCCATCTTCTGCATTTTTAAGAGGGGATGGT
ATCACTTGCAATCAATGAATCTTGCTCAAAAGGCTGAGTGTTATATTTGCTGAGTGCCTC
AACGTTCCAAGGGGAAGAGATTAAGTTTTAATGCTGTACTTTCCCACTACACTTGAAGCC
AAGCTGAATTTCTCAAACCCTCTTCCTCGCGTTCCCCTGTTGGAGATGTGAATATCTTGG
TCATGGACTCCAAGGATGGAGCATATTTTGTTCTTGTTCCCTGCATTAAAATATGGTCAT
CAGTGAGGAAAATAGCTGAATAATGAAGATGTAGATATTAAAGTTATTTATTCCTCACTT
TTGAACGCAAACAAAAAAATCGGACCCTCAAATTATCTGAGAACCCAATCTGCCACTACA
CTAAAAGGTTAATTACATTGGTTAACTCTGAATTGCATGGCGATTTTTCTAGAAGATTTT
GTGTTTTTGGCTAACTTAAATACAGGTTGTGGAGAGTCGGAATAAGGATAAATTGAGATG
AAGGAATTATTGTAACAATATTTATTTTTGTGTTTGACTCGAATGAGCAGAAACTCTCTT
GTTTTTTATAACTTTATCATGCTCTAGCTGACTGATGACAGAATTATCCATACTAGATGG
GCACTCTAATAAATTATATCTTGAAGGAAAATAATGTAAGAAGTATATTTTCACTGCTCT
AGGGAAATGTGGCTTTTTTTTTTTAGGATTTTAATGAGCAAAAGTTGCTCTAATTAAGAT
TTATGTTCTAAAGAATGGAGTTAGAAAAATACTACAGATGTGGCAGTAGTTTAATTTTTT
TCTTTAAAAATGACTAATATGAGAACTATGGTACCTTTTTATAAGTATTTTTAAAAATAA
TCTAAATTGGTTGTTAAAAAAAAAAAAAGTAAAGCCAGAAGAACTCTATTCTCCATAGCC
CATACTGTTTGTGATTCTCCAACCATAGCTTAAATTCTTAAATGTATTTATCTTGGCTCC
ACCCAAAGACTTACATAGCCTAAGCTTATCCAAGTCTACAGCACTCTGTTAGAATAATCA
GATAACCCTGATAATAATCTGTGTCAACTTGGCTAGGCTTTGATTTGTATTGGTTTGGCA
TCAATGTCATCAAGAGTAATGACTTCTTCAGTGACAATAACTTTCTTCAACAACACAAAT
GGAGACTATGCAGATCAACTTCTCCAGGTAGAATACATCGAAATCAAATTGACTATATCT
GTGGGAAGAGATGATGGAAAAGCTCAATATCCTCAGCTCCAACTAGGCCATGGGCTGACT
CTGTGTGGTACATACCATCAACTGCTTATATGCAAGTTTAGGTTAAAGCTGAAGAAAATT
AAAACAAGTCCACAAGAGCCAAAATATGACCTTGAGTCTATCTCACCTGAATTTTGAGAA
TTATTTCAAGAAGAGACTTGCTGCATTGAACTCTAATGAACTTTGATGAGCTGTGGGTTG
ACATTGGGAACATCATCCATGGAGAGAGCAAAGGTTAATTAAAAAATAGAAAAGAAAGAA
AAAGATCAGTGTGGATATTAGAAGAGACTCTGAAACTTGTTCTTAGTTACAGAGTAGCCA
AACCAAATAGAGAAAGGATGAAGTCAAGAGTTTAACAAAATGTCCAAGGGCAGCTTGAGA
ACACAAAGTCAAATCTAATGAAATGTGCAAAGACCTAGAGTTAGAAAATCAAAAAGGAAG
AGCATGCTTAGCATCCTAAAATGAAAGAACTAAAGAAAACACTCAAGCCCTGAGTTGCAA
TATTGAAAGATTCTATGGGAATACATTGGAACAATGCAGGAATAATATACATCCCCCACA
AAACCCCTTTGTGGCAGAGGACTACTAGCCCCAAAGTTGGTTGTTTGAAACTACCCCATG
AGAGACACACTGGGGATTGGTTCTGAAAAGTTCCAACATTAAAAATCCTATGGAACAATT
GGTCTTAATGAATTGGGATTACCCGCAACTAACAGCAATAATGAGTACCAGCACGATGCA
GACCAGAATGTATATGTGATGAACAAAATTAGCAGGAACCTTGCTCACATGGAGTTTAGT
CTGGAAGACTGCTTGGAGAGGCTAAGTGTCCCCTGTAGGCTGTGACCTTTGATAACCAGC
ATCTTGCATGATATTTCACATATAGTAAGTCCATTAGTCGACAAATGTTTTTGACAGGAT
ATACCCCAAAATGTACAAAGCTTTGTTTCAGGTTCTGGAGATGAAACATCACCAAACAAG
GTGGGCAAGAAAGGGCCTGCTGTCTTAGTACATACATTTTAGCAAAGAGAGGTAGACAGG
AAAATTTGAAGACAAGAAATAACCATCATACAAGTTGATTTCCAATAGTAATAGTGCTAT
GAAGGGAATTCAAGAGTGCACATCAGGAGGACATTCTAGAAAGGCAACTCTATGGAGAGT
ACACTTGTATTACGGAATCTACAAGTGTTGTAAACCTGAGGAATAGCAAGTGAAATACTG
TGGTAGTGAGGATTGTGTGTGCACTGAACAGTGGCCAGTCTAACTGGAGTAGGGTGAATG
AGGACGAAAGAGATGTAGGATGTGGTTGGAGAGGCAAGGAGCAGCCACATCACATAGGGC
ATTCAGACCACGCTAAGGTGTATGGCTTCTCATCATCTTTAGAATTAACATCTGGGGTCC
AATTTTTTATTTGCATTTTTCTTTTTGGAACTCACAAGAAGAAATATTTTTGATTTTGTG
ATGCTGGTCATTTAAACAAACAAACAAACAAAACACACACACATACAAAATGTGAAGTAA
CACTGTTATCATGAGTAATACACTCTGGTATTTTCTGTACATTTTTACTATAAAAGAAAA
AGAGTTGATTGTAACCCACTAGACTGATTTCATAACTCACCAATGGGTTACAACTTAGAA
TTTGTAAAATGTTGCTTCAGGTTAAAGTGGTGACAGTGGAGATGGATAGAAATGGACAGA
GTCTGGGCATATTTTGGAAATAGAATTGATAGTGGGTTTTGATCACTGTTGTGAACAAAT
AAGGAAAAAAGTCAGATGAGTGATTATTTCTATCGTTTTTAGCTTAACAAATGGGAGATG
GTGGGTCCTATATCCTGAAATGAGAAGCCCGAAAGAGGAGCAGGTTTGTAGAGGGATGGG
GAGGGGAATTAGTGTTTATTATCTAAAGACTCAGAAAAACTCTGAGTATATCGTCTTGTG
TATCTAGAATTTATGCTTAATGGTTCAAATTACAAGCCGACTCTTAAAATTCAATATATT
CTTTAAATGTTTATTTTCTCTGTATTATAGAAAGAAAACATGCTTACCAAAATAAAAGTG
ATCCATGGTCTAGCCACACACAAATGACCATGGTTAAGTGCTCTCTTTAATGTAACTTAT
ATGAATCCATTGACGCCATTGCTTCAACTTGAGTAAGAGATCATTAAAGAGTAGAAGTAC
TTAAATAGTGTCGGATGGTCCCTGAACTTAGAGCTCATGGTGGTTAAGACCTTTGAAACT
TATTGGGAAGGAAGCTTCATTTTCTGATAGAGTGATTTTAATGATAAATCCAACCAGCCA
GTCTTAAACTTAAAACTTATCAAACTTAAAAAATGCGCACACACCATACTTTCCAAATAG
TTCCGGGGAAGTGTTCAGATTCGGATGTATACTTCACATCCACTCCTTCAACATCCATTC
CCTAGGTCCTCTTGCGAACTACTAATTCACAGATGTCCTTCACTCTTGAATATAAAATCA
TAATTGAATACGCTCATCCAAGCCACATAAGCCCTTTCTGATTCTTCTGATGCATAGCTT
TTAAAGCAACATAGTCCCTAGCCATCTCTGAATGACTAATGATTTCATCTAGCCCAGTGG
GCATTTAAATAGAGCATTAGATATTGCTCCCCCAACCATCTTGTCTCTTTTCCTATCTTA
ACACTCCTTGGGTGATCTGAGTGAAGCACTTAGACTTTTTGTACAGAAATATGAGGGAGA
ACATGGTCCCTGCCCTCAAAGAGTTTATAATCTAGTCTTGTTGACAAGTGACTTCTTGTT
TCAAATACATTAAAAAGAATTTTTCAGTAAACCTTAGATATACAAAAAAATGAAAAACAA
TTTAAAGCAATGATGATACAGAGTTCCTACATACCCTGCCCTTGCTTTCTCCTATTATTA
ACATATTTCTTTCTTTTTCTTTTTAAATCCTTTTATTGGGGGCTCATACCACAATCCATG
CAAACATCCTTCGTGTCAAGCGCATTTGTACATTTGTTGCCAATATCATTCTCAAAACAT
TTGCTTTCTACTTGAGTCCTTGTTATCAGCTCATTTTCCCCTCTCTCCCTGTCCCCACTC
CCTCACAAACCTTTGATGATTTAGAAATTATTATTATTTTGTCATGTCTTACACTCTCTG
ACATCTCCCTTCACCCACTTTTCTGTTGTCCATACCCCAGAGACATATGTAGATCTTTGT
GATCGGTTCCCCCTTTCTACCCCACCTTCCCCTTATCCTCCTGGGATCGATACTCTCAGT
ATTGGTCCCAAGGGGTTTATTTGTCCTCGATTCCCCGTGCTTCTAGTTCTTATCTGTACC
AGTGCCCATCCTCTGGTCTAGTCCGATTTGTAAGGTAGAATTGGGATCATGATAGTGGAG
GGAGGAAGCATTCAAGAACTAGAGGAAAGTTGTATGTTTCATCGGTGCTACCCTGCACCC
TGACTGGTTCGTCTCCTCCCCACAACCCTTTTGTAAGGGGATGTTCAGTTGCCTACAGAT
GGGTTTTGGGTCTCCACTCCACACTCCCCCTCATTCACAATGATATGAATTTTTGTTCTT
TGATGCCTGATACCTGATCCCATCGACACTTCATGATCACACAGGCTGGTGTGCTTCTTC
CATGTGAGAAGCATTATTTTATAGGCAATTTAAATAATACTATTTATAGAATTTTAAATG
TTACCCTTTTCTCTTTATCGCCTAAGCATTGTTTCCACTTAAGAAGAATATTAATGCTGG
CCAGATACTCAAGATATTACTGATTTTGGCCACCTCATTTTTCAAATGAGCATCTTAGCA
ATCTGGGCTCAGACTAGACTGCGGAGTACAAATCACAGCCGCAGGCCGCTGTCCATCTCC
AGGTCTGTAGGTACTACATGGCTACTCTTCATCTCCCATGGAAAAGACCTGAGGATGTAC
AAGATGCTTCCTTCTCTCCTTTCTTCCACCAAGAAGTATTTACTGAATGCCCACTGAGTA
TCCATGATTCTCCTGGTGAAAAACAGCAAACAACTCGGTCAGTGACGCCCTCAAAGTGCC
TACCCTGTAAAGGTCTCATAGTTTGGAAGGCAGAATCATGGTATATTGAGTTCCTGCGTC
ACTTCCGGGTGGTGACAAGAGCAAAGCAAGCCAGAGAATGGGATGCAGACCTAATTTCCT
CGTGTTGATGTGGGACACAGAATGGTGGTGGCTCCAAAGGTGTCCTTGTCCAAATTCCTA
GAACCTGTACATAAGCCATCTTCCATGGCAAGAGCGGTTTGGGGGCAGCTGTTTTTAAGT
TAAGGGTCTTGGATGTGAAGGTTAGCCTGGGTTATCCAGGTGGATCCAATCTACACCCAA
GGGTTCTTAGAAAGTGTGAGCTAGAAGAGTGAGGGAAGATGGGAGGAAGGAAGCAGAGGG
TGCAGTGATAGGATTGCTGGCTGGGGGCGCATGCGCCAAGGAGTCGCCTCTGACTGATAG
CAACGCTGCAGGACAGAGAAGTGGTTATTGAGGGCCGTTGTATTGATTCCGACGCGGCAA
TCCTACGCACTACAGAAGGAAACCTCCCCTGGTCCTGTGTCATCTTCACAATTCTTGTCG
CAGCTACTGTAGCCTTTCATCTTGTTGGGTCTTCCTCGCTCTTGATGCCCCTTTACTTTA
CCAAGACTTTGATCCTAATAGTCGGCAGTTCAAAACCATCAGTTCAAAACCTCAGGAGGA
AGATTGGGCTTTCTACTCTCATTACTCTCATAACCTTGGAAACCCACAGGGGGCTGCTAT
GAGTCAGCATTAGCTTGATGGCATTGAGGGAGTTCGTCTGCTTTACCCAGCAGGATGTCA
TTTTTCAGGGACTGACCTCCCCCGACATCATGTCCAAAGTATGTGAGACAAAGTCTCACC
ATCTTGGCTTCTAAGGAGCATTTGGCTGTGGAGTAGAACTGCCCTTTAGGGTTTCTGATA
CTTTAAGTCTTTTCAGGAGTAGACAGCCTCATCTTTCTCCTGCGAGTCAATTGATGGGTT
TGAACCACTGGCCTCGCAGCTCAGTGTGTAGCCCACTATGCCACCAGGGCTCCTGGAAAA
GACACAAAGGCCATTCTCCCCTAGATTCTCGAGAATTCATTTGCCCTACTTCTATGTTGA
ATTAGCCCAATGAGACCTGTTTTGGGCATCTGAACTGTAGAGGAATACATTTGTGTTGTT
TTAAACCAGTAAGTCTGTGGGTATTTTATCTGGTGACAATAAGTAACTAATAGTTGGTGA
ACGGGGTATCTAGAAATAACTTTTGGGGAGTGGGGGGAGGTTTGTGTGTGGAAGTAGTGT
TACAGTTTTGCAGAATCAGACATATTAGACTCTAAGGTTCATCTCTGCTCTATCAAATCC
AATAATTTCATTTTTCAGATGAAGATAATAATAAAAAGAATATCTGCTAAACTGTTCCTT
ATTCAAACTGATTTTATTACTTTTTATGGAAACTCTTATGGAGCAGCACAATTCATAATA
GCCTCCAAATGCCATTCCCCAAACAAGCCAAGCTCACTGCCATCAAGTTGATGCCAACTC
ATAGCAACCCTATGCACTACAGAACTACACTACCCAGTCCGCTGGCATCCTCTTAAGTGC
TCCCGTGTTTGAGCCCACTGATGCCGCGGCTCTGTCAACCCCCTGGTCTAGGGCCTTCTT
CACGGTCTCTCCACTTGACCAGGCAGAGGTGCTTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTTTATTAATTTATATTTGTGTATATTGTTTTTGGTGCCATAAAAAT
TATATGTAAATAAATTGTATATAATTATATATGTACATTTATAACTATATATAATTTCAG
CTCCAAGCAGTTGGCTCTTTTTTCTTAATCTTGTATAGATAGTGTGACCTTGTTGTGCTT
GCTGTTAGTTTCAGGATATTTATATTCTTCTGTTCTCTGAAAATGTAGTGGTTTTAGTTT
TCCTTCTCAATCTACACACCTCTTTTTTCTCGTCTTATGGCATAAGCTAGGACTTCTTTT
CAGTACAGCGTTGAGCAGAATTAGTGAGGTAGGCCATCCTTGCTGATCCTCAGAGGTGTT
GAAAAATAAAACAAACCAAGATGTTTCTTTGTTTGCCCTCACCCAGGTGGTTCTTCGAAG
CTCTGAAGTATCCGAAGTTTTCCAAAGCTAACGTCATCAATGGAATACTCATGACACTAG
TGTTTTTCATCGTGAGGATTGCTGTGATACCTCCGTACTATTTCTTCATATATTCTGTGC
ATGGAACAGACCCTTACATCCAGCTTGGACCACTAATACAGTATTCCTGGATCTCTTCCT
GTGCCGTCTTAGATGTAATGAATGTCTTGTGGATGATCAAAATCACGAAGGGATGCATCA
AAGTCATCTCCTCCATCCGACAAGAAAAGGCCAAAAATCGTCTTCAAAATGGAAAAACTG
ACTAAAACTGGGAGATAGAGAAGCAAACTTCATTCCAACCTGGCATTTATATCTGCTGAT
AGGATGAAATCTTGGCATGTTCCTGTGTTTCTTTATTAATTATAAGTGTTAGCCAGACTT
TCAGTGTGAGTCTTTTTTTTAACTCTAGAAAGTAAAACTAAAAATCAGTTTTTATTCAAG
ACTTCCTTTCTGATTTTTCTTCTGCATTCTAAGGTTTAAATGAAAATTTACAAATATAGT
GGTGAATCTTTTCAGAAACCTGTTAATCTGCATTGGTATTTTTCTCTATGCTAACTCAGT
ATACTGGTTTTACATCATTAATCCGGTTGAAAGAATGGAAAACCGCTTTAAAAATTTTTA
ATAGTTCTCAACATTTTGTTGCTCTGTACTGCTTTCTTTCCATGACTGTCAAGACCTGTA
TAAAGCTTGCTTTTCTCATTGTTGAAATGTTGGTTTTCCTTAGCCTCGTAGCATTGAAGG
AGCTCGTGGGGCATAGTGTGGCCTAATGAGTGGGGACAGTGAATCTGTGTAGAGTGATAT
GGGGACCCCCGCAGCCCACTCCCTTGGAATAAGCTGAGACGCCCTCCCTATCGGTGTCAA
TGGGACAACTTTCAAAGCCTGGGTCTGCTTCTGGTCTTAAGGGGCCGGTGTAGAGGGCTA
TATTGGTTCCGGAACGGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTAAAAAG
GAAATAATATTTAATGCCCCACTTACCTAGTACGATATCCAATCCACATACACACACACA
CCCATCCCCCAAAAGTCATTGCGGACTTTATCAGTGATGTAGAAACTTATGCAAGACATG
TTAAGAACAGGACCAAAAAAAGGGAGGTAAGTTAGAGAGTTTAAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1149, 5837..5926, 55095..55140, 55142..55154, 57750..57844, 73979..74052, 113386..113704
1001..1149, 5837..5926, 55095..55140, 55142..55154, 57750..57844, 73979..74052, 113386..113701
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved