Echinops_telfairi Locus IGF2BP2
snOPY snoRNA Orthological Gene Database
Echinops_telfairi IGF2BP2
Echinops_telfairi
IGF2BP2
GeneScaffold_703
SNORA28
15209..15330
78679
GGCGTGCACCACTCGTGCTGGCCCGGCCTGTCTCGATCCCGCCACCTCAGGGTTGCCTC
CGAGTGCTGGGCGGGGAAGCGGGTCTCCGGGGGAGCGCTGCGCCCGGGAACGCGCAGGGA
GCGAGACTTGGCCAAGTCACTGCGAAAAGTTGTGGTCTCGCAGCCTCACCTCCTGGACAC
ACCTTCCCGCTCTCCGCGGCCGCCGCGCACTGACGTCCGGCCCACCTTGCGCACACGCCT
TCCCCGCGGTCACCAGCCGTCCCTCTCCCGTACGCGCCCGTGGGTCCTCGCGCGCTCCCG
CCGGAGCCCGGGGAGCTTCCCCAGGCCCCCATTCGCCCGGCCTCCGCGCCCCGGAGTCCC
AGCCCGGGACCGGACCCGCTTCCGCTCGCGCGGCGCCCAGCTGCGGCCGGAGCCGGGGTA
GCGGCGCGCAGCCCCTGAGCGCGGCGGGCGCGAGGCGCGAGGCGCAGCGGCGCGGGCCGG
GGGTGCTCGCTCCTTCGCGGCTGCGCACACGCTCGAGCAAACTCTCTGACTCACGCGGGG
CGAGCAGCCGCCCGCCGCGGGTCCTTCCTCCCGCCAGTCGCCGCCGCCGCCGCCGCCGCC
GCCGAAGGGAAGAAGAGCGAGCGAAGCAGAGAGAGCGCTTTGTCCGCGCGCCGCCGCCCG
GCCCGGGACTCTGCCCCGAGGAGGCAGCCGCGCCGAGTCCCCGCCTCCGCCTCTGCCCCC
GGGCGGGCCGGGCCGGCCGCGGTGGGGGGAGCCAGGGTGGGGGTGGGGTGGGGGGCGGGC
GGGCGCGGGGCGGGGAGGGGGGGCGGCGGCGGAGGAGGAGATACGAGGGCAGCGGAGGAG
GCGAGGAGCGCTGGGTACCGGGCCGGGGGAGCCACGGGCTCTCGGGGAAGAGACGGATGA
TGAACAAGCTTTACATCGGGAACCTGAGCCTCGCGGTCACTGCCGACGACCTCCGGCAGC
TCTTCGGGGACAGGAAGCTGCCTCTGGCGGGACAGGTCCTCCTCAAGTCTGGCTACGCCT
TCGTGGACTACTCTCGACTAGAACTGGGCCATCCGCGCCATCGAGACCCTCTCGGGTGAG
CACCCGGCGCTGCCCCGCTGGGAGCCGCTCGGGCCGGGACGGCGCCCCCGGGGAGGCCGC
GCGCGGCGGGCGGCGCCCGGCGGCGGCACGCTCACTTTCACGCACCGGGTCCGCTACTCT
CGCGGCCCGCCGGCCGGGGCACGGCGCTCCCTCTCCCTCACGCCGGGCTGGCCTCTCGCT
CCTGGGGCGCCTCCTCGCGCTGCTTCTGCGGGTCCTCGGGGCTCGCTCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGACCCCGTCTGCGTGATCTAAGT
CGCGGTCTGAGAGGCTAAATTCTGATTTTAAATGTACAGTGCAGTTGCATGGGAAAATCA
TGGAAGTTGATTACTCAGTCTCTAAAAAGCTCAGGTAAATATATTTTGCTTAGAATTTTG
TGACTTGGGCTGACGTATAAGTAAAAGTTTTGAAAACATTGCTTAGAGCAATGTGCTGGG
AGGTTTTAGGACGGCTTTTGTTTGTGGTGGTTGCGGACATCTATAGTTTCGATCGTTCCG
TTTTTACTTTCATTCTAGAAGGTGTGTGCTGTGCTTGGGATCGATGCGGTGCCTTCTTTT
AAGTGGGTGTGTGGGAGCATGAGCCAGGCAGCGTTCTCTGGGACCCTTTAAACGCGGCTC
TCAGCAGTTGTCTCGCACCCCCCACCCCTACTCCTACCTCCTGCCCAGTGGTAACAACTG
TTAGTCAAGACTTCCCCTGAGAGGTCTGAGTCAATATTTACTGTGTCAGCTAAACTGCCT
CGCTAGATTTCTCAATTAATTAGTTTTCTGTTTTAGATGGCATAATGTTGAATGATTAAA
ATCACTCAGCGCCAGTGTCTTGCGTGGTATTGTAAAGAAGCCTCTGGTTTGGATTGCATG
GCAATTGAAAGCCAGACAGACTTCACTGAAGCTCCTCAATACTTACCGCGTGTGAGCGTT
TTGTTGTTGCTATTAAATGTTTGAAGATCAGCAAGCGTCCCTGTGAAATCTTTAAGGTAC
TTCCAGTGCTTTGTTGTTGTTAATGAAGGAGTAAAAAGTTTTGTGGAGGTTGGGTTTCTC
CACAGTGATTTGCCTACAAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTTTGTC
TACTCTCAAGGGTCAGTTTTAATATCTACATTTCCCAAATAGATTTCATTAAGCTAATGA
TACTTGGGGGGGAGGAAGAATATTTATTTTGAGTTATGGAATTAGTGACATGCCATTTGC
TTACCAATTGGATTTTTTTTGTTAAATATTACTCTAAAATTGTTTTTTTTTATCATTTTA
TTGGGGCTTCTACAACTCTTATCACAATCCATACATACATCAATTGTGTCAAGCACACTT
GTACATTTGTTGCCCTCATCGTTCTTTGCTTTCCGCTTGGGTTCTTGGAATCAGCTCATT
TTCCTTTTCCCCGCGCCCCCTCCCTAAAATTTTAACAGAAAGTCTAGATGCAATTCTTTT
ATCCCCGTCACTGAGGGGTAGAAAACTCCCTCTTCTCTTTATGCCACCTGTGTTTCATTC
TGTATACAAAGTATTTCTTGTTTTCAAGTTGGTCTCAGACTCTGAATAAAAATCTTTGGA
TCTTTTATATCTACTCATGCTTCCTGATAATTCACCTGATAAAATATTGATTAAAGCTTT
CCTAAAACCCCCAATAAAATGATCTTTTAAAAAAACCAAAACAGCTTTTCTAAAGAGGAA
AGGCTGGCAATCTTTAAAATGCCAGTAAGAGCTGTAGAGATTTCCTTGATAGAAATGTCC
TGTTTGATGTTAATGAAAATTTACTCAACACACGCAGTACATAGATTGCACATACTATTT
TGTGCTAAGATATATGTTAACTTGCATGTGCTATTGTAACTGAAGTTGAATGATTCCGTG
AGAACCATGCTTTGGAAAATGCCGCTTCCACCACATCTCTAGGAAGGAACTAAGTGGTGC
TAGACATGCTTCTACTGTGAGATGGTGTGAATACTATGGGGCAGTGTAGGAAAAAGCTAT
GAATTTGTCTTTCATGAGTTAAAAATCAGTAATTGTGTTCTCTCCAATGCAAATGAATTT
GGTCTCCTATAGGAATGCTAAAGAAAACAGTATCTCAATTGTATTTTGCTTGTATGTGCT
ACATTGTGTATAGCTGAATTAAATATCAAAAAAGGGGGGAAAAACCCACCCAGCCCCAAG
CCCTCTCCGCAAAAAAGGCATTTGCTGCATCAATTTCTAATCTTTTAGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAAGAATAGCACCTAGGATCTTAAAAACCT
GTCTTAATACAAGCATCCATCTACGTGAGGTATGAGCATATCAGCTTCGTTGATTCAGGA
ATTGTAAATAACAAAATCTACGATCAGAGGAGGGGAATCTAGTGGAGTTTAAATTCTTAA
CACTCAGATTGCAGAAGACTATGGATGACAGTAAAAGCCAAAATCTACGTGTAGAAACCC
CACAGGAAATAAGCTTCCATTGAATTCCCTCAGACCATTGAGCAGGGATTCAAAAAGCCC
TGCTCTTAGACAGTGCATCAGAAAGTGAATTAATGCAGGTATAGTTAGGTTAAAATTTAA
GATCTAATTTATTTTCCCTTTTAATCCATTCTTAATTTGTTCTATTTTAAAATTATTTTG
GCTTTCTTTTAGATTGAAATAAAGACCAATGTTATTAAGCAAATGATATAAAAATTGTTA
AGTGAGCATCTAATTTACTGTGTAAACTTTTACTGAAAACAATAAAATTTAGTTTTTGTT
TCTTTTTTTTCAAATACTTTTATTGGGGGCTCTTACATCTCTTATCACAATCAGTTTTAT
TTTTTTTAAAAAAGAACTTGACCCCAGGAGCTATCCAAATTTGACATACAAAATGACTGA
AGGGGACATTCAAATGGTCACCAAACACATGAAGAGATGCTCCATACCATTTACCGTCAG
CGAGATGCAAATCAAATCCCAGTGAAGACCACCTCACACCCACTGGAATGCCTAAGATGA
AAATAAATAAATAACAAAGGTTGGCAAGAATTTGGGGAACTAGAACCCTGATCTATTGCT
GGCAGGAATTCAAAATTGTACAGCTGTTGTGAAAATCAAGGTAGCAGTTTCTTTTTTTTT
TTTTTTGGGGGGGGCTCTTACAGCTCTTATAATAATCCATACATCAAATTGTATCAAGCA
CATTTGTACATATGTTGCCATCATCATTTCTTTTTTTTTTTTTTTGCATGTTTCCTTTTT
TTTTTTTTTGGGGGGGCTCTTACAGCTCTTATAATAATCCATACATCAAATTGTATCAAG
CACATTTGTACATATGTTGCCATCATCATTTCTTTTTTTTTTTTTGCATGTTTCCTTTTT
TTTTTTTTTTTTAAACATTTTATTAGGGGCTCATACAACTGTTATCCCAATCCATACACA
CATCAATTGTGTAAAGCGTATTTGTACATCATTTCTCAAAACATTTTCTCTCCATTTAAA
CCCCCGACATTAGGTCCTCATTTTCCCCCTCCCTCCCCGCTCCCCTCTCCCACATGAGCC
CTTGATAGTTTATAAATGGGTATTTTGTCATATCTTGCCCTGTCCGACTTCTCCCTTCAC
CCACTTTTCGGTTGTCTGTCCCCCAGGGAGGAGGTCACACACAGTTCCATGTAATCGGTT
CCCTCTTTCCTACCCATTCTCCCTTTACCCTCCCTGTTTTGCCACTCACACCACTGGTCC
TATAGGGCTCATCCATCCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGATGATGCCTTACACCTGATCCCCTTCGACACCTCGTGGTGCATAGGCTGGTGTGCTTT
TCCATGTGGGCCTTTGTTGCTTCTGAGCTTGATGGCCGCTTGATTACCTTCAAGCCTTTA
AGACCCCAGACGCTATACTTTTTGATAGCCGGGCACCATCAGCTTTCTTTGCCACATTTG
CTTATGCACCCATTTGTCTTCAGTGATCCGTTCGACACCCCGTGATCACACAGGTTGATA
TGTTGTTCCATGTGGGCTTTGTTGCTTCTGAGCTAGATGGCCGCTTGTTTACCTTCAAGC
TTTTAAGACCCCAGACGCTATATCTTTTGATAGCCGGGCACCATCAGCTTTCTTCACCAC
ATTTGCTTATTCACCCGCTTTGTCTTCAGTGGTTGTGTCGGGAAGGTGAGCATCATAGAA
TGCCAATTTAATAGAAGAAAGTATTCTTGTGTTGAGGGAGTACTTGAGTGGAGGCCCAAT
GTCCTTCTGCTACCTTAATACTAAACCTATAAATGTAGGCTCATAGATCTATTTCCCCAT
CCTCATATAATATATTTGTATATGTACATGTCTTTATCTAGAGCTCTATAAATGACGTAT
GGAACTGACACACAAAGGAATTCTACTTAGAAAGAGAACTAAAGTCTTGATGCCTTCTGT
CGTGCAAATGGAGCTTGAAGACATTATACTAAGTGGAATAAGTCAGTCACAAAAGGACAA
CTACTGTATGGCCTCATTTATATAAAAAGACTAGAACAGGAAAATATACAGAGACCAAGT
TTATTGGTCTTTTCCCAGGGGTAGAAGGTGGGGAAAATGGAAGGGTTATTGCTTATGGAA
AGTACAGTATATGAAGTAGTTTGGGTTTATAGTGATGGAAGGATTGCATCGATTAACGGA
ACGGTTTCATGGTGATTAATGTAGTAGCTGGTAATAAGTTGTACACGTATAAAACATTGA
ATCAGTGAAACTTAGGGAATAGACATATCTACAAAAGTAAAAAAGCTGAAGCTAAACAAG
CAACCATCTAGCTGAGAAGCAACAAAGCCCACATGGAAGTCGCACACCAGCCTGTCTGAC
CACAAGGTGCAGAAGGGACCAGTTATCAGATATCAAAGAACTTAAAATCAGATCAGTTGG
TGCCCACCTTCCTGATACGATCACTGAAGACAAACATGTGCATAAGCAAAGATGGTGAAG
AAAGCTGATGTGTCCGGCTATCAAAAGATATAGCGTCTGGAATCTTAAAGGCTTGAAGAT
AAACAAGCAGCCATCTAGCTCAGAAGCATCAAAGCCCACATGGAAGAAGCACAACAGCAT
GTGTGACCACGAGCTGTCGAAGGGATCAGGTATCAAGCATCAAAGAACCAAAAAACATAT
CATTGTAAAGGTGGGTGAGTGCAGAGTGGAGACTCAAAGCCCATCGATAGGCAAGTGAGC
ACCCCCTTACTGAAGGGTTGTGGGGAGGAGATGAGCCAATCAGGGTGCAGGGTAGCAACG
ATGAAACATATAACTTTTCTCTGTTCTTACATGCTTCCTCCCCACTCCCCCACCCCCGCC
ACTATCATGATCCCAATTCTACCTTGCAAGTCTGGCTAGACCAGAGGATGTACATTGGTA
CAGATAGCAACTGGAAACACAGGGAATCCAGGACAGATGACTCCTTCAGGACCAGTGGTG
AAAGGGGTGAGGTCTGGAGGGTGAAGGGAATGTGGGGTGGGAAGGGGGGACCGATTACAA
GAATCTAGGTATTGCCTCCTCCCTGGGGGAGGGACAGCAGAGAAGAAGGTGGGGGGAGAC
GTCGGACAGTGTAACTTATGACAAAACTATAATAAGTTGTGAATTATGAAGGGTTCATGA
GGGAGGGGGTAGGGAGGGAGGGGGAAAATGAGCAACTGATATTAAGGGCTCAGGTGGAGG
GCGAATGTTTTGAGAATGATGGGGGCAGCAAATGTACATATGTGCTTGATTGAATCCTGG
TCGAGTCCGATAGCTTTAGCTTCCAGGCAGGCAGAGGTGCTCGTTCTTAGTCATACTGCA
GCAAAGAACGGGACGGAGCACTTTGTTTGGTTGACTCTAAATCATTCCCAGTGCTGCCCT
CCGGGAGCCCCCCCACCCGTGAGCACTTCAAGAGACGGTGAATGGAGCCTCACTTTTGGC
CTCCCCCAACACATGTGTCCTTAGCTCAGCTGAGCACAGCTGTCCCTTATACTGAATGTC
CAGAAGTTGTACGGGGACCTTTCATAACTCGTGAGGGATGGAAACAGGTCAAGTGCCTCA
TTTACACACTAAGGAGCGCAGGAGGTGCTGCGAAGGCCGACCGGCACCCTGGGGGTGCGG
TGCGCAGTGCTGCCCCGCTCTGTGTCCTCCTTGGACACGGCACACCTGCCTTCTCCACAG
GTGACTTCCATGCTGGGCCCTTTGGTGTCCCGCCAAGAAGAAGACCACAGGCCCGCTGAT
GGACCTCGGAATGGCTGTGCTGCCTCTCTGGCCCACACGTTGTCTGCAGAAGCCTCTGCT
CTTGGACCTGACCGTTTTCGGATGGAACTTGGGGTCCCGTGAGCTGGATTCCCACTATCA
TGTTGTCTGGGTTCTCTGCTCCAAGCCCTGACAGGATCAAGCCTGTGGCCAATGACCAGA
CGTGTGAAATCCGTGGCATGATCTCTTCCTCACATGCCAGCAGCTGCTGGTTTGTTTTCA
AATGATAGAGGTGAAGTCGTCCTTTAGGATCATGGAGAGTTCTCCGTAATTAAATTGGGT
TTTATTTCCCCAGTGGCTCACCCATTTCAAGCAACAGATTCTACCACACAAAACAGTTTC
TCCCAAGCCCATAAAATTCCTGACCACGGACATCTAGTTTATGCGGAATGCATTCCTTTG
GAAGCTTCTGTTACCTCTGGGCAGCCACAGGACAACGATCATAACATAGGAATAAAATGT
ACCCTGAGGCACGTTCCGGTCTTGGAACTCGCCAGCTGAGGTAGATGAGCCGGGTGAGGT
GTGTTCCAAGTTGTTGTTACATGTGTGGTTGAGTCAGTTCCGAGTGGGCGGGACTACGTG
CGACAGAACAAATCCATTGCCCGGTCCCGTGTCATCTTCACAGTAGGGCCCATGGGTGCG
CCCATCACTGCGGCCACTGTGTGACTCATTTCTCTCTATTGTGAGCCCTCGCCCGAGTGT
GGTATTCTTCTCCAGGGACTGCCTGCTGAGAACATGTCCAAAGTGTGTGAGACAGAGGCT
AGCCATCCTCACTTCTGGTTTTTTTAAGTCATTTTACTGGGGGCTCATACAACTCCTCTC
ACCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCACTGTGTCA
AGCACATTTGTACATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GCATTTGGAACGGTGCTTTCAGAAAGGTCTGCGTGTCTGATGGCAGTCCATGACACTGTA
ACAATGCCCCGCCAACCCCATCATTCACCTGCATCTGCCCTTCTCTGGTCTTCCTTGTTC
ACTGCCCAGCTCTCACAGGTGCATGATAGGATGCTTCTAAATCTTATAGTTGACAAGCTA
TATTAGAATCCCAATTAGCCAGAATATAGAATTCATCCAAGTAGCTAGTTCTCCAACAAC
AGGATGGCTAAAGGGCTGCACTACCCTTTACCTGGTATGGAAACGGGGCTTCTTGCCCTT
TTTAACCCTAACATTTACTGTTCTTGAACATGAGCGTGGGGAATTCTGCATCCCACAGGC
CAGGAAAGCCCACGCGCATCTCTGTGAAAGAGTGCCCTCTGCTTGACTGGCCAGAGTCCT
TGTTGCATTGATAGTTAAAATAACCAGCAATTGAAGTGAGCACAGGCCTCCTGCCTGGCC
CCTCGGTCTGGTTTTGAAGGTGGGACACATCTGTGAACTACTGGCGCAGACTGGGGCAGT
TTGAAATGGCAGCGGCATTTTCAGCTTGGTGGTGAAGGGGCAGCACGGAGCGGGGCTGTG
ACAGGATTGGACATGGCAAGGGAGTCCTTGAAGGAAGGCTTCCAGGGAAGGCAGGCGGAA
TGACCAGTCGTGGAGGTAGTCGGTGGTACTGAGTGTGAACTGGTTGGGAGAGGAGAGGCG
GAGGCAGCAGAGGGCGACTTGTGGGCCACTTTTGTGCCACCCAGGGCCAGAAAGACGATT
TCAATTTCTTTAGAGACTCTTTTTTTTTCTTTTTCAATAAAGAATAAAAATAAAAACTCA
CTGTCGTGCAGTAGATTCCTACAGGGCAGGGAGAGCTGCCCCTGTGGGCTTCCGATACGC
TCTTGATGGGAACAGAAAGCCTCGCCTCCCCCCTGAGGATCAACTGGCGGTGTCGAACCG
CTGACCTTGTGGTCAAGCCAACACGTACCCACGCCGCCACCAGGGCTCCTTCTCGGATAA
AGCAGCTATCAGATTATTATTAATATTGCTGTCATGAAGAACTTTTTTCCCTTGCAGTTC
ATTGCTTTCCTAATGTATTGTGGAAGGTTGGATTTAAATAAATATATGTGCCACACCTTG
ATGGATTTCAATGAAAGAGCCTTTTTTTTTTTTTTTAAGTCTGAACCAAACACTGGGTTT
CTTTTCTAAATTTCCCTGGTGGTGCCCTGGGGTTTGAACCCACGCGCCACTCTGAAGCAG
AAAGCTGAGGCTGTCTGTCCCCACACAGCCTGGGATCCACTCCAGGGCAGGGGTTCTATA
AGGAAATTGAACAGACAGATGTGCATTTAAGCTGGGTGTTGAGCTCTCAGAGTGTGCCCC
GTCCTTTTCCTCAGGGCCGTGAAAAGCCTTGACGTGCGAGGCTCAAGGGTTCACGGTGGA
CGCCTTGGTGAAGACGCAGAGAAAGGGAGCGCCGAGTGTGATAGTCAGCCTGTTGGCACT
GTCTGCTAAAGCTGTGTCCAAGAGAAAAGCTAACCGTCCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGTGTTTCAAA
AGTAGAATTTTCCCCGAGCTGCCCAAGTCTCCTCATATTTACCTCTCTGTTATGCAGAAA
TAGAACCCTGATTGGTGCGGCAGGTTAAGCATGAGACTGTTAACGCCAAAGCCCAAAGTT
CAAGGCCGCCAGCAGCTCTTCAGAAGGATGAGGCTGTTTGCTTCATCCCATAAAGGCTTA
CTTTTCTAAACACTTTCTGTTGGTGCGGGTGAGGGCTTACCGATCAAAGCAGTTTCCCAT
TCAACACACTTTCTTTTATGGCTTTGATCGCCACCTCAGGAGTGTGCCAGCATTCCCCCT
CACCCTCCTACAGATGGGAAACCTCAGGAGCAGTCCTGTGTCCCATGGGGTCCGTGTGAG
TTGGAATCCGCTCAACAGCAGTGGTCTGGTTTGGGCTTATTTATTGTGCCGAGTGTACAC
TTCGGTCTCGCGCAGCAAAGCACCAACCAAACTGCAAAACAATACCTGCCTGGTTTGTGG
CGTTTACATCTCATGGTTTGGTTACCCTTCCAAATGAGGATTTTATTTGGGGCGGGGGGA
TAGGGAGGAAGACTAATGAAAATAGAAAGTTCTTTGTTGAGTTTGTGTGAGTTTTTACTT
TCAATTAAGTTACTTTCAGTGACTATTAAGGTATCTTTTGAGATTTCTCATAAGAGTGCG
ACACTGATAAAAGGCAGACTGTAGAGAGTGGCCTTGGCGTCTTATTTAAACACACAGGGC
TCTGCTTTGTTCGTGAGGCCAGCACAAGTTTAAGATAGCCGTACAAGGAAACAGGTGGCT
TTGTCTAGCCTCTCCACTACTAAAAAAGTAGGTATTTATTATGCCAGCAACACTCCGTGG
CAGATGATCAAACCGTCTCAAATTTGCGCTCACTACAGCAAGAAACTCTAACCTATTCCG
GTGTTCTCTCCTTAGTGAGACTAACCATTATATAGACTTAAACAAGCAAAAAATGTGTGT
ACATGTGTGTGTGTACGTGTGTGTATAAAATGGAAAACTTAAACATTCCCATTGCTTTGT
AAAATAAAAAGATCCTTGTAGGGGAAATGAAAGAAGAGTTGCTAAATCTTCCAAGAAGTG
AGCCTGGTACTTTATTCTGCTCAGCATCTCAAGAGCAGCAGGTGATTCCAGCCGTCAGGG
CCGACAGTAGATTTACCAGCGTTACCAAGGCTGTGGGGTTCTGTGGCCCAGACAGCAGGG
GCAGGCTAACTAGCCCCTCAGAGTATCAAAACCAGACAAGGCATCGCCTTAGTGAACAAA
TCTCTGTAGAAGCCACTCAGCACATGAACATCCCCTAGTTTTATTCAGCTCAATTCTTAT
AGAAAAGCCTTTAAATATCAATTTGATGGCATCACCTCCATAAGCACTTGGTTTTAAGGT
GCTCTGGCAGCGCAGGGGTTAAGCATTGGGCTGCTGGTTAAGCTCCACAGCTGCTCTGCA
GGGAAGGAGAAGCGGTCAGCCCTGTAGAAATGACAGCCTCAGAAGCCAGGAGCAGCGCCA
CTGTGTCCCGCAGGGTCCCTCTGAATGGGAACGGACCAGTGGCAGAGGATTGGGCCTTGG
GTTCATCTGCTGTGATTCCTGGCCAGTCTTTGTGAGTGTCTAGTCCCCCTGACACGAAGC
TTTCTTTTTCCTGGTTTCAGGTGTTGGATGGGCTTTTGGCTCAGTATGGGACTGTGGAGA
ATGTGGAACAAGGTAATACGTCCGTCTATTCCATTTTGAAACGGATATTACTTATCGTTC
CTTATAGCTCGGGCCAACTCCCGGGAAAAGCTGCTCAGAGTGTATGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTGA
CTCTGAAGTCCTTGGGAAAGTCCCCCTAACCTCTCGGACTCGGTTTCAACCTGTGCAGAA
ATGCTCCTCTTCTGAGCATTGCAGAGTCCTCGCGCCCAGAGAGCGCATCCGGTCAGTTGA
CCCTCGGCAGGGATCCATCATCCGTGAGGGAATTTGGAATGTTCACTTGAGAAAAAACCA
GCGAGCCCATTTCCCCATATCTGCAATCTGCTGGATCTCCATTCGAATGAACAGAATCAT
TTTAAAGTAATTATTCAGACATTCTTCACTCTGTGAATATTAAAAAACAGCTTCCCATAT
CACGCTGCTGCTGCCTGCCTAAGCCCAAAGGCGAAGAGAAAGAAGAGTTCAAAAAGAAGG
CATGATTTTCAAGGACTGCATTTCTTGGTTCTCCTTATTTCCCTTCAGCGTGGAAAAGAA
GACATTCTAGGAAAGGCCGAGTATTGTAGGCAGGACGACTTGACAGACAGGAACGGGTAC
AAAGCCCGAGCTAGGACCGTGTTATCAATTCAGGACGGTTCTGCGGGAGAAGAGGCATCC
CAGGTCCCGGGGGCAGTTCACAGCTCTGAGGGCACCTGTACCCTGAAGGAGCCCCAGCCC
TCACTGCCTCCCAACTGCAGGATCGAGTGTGGTACTGGATTTTGTTCTGTTTTATGGGTG
ATGCCTCATTCCTCAGGAAAGCACTTTTAGAAATCTCTATAGAACTTTCATGCCCCGTGA
AATCTATTATTTGGGTGGAGCTCAGCTCATCCCAGAAGACCAGAGAATATATCTTAGTGA
GAACCTAATCTGACAATCCTACTGGAGAGCTTGAGTCAGGAATTTCAAACCCAGCCCCTT
CTGGGCATCTCCAGCTTCATCTGTCACAGTTGAGCGCAGCAGATTGGAACCTCAGTAGCT
TCCTGTGTGCCAGCACTTGGAGGGGTTGTGGGCTACAGATTCCCATTTGCACTGAGGGCT
TCACGGGGGTGGGTGTGAGTTAGTTTTCTGCACCCTCATGGGCCAGGTCCAGAGCTGGTC
TCAGCCGCTGATCTCCAGAGCAATTCCCCAAGACTGGAGCCACTTTGAAATCATTGGACA
CACACTAGTTTAACCATGCCTTTTTTTTTTCTTTTAAAAAATTATTTTATTTGGGGCTCG
TACAACTTACCACAGTCCATATATACATCCATTGTGCCAAGCACATTTGGACATTTGTTG
CCCTCATCATTCTCAAAACATTTGCTTTCTACTTGAGATCTTGGTATCAGCTCCTCATTT
TTCCCCTCCCTCTCCGCCCCCTCTCTCATGAACCCTTGATAATTTATAAATTATTATTAT
TTTGTCATGTCTTACACTGTCCAACGTCTCCCTTCACACACTTTTCTGTTGCCCGGCCCC
CAGGGAGGGGATAACCATGCTTTTTAACTCTTTGGAGGATCTGCAGATCTCTCACAGAAT
CTTCTGGGAATTCTAAGCCTTCTTCTCAGAGGAAGTGACATTATATCTGAATCGGAACCC
TTTGGGAGAGTCCATAGAACTCCTGAAGCTCAAACATGAATCTTCACACTGGAGGGACTT
TACCTTCCCACTGAAAAGCAGTGTTCGCATGGTTTTCTTGTCCTAGTTCTATAGTTACCT
CCAAGAAGCCCAGAGCTTGCCTGATCCAACAAGGGGTTTAGATTTTAACACTTTGGTTTG
TTTTGGGAAAACAGATGCTTTTGGGTTTAAGTTTCCGCACTTGGACCGGGAACATTTTCA
CCACGTCCTTTGAGGTTACAGTTGCTTTTTTTTTTCTTTCTGCATTTTATTATGTGACGT
TACTCTTACTTTTAACTCCAGACCTGGGAAGGAAAGGCAAGCAATTGTGAACCAAGGTGA
GCCCGCTCACAGGCACAGGCCCGCGTTAGCCAATCGTAGAGTCTGTGCGCTCTGTCCTTC
AGCCAAGTAGGCTGCAATTGGCAGGTTTTTATCAAACCCACATAATCAGGGAGTTCAAGG
TAAGCAAAAATAGTAACAATTCGACCTCCCCCCCAAATGAGGAAGTCCTATTAGGGTACA
CCTTTTTTATTGCTTTATACATTATATGTACCTGACGCAACCACCTATNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTAAGTGGGCGTGGGTTGTCTCCTTCCATAAGCCCAGGTTGGCCT
TGTCTTTGAAGCCCAGTGACCCTTGTGTTGAGCAGCCTTTCCTGTAAGGATGCTGCTCTT
TGGCAGATCCGTGGAGCCCCACGGCTGTGTGCTGTAGGTTACACCTGGGGTGCAGCAGTT
GACAGGCTAGCTGGAGCATGGATATTGGAGTCCACGCGAGTCATCTCGGAAGAAAGGCCT
GGCGATCTGCTTCTAAATACCAGCCCCTGGAAAGCCTTGGGCAGCACAGTTACTCTGACA
CCCTTGGGGCTGCCATGAGTCAGAATGGGCCCCTCAGCAAGTAGTTGACTGGTTGTATCG
TGGGAAATAATGAGCCCAGGCGTCAAACCTCAGGTAGGAGCTGGGCCTTGACATGTGAAC
ACCTGTCCCCTAGGCTCAACTTCAACAGCCACTTGGACCACTGTCACTTGGAGTTTCGTC
AGCAGCATAGGTGCAGGGAGGAGAGTCTGGGCTGGCTGGTCAAAGAGCACTGGATTCTCT
CTACCTCCTTTCCTTCCCCAGTCCCCCCGGCCCCATTGCTCTAAGCCTTGAGCTTGGATC
TTAGCAGACTAGGCACAAAGTGTGGCTCTGCTCTTTGGGGTCTCCCCTACGTTCCTTTGG
TTAAAAATCCAAGCTGCTTTTTGTAGAAGGTCCCGGAAGAAACTGTCTGGTCATTGTCAC
TAGACTCTTGGTTGAACGTGGTCATAATGTGCCTTGAGCTTGGCTCTCAGCCCAGCGTTA
GCGTTCTGTGTCTTTCTCAAGCTTCCAGTGCATACGATGACACACATAACCCCGTCTTAG
ACCTCTAGTTTTCAAAAAGCTTATGGTGCAGGAGGTAAGCAGACAACTCGGCTGTCAGGC
CCTCATCGCAGGAGGTGGCCCTCTTGCCTTGATCAGTTTCAAAAGACTGCTCTGCAGTGA
ACCCACAAACCCTAAATATTCCCCCAGAAGGACTGTGTTCATGCTGCCCAGAAACCAGTT
GGGGGAAACTCCCCAATTCACACAGAATTTTAAAATATAGTAGTAGGATATGGTCTGTCC
CGTCAAGTTGATAAAGACATTACAGTCATGTGCTGTCACCTGAGCATTCAAGGAAGTACA
TGCTTCCCTGGACTGCTCCGGGACTGCTGTGGTGAGAGCCTTCCAGAGGGCCCACTGCTC
CCCCAAAGCCCCGTGGAAGCGAGCTGGTTTGCAAAGACGCCGTGACACCTGGGTGGGGGA
AAGGACATCATGTAGATCAGTTACAGAAGTTAGGACACACCTGATAGGATATTGTTGCTG
GACCGCGTAGGCAAATCCCACGCAGCGCCCCCTGTGTGTGACAGAAGGAAGCACAGCCCG
CTCCTGCTTTGGTTCTTATTCCAGGGTCAGTCTGCCTGTCCTTGCTGAGGGCCTGCCTCT
GTTTCTCTGCCCCTCTCCTTGACCAAGCGTGGTAACCTTCTCCAGGCCCTGGTCGGCTGC
TAATGTACCCAGAGCACGTGTGGCAGTCTCACCACCCTTGCCTCTGTGTGTGGATGGATT
GTGATGAGTTGTATGAGCCCTCAATAAAATGATTTTTTTAAATACTTCTTTTTAAAAAAA
ATAAATCATTTTATTGCGGTCTCTTACAGCTCTTATAATAATCCATACATCAATTGTATC
AAACACATGTGTGCATATGTTGCCATCTTCATTTTCAAAACATTTTCTTTCTATTTGAGC
CCTTGATATTAGTTCTTCTCCCCCCCTTCCACCTCCCACCCTCGTGATCCCTTGATATAT
ATATATTTTCATATCTTTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCTGTACT
TGGCTGCCCAGGCCTGTGGTCATGACCGAGGCAGCTCTGCGGAGCACAGCTGGTACCTTG
TCTCGCTCAGCACCGCCACTCTACGGAGTGCCTGGCAGGACATCAGGCACTGCGTGCTTA
AAGCAGAGCGCATGGCCTGCTCAGTCGATAGAGAAGTCGCTTCTAAAGGCACTCTCCGGC
CTGCTGCTGCCTTTCAGAGCCATCGAGAAGCTGAGCGGGCATCAGTTTGAGAACTACTCC
TTCAAGATTTCCTACATCCCAGATGAAGAGTTGAGCTCCCCTTCGCCCCCTCAGCGAGCC
CAGCGTGGGGACCACTCTTCCAGGGAGCAAGGGCCATGCCCCTGGGGGCTCTCCTCAGGG
CCAGACAGATTGATTTCCCGCTGCGGATCCTGGTCCCCACCCAGTTTGTTGGCGCCATCA
TCGGAAAGGAGGGCTGGACCATAAAGAACATCACTAAGCAGACCCAGTCTCGGTATGTAC
GTGCCTCTGGGGCTTCCTTTGCTTGCTCTCAGGGGTCTCTCTTGTGCTGGTGGGCCTCGG
CCAACGGCAGAAGCTCTCGTTGGGCGTCAGCAGACGGGCCGGGCTGTGTGGGGCAGTGGT
TTCCTCAAACAGGACAAACAGACTGACACGAGGCTGGGGCATTGATGAGCTTTCGTGGCG
ATGGCCCAATGGTCACCATTGAAAGTTTCATAAAATGCTAATCTAATCTAAAGTGCCACA
GAGCACTCACGGTCTCATAACCAAGGCTTGTTCCTATAAGCTAACCGATGCTTGTGCGTG
CCTCCCAGGCTGGTTGTGAAACAGCTAGCCACCCGCTTACCAGAGTTCCTACCTCTTCAA
AGCTCACGGTGATAGTCATTCCTTGAGGACCATCAAGGGAGCCTCCCACATCCCCACAGA
AAAGCGGACAAGTCACCGTCCTCCTGAGCAAGCAGTAAGGCGCACTAACTGACCTCAGCT
CGTTTAAAGAGCCTGAAGGTGTGGTGGGGAAGTGGCTTGTGGGACAGTGCACCTGTGCGT
TCATGAGCCCAGAGCAAGGAAGACGAATGGTGAAGCTTGACTCACGATTTGAAAAGAAAG
TCCTGAGTTTAAGTTCTCTTAATGGCGAAATGAACTAGGAGGGGAACTAGCCTCTGAGCA
TCCGAGACTGCTGTAAAGGAGGGCTTACGAACTGTTTTGCCAAGATGACCCAAGAAGTAA
CTCAATTGGGCAGATTGCTTAAAGCGAGGAATATGAAAGCACTTAGTTGCAAAGCACAAG
ACCTGTCAATTACTAGTTACGTACACACACCAAGTGTACTTCACCCTGGCGCTCTGTGAG
TGCAAGGACCTGGTTGGCAGGGCAAGCATGTGGTGACAAAGCATGGGGACAGATGCTATA
GCTGACCCTTCCAAAGCTCGTTTAAGGTGGCTCAGAAATAGAGAAGCGTGAGAGCAAATG
TTGTGAGAACAATGATGGCAGCGAATGTACAAATGTGCTTGACACAATGGATGGATGGAT
GGATTGTGGTAAGAGTTGTATGAGCCCCCAATAAAGCTTAATTTTGAGGTTGGTCTGCAA
GGTGTACGCGGATCCGTTTAGAATCAGGCCCAAGATGTGGCTCTGGTCTTGAAAACTGCC
ACAGTGAAAAAGAGCATGAACAAACACAAGGAGGACCGTCCACCTGAAGGCACCCGAGAA
AGCCATCCCTCTTTGGAGCCGTTCAGGGAAGAGCCCGGAGTGAGAGGAAACCTAGAGAGG
CAAAGGGGGCGAGCCTCTGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTTTCTTCTATGAATGTTTCCTGG
GCTTCCACAGCCTAACGAGTACTAGGCACATTTCCAGGGTAAATACACCTCTTACTAAAC
CAGTCGACTCTGTGTTGTAAACAAAGGGATGGCCAGACAGGAGGGAGACTTGCTGCCAGT
TGGGCACGGTCGATCTGTGGTCCGTGGTGGCTGTTTTCTAGAGAAGCAGCAAGGGGTGAC
GGTGAACAGAAGAATAAGTAAGGGTGTTCCAAAGCCAGGAAGATGAAGTAGTCGTTCAAG
GAAAACAATACAAATCCAACTGCTCACTCAGGAATGATTTCCGCTACTTGGGCTTTAGGA
ACCCCTGGCCCCACCTCGTGCCATGGCTGAATTCGAGGAAGCCCTTCTCATTGAGCTCCC
AGGGGGTTTTATATATAACACCAGCCTCGGTCCTTCTGCTTAGGTGGAAACCACTTCCAG
ACCAAACTCCCTGCTGCCGAGTCAATGCCCACTCTGTAGGACAGAGTGGATCAGCCCCTA
TAGGACAGGGTGGATCAGCCCCTATAGGACAGAGTGGATCAGCCCTATAGGACAGGGTGG
ATCAGCCCCTATAGGACAGGGTGGATCAGCCCCTATAGGACAGGGTGGATCAGCCCCTGT
AGGACAGGGTAGATCAGCCCTATAGGACAGGGTAGATCAGCCCCTATAGGACAGGGTGGA
TCAGCCCCTATAGGACAGGGTGGATCAGCCCCTATAGGACAGGGTGGATCAGCCCCTGCG
GGTTTCTGAGACGGTCACTCTTTATGGGAGCAGAGAGCCCCGTCTTTTGTAGAGCAGCTG
GTGGGTTCAAACTGCTGACCTTGTGGTTAGCAGCCTGAAATGCCCCCTCCATGCCAACAG
AGCTCCTTATAACATCTTACAATGTTCTAAGTAATCAAAAAGACTGATTTATTATGAGAT
GGGTTTTTACATACTCACATAGGACCGATAGGAAGTTTATAGCTTTGAAATAGTAATTCT
TTCCTGGGTGTTGACCCTACTAGGCCCTGTGTTGAGGACCGAGGACACCCGTGCATAAGA
CCTGGCCCATGCCTTCATGCTGGATGCAGTGGGAGCGAATGTTCCCGCAACACGCACGCT
GCATGCCGACCAGAAGTGCTGTGGCGAAAGCGGGCGGTTCCCGATGGCTGCGTGTCCCTG
AGGCTCCCTGCTAAGGTTCCTCGGGCAGACAGGAGGCGACTTTGGACATTTCAGAACTGA
CCTTTCTATATAGACGACATTTAAGACCCTGGGGGTGCGGGGTAGGAGATAGAAGCCATA
GAGGAAGAAAGGAAGAGAGGCCTACACTGTGTTTTAGTTTACTTACTGGACATTTATGTG
CCGGGAACTCAGCTGTGGGCAGACAGAACCCCCTGGCTGGCGGGGTCTCCTCAAGCCGCC
TGTGCATGTTGAGGCAGCTGCTCAGTGTCTGTTACATGCTTTGGGCCTCAAGCCCCAGAC
GCCACAGCAGTGACTTAAGCTGTAAGAAGCCAGTGGCATGCCAGCCAACAAGGCCTCAGA
TTGAGTGGCTGCCCGGCTGGGGGCATCCTGGCCCCAGGATTTCCTATTGCTTTACCGTCC
TCGGCACACGCGACGCTCCCCTGGTGGTGACAGGAGGCCTGCCGCAATCCCAGACCCCGT
GCCCTAACACAGTATTCTCACGTGGAGAGAGAGCTCATCACCGTGCTCCACCTCCTTTTT
AAAGAAAAAGAACAAAGTCTTGTTTGGAAGTCGCCCAGTAGACTTCTCGTGCCTCCTCGG
CCAGCGTGGTTTCCTGGACTCCCTTTCTGTTAGCCACTGGTCTATGATTTGAGCTTCCAA
AGGGAACAGACTGTAGGGGCGAGGGAGGGAAGATGAAGGAATAGGCTAGAGGGTGGACAG
CTATTATTAACTTGGGTGAAGGGCTAACTAGTAATTCACCACAGGGAGAAGAGAACTCAG
AGTAGGCGGGGAGAAGGGTGAGTTATTGGGGTGCAATGGCGGTGGGTGAGGGGTAGTTGA
TAACGAGCTTCAACTGATGAATACGAAATAGGTGATCTGAAATGTGAAACCCTCCCCTCG
TTCGCAGTGGAAACGTGGTGACAGTGCTGGGAAATGCACGCGCATGACGTGTTCAATCGT
CGTCTGTCTGTCTGTTTTTCAGAGCGGAAGAGATCCCTCTGAAGATCTTGGCCCACAATG
GCTTGGTGGGAAGACTTATCGGAAAGGAAGGCAGAAACCTGAAGAAAATCGAACACGAGA
CAGGAACCAAGATAACCATCTCATCGTAAGCCGTGCATTTGTACGAATTGTGCCAGATAC
TGGTATCTGACTCTAGCCAGCTCCTCGGGCTGCTCTTCCCTGCACCGGGAGCGCACCGTG
GGCGCTGTGCTTACCTCCACCGCGTCGGTAGTTCCCAGTCAGACCCTTTGCACCGTATGC
GATTCCAGATAGAAACACAGGTTTGCTACACCGCGGAGTGTACCCAGAGCATCCGGGCCC
CTCCCCACCTCCTCCTCCTCCTCCTCATTCAGGAATTTAATTTTCCTTTTGATAAAGAAG
TCGTTTCCTCTCTCCTGTTGGCCAGCTTGCAGGACCTGAGCATCTACAACCCGGAGAGAA
CCATCACTGTGAAGGGGACGGTGGACGCCTGTGCCAGTGCCGAGGTAGAGATCATGAAGA
AGCTGCGCGAGGCCTTCGAAAACGATATGCTGACCGTGAACGTGAGTGCCCGGCGCCTGC
CTCTCCTCCAGGGGGGTCTCCACACGTGCTCCCCTGCAGGACCCCTGCTCTCTGGGAATA
ACTGCCGCTCAGCCAGGGAGGAAGCTCCTGGGAGCAGAGGCACAGAGCTCCCTGGCCTTG
TGCAACTCAGGGCACGCACAGGGAGGAAGCCAGCTGGTCCGTCGGACGGAACTGTTGTAC
CCAGCTGCAGGAAGTGACAGCAACGAAGGTCTGCAAAACACAGAGGCGCCGATGCTGGGG
CGTTAAGTGAAAGTATCTGTAACAGGGATCAGAAAAGAAGGACACGACAGGAAGGCTGCC
CCTAAAGACAGCAGCGGGCTCTCGCTCTACCTTCCACACTTTCTAGAAAGCTGTGATTCG
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGACCTTTCAA
ACGTCTGAGTACGTATTTTTTCCAAATCACTCTGATGGTCCTCTCTGCTTGCTGATGTGC
ACCTTCAGACAGCGCCAAAATTGTTCCCCGTCACTGGAGCCCACCCCCCACCCCCCACTT
CTTGCAGCTCACTGGGGTGTACAGGCTTTGCTGTTGGCTCTGCTCTGTGATGGGGAGAAC
GTCAGAATGTCTTTAAATCGGTCCATCAGCAAAGCCCAAGTTCAGCTCGGAAGAGTAACA
TTTTTTACATTCTTAAGATGATTTTCAAGGTAGACACAGACAAGGAAAGGCTACTGCAGT
AAGTCCTCCTGTTCCGTTTCAACAGTTTCCACCATGACCAGCCCTCAGCCAAAGCCCCAC
TCCCCTTGGATGACCTTGATGCGAATCCCAGGCCTGGTAACATTGCTTAGATGTTGACCA
AGGAATAAAAGGTGGCCCAGCTGGCCCCTGGCTCCTTCCCTGCAGCACCGTCCCCCGCAC
CCTCCTGCTCATGTCACTGCTTCTTCCACGCTCACCTGGCCCTCCTCACCCAGTCCCCAC
CCCAGAGCCCACCTTGGCGGGTGCTGGGGGTGCTGGCAGAGGGGGCTGCAGTGGGACCTT
CCCTCCACATGTACAGGTTCTCGACAGGCAGCCCGCGACGGCAGGTGTCAGTGAACATGT
AATTCGGTGACCCCACGCCCCTCTTTGGGCTCTCGGCCTCTTGATAACGATCCCTTTCTG
TGAAGGACGTTACAGAGGGGCTGTGTGTGCTGACCACTCACTCAGAGTTGTTCACGTCTG
CACCCAAGTCATGCATTGGTAGGTGACTAACAAAACGGCTGCACGCCTGCAGCTCTCCGA
CGCGGTGCAGCTGGGAGATCTTAGCTCTGCGTTCCCAGGTGTTCTAGAAGAATGCTGGTT
CTTGCGTGACCCTCGTGACAGGTTTTTTTAAAAGAAAAGAAACTCTGAGGAGAGCTGCTG
AGTGTCCAGGAAGACAAAGGTGGGGGCAGGTTGTACCCAGGCTGGGGGAGGGTGGCCGCA
TCGCTCCGCCTTGCAGGGCTGTGTAAGTGAGGCTCCCACACGCCAGCATGCTGACATGTG
AACTAAGCCAATAAGTGATAGGATCGTGGAGCCATCCACAGGCTGGGGACAGATGGCATT
GACATGTGTGGTGTTGGAGAGAAACATCTGTGCTTTTCCTGGGTAGGAAAAACTCAGTGG
TTAGACCAAGTGCTTTGAAGTGTACTTGTAACCGATTCCTCTGTGCCAGGCACTGAGAAC
ACCATGCAAAGTAAGGCAACCTCTGCCCCCGAGGAGATTGGATCCTAAAAGGGAGAGAAA
AGATGAACCAGGCATGGCAAAGGCATACGGCAGGCATTGCTTTAGGAAAACACAGGAATG
TTAGAGAGCAAGGGAGGGCACATAGGGGTGCGAGAAGGCCACTGGGAGAGGTGACATCTG
GACTCAGGTGGAGCCCACAGAGTCGGCAGGACCTCGCCTGGTGAATAGGGACAGACCTGC
CCTTCTTGCAGGACAGACAAGTGTGGGTAGAGTCTCACAGGTGGGGAGAGCATTGGGGCT
GTTTAGAGACCAGGTGTTAGCTGGGTGAAGGGGCGTGCACAAGAAAGGTTCTGATGATGT
GGCCTGGACCCCTTAGGAAGAGCCTGGTTTACCAGGTTGTGCAGACTTTCCCAAGGGTGA
GAGAACCCCAACATCAGGCCGAGGTTTGGGGAACCTCCCTGCACCTAGACACAGGGCTAG
GGGAAGACGGACCAGGGGACAAAGATGCTGCCCTGCCAAGATGGATGGTGGAGCCTGACA
ATTGAAGACACAGGGCTAGGGGAAGACGGACCAGGGGACAAAGGTGCTGCCCTGCCACGC
TGGATGGTGGAGCCTGACAATTGAAGCTCTCTGGTCTCCATCCCTCATCTTGCTCTGTTT
CTCTTCCCAGCAGCAAACCAGTCTGATCCCAGGCTTGAACCTCAGTGCACTCGGCATCTT
TTCAACAGGGCTGTCTGTCCTGCCTCCACCAGCAGGGCCCCGCGGAGCTCCCCCCTACCA
CCCTTTCGCTGTAAGTAGCTCAGCACGCAGAGCCACCGCCTCGCACTCGGGCGCCTGCCT
CTGGGAGCAGCATCTCTGCTCTGCTGAATTAGAGCCAAGGCCTGGCTTCTTGGGAAGCTC
GAGGACAGCTACCCGAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGGAAGAGAAGAGGCGCTGCGGGCAGGGCCTCTCTAACCCACAATGCA
TGAGGTATATGGAACCGTCCGGAAGGGACCGCCAGCAGCTAGAGGGACAGGCAGGGCGCT
CTCACAGCAACTGCTGATGAAGGATCTCCCACACCATCTTCTTCCGGAAGAGAGGCATCT
GGTGCTGCAAAGAGTCCCACAAACAACAGGCATCACATGGGCACAGGCATGGGCACAGCA
TCCCATGTGGCTTTTCTGGTCATATCCTTTCTGAAAGCCTCTACTTTTAATTTTAATTAT
TCATTAAAATATTTTTATTGTGTGTTGGCTGAAAAGTTGACACAGCAAATTAGGGCTCCA
TCTGATAAATCCCCGTCACATGGTATGTCACTGACACTGGTAACATTTGGCTCATTATCC
CTCTGGTTGTTCCGTTTCTGCTCGTCTAGTTTCCCTGCCCTCAAACCTTGATTTCTGTCA
CATCTTGGTACACACTTAGTAAGCCAGGAAAAAAGGCTCATAGGATGTTTAATTATATGT
CAAAAGTATGTTTATATATTAAGAAAAATAAATGCAGAATTAACAATAAATAGCACAATG
GTGATTTCATAATATGAATGTACTGTATATACTTGAATATAAGCCGACCCAAATATCAGC
CGAGGCACCTAATTTTACCACAAAAATGGCATTAAAAATGTGCTGTAAAAAAACTCGGCT
TATACACGAGTATACACGGTATACCCAAAACGGAAACATCCAAGTGGTGGGACAATAGGC
AACTTTTATATTTACACATATAGAAAAGTTTTTATATATACATAGAATACACATATATTT
TCTATATATATATAGAATACGTTTTCTATATATACATATACAAATCTTATGTACATAAGT
ATAAACGTGTGCATATTTAAAACATAAGATGAATACATTCTTTTCTGAGAAAAACATAAA
ATTACTTTAAATAAAGAAAAAATACAAGCAAAACTATAAATCATTATTCTACTTTAATTG
CTACTCACTACGTGTCGATTTTCAAAGCAGCAGCATGTAACAATTCCAAAATTACCTATA
ACTTCACTCATCCTTTTTTGATGGGTCCGAAATCTCACACCCTGTGGTGTTCTGCGTGTC
CTTATCGTGATATCCCTTGACCATAAGCTAGGGACTGCTTACCCAGGGGGAGTCTAAAAA
GTCTCAACACTGGGGTTGTTAAAGTGATATTAAAGAGCTCAAAACAACTAGTAAAAAAAA
TTGGCATATTTATTTGTAGTAAAACTGCTTAGATGAATAACTGGTAGCAAACGTCTTTAA
TTTAGACCAGAATTGTATAAATTCATGTTGCTCAAAAGCTAGGAATGGCATGACTCGTCA
TACTACTCAAAACTGTGTTTGATAGACAACATCCACCATATTCAGGTCTGCTAAAGGAAA
AGGTGTTTTAAAAGGAATTGCCCTTGGATGTAGAAAGGAGAGCCAGAGAACCAAAATTAA
CCAGAACAGTAAGAAAAAGCAGCATCCACAGATCTTAGATCTGCAGCTAAATTCGCAGTC
GCCTGATTTCTTTCCTTGCTGCTCCCTTCTTTGGCTAAAAACATCAGTGGCACAAAGAAT
GCATGGACACAGCAGTTCAAAGGTGTGGCCTGTGCTGGTGGCCACCAGGGGCTGGGAGCA
TCTGTGTCCTCACAGGAGTGGGGCTCTGGCTACAGTGCTGCCGGAAGCCCCGCTCACGCG
GGTGTGGACAGAATAATGCGTGTCGGGCACAGGCAAAGTAGTCTCGGCTCGGCTACCGCG
GTAAAGATTCCGTGGGTTAGGTGGGGTCTTCACTCACCTGAGTAAATGTGATAGGTTTGT
CTCTAGAGAGATAATCTGCATATTTACAAGTAAACATTCCACAATCACTCCCATTCAACT
GTTGAGGAATCTCCTAAGATTACAACACAAAGAACAGAGGATGGGATAAAACATCATCAA
ATACAAATGCCTCTGACTTCTAAATATCGCTTTGAATGAACACTACTACAAAGGGAAATA
TTGAATTTGGGATGGCACACAATTTGTCACACAATTAGTCCTACCTGAGGAATGACTCAA
TGTTGCCCAAAGTGGGCAATACTGCCCTTTGGGGGGTGATAGAACCACCAGGGGGGCTGC
AAAAGCAGATGCCTACACTTTATACAGGATTATGAGCTATCGAATAAAAGTTTTTTCATT
GCCAAGGAGGTACTGAGTAAATGTTTTTCTGAAAAGGGGGCCTTATTTTGTCATATCTTG
CCCTGTCCGATGTCTCCCTTCCCCCACTTTTCTGTTATCAGTCCCCCAGGGAGGAGGTCA
CATGTAGATCCTTGTAATCGGTTCCCCCTTTCTATCCCACCCTTCCCTTCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGGACACATGTAGGTGTTGGGAACCGTCCGGTGTCTGCACGC
AGAGCCGTTAGGAAGGATGCTTTCTCTCTCGTCCTTGCTCTTCCCAGTACCCGGAGCAGG
AGATCGTCAACCTCTTCATCCCCACCCAGGCGGTGGGCGCCATCATCGGGAAGAAGGGGG
CCCACATTAAACAGCTGGCTCGATTCGCCGGGGCCTCGATCAAGGTAAGGCAGCTCTCGG
CAGCTGTTTGGGGCCTCCCCATCCCCCACAGCCCTTGCTGATGCCACCCAGAGGCGTCAT
GCCACAGGGCCTAGAACCTTTTCCCTTGTAACGATTCCCGTCTCCTCCGCTCATCTGTTC
TTCCCGTCTCCCTCTTGTTCCCTCTTCAACTGGTGCTTTTTATGCTTGACCAAACCATCT
TACTAGAAGCTAATCCAGACACCTCACAGCTCCATAGCTCAGTCATATCGAGCAGTGTTG
TACAATCACTACCACAATCGTTTCCAAACATTTCCTTCCTCCTTGCACTCCTTGATATCA
GCTCCCCTCCCCCCCTCCCCTGCCCCACCTCCCAGGAACCCTTGTTCTGTTCAACTAGTG
AGCAAATTACCAAGAAACATCAGTAACAGAGAGTCGGACAAGGAGGAGAAGCGGAGGGTC
CTTGCTGAGGGAAGCAAGTCAGAGAGTTGTTTCTGACACAGCTTTCAGTGCCATGATCCT
TGAATTAGTCTCTGCTGCCGACACCCTTGCCCTTTGTGAAACCAAGAACACCTCTTGGGA
AATGGATGGTGGAACCGAGCTCCCCAGAAGCTGGCGGCAGAGCTGGCATGAGCAGAGGGC
TGGGGCGAGCAGCCTGGAAGGAAGACCCCTTGGTTTATGGAAGTGGCTGGGTACAGACGC
ACATCTGCCCACGGTTGGAGAGGCCAAAAGGAGAGGATTCTTCGGCCCTGGCCCTGCACC
TGCTACCCGCGCTGACACACAGGCCGAACGCCAAGCTCACCACGCTCACGGAGCCCGTTG
GGAAATAGCTGCTGTTATTACGTAAAGTCAGTTGCTACCATGAGACAACCTGGCGGTCCC
AGCGGGCAGTCCCGTGACTTGGAGAGAAAGAATACTTTCTTCCCCCAGAAGAGCTGGAGT
TTCTCCCACAGCAAGTGTGCTTGTTGGGATGGGGGTGGGGGGTGGGGGTGGACAGCATTC
CCAGTCAGGCAGAACAAGGCTTGTAGTGAGGGCGGAAAGAACGGTCCTGGGGTGTCACAC
ACGCCCCGCCCCTCATCTCACTAGGTAGCTGGGGGAGGGGGAGACCCCTGAGGAGTGTGG
GGAATGCAGTACCCCGCCCTGTACACCCAGCGGCTTGACGCAGGAGAGGCCTGGTTCCTG
CTCCTTTGGTGAGAGGGAGAAAGTGCAGAGGGCCCTTGTTGGCTGTGTCCCAAGGGCCTT
TGCCAGTGCCCAGCGCTGAGGCCTGAGATGCTGGACAGGAGGGAACAGAGAGAGAGACGA
TAGGAACTCACAGAGACTCGAAGGGCCATCGCATGAAGTCTCCCCATCTTTTAGCTGAGA
TAGAGGCACACAGCTGTCTTGTCAGTAACAGGGCTGGCTTGCTCTTAAGACATCTAGTCG
CCTGGCCTACAGGACCCTGAGCACCTGCTGGGCTCATCACGGCCGTGACTCGTACTAGCT
TCCTGATCTACTGAACTCCGTGCCTGGGAGGAAAGCATGGTTCACAATGAAAGCTGGGCC
TCAGAGAATTCACTGAGTTGCCCAGTGCCACGCAGCTGGGAGGCTCTCAAAGCTGAGACT
TGCTAAAGTCTGGCTTATATGTCGGCATCAGCAGTGGGATGGAAGACATTGACCACTTGC
CCCTATGCAGATGACACAACCCTTGCTCCTTTGAAAGTGAGGGAGGATTTGAAAGGANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTTGAGGACGTGGTGGCTGAG
AAGCACCCCATCCCGGTTGGCTGGTGGTCAACCACATCCCTCACCGTGGTCCCTTGGCCC
AAGAGGGCTTGGGTGCTCTGTGTGCCACCTCACTTGTACCCACCAAATAAAAATTGAACT
TCCTGAAGAAGAAAAAGAAATACCATGGCTTTGATCAAGCACACCTTAGCCCTCAATGGG
ACATTCGTTCCCGTCCACACTTTAAAGAGGTCTTGTACAGCAGATTTGCTGTACAATAGA
CCATTTGGTTTTGTTAGGTTTCCCCGGGTGGGAATACCTTGGTCCTTGGCTTCCCACGAG
AAAGAATTCACTCCGAAGCCTGGATTGTGATCCAAGTGAGTTTTATGAAAGGTGAAAGAA
GTTTCAGGTTTACACAGGCACCCCAGGGCCCTTCACCCACGAAACTGCTGAAGAGGAGAA
AAAGACTCAGTGGGCACCGGATTCTCCTAAGTTCCTCTGTCAGGAGGTGTGGTGTACGAT
CCTGGTCCACCCCACTGGTTGAGTTGAATGCACCTGGCCCAGATGGGCCAATCCAGACGT
GCCACCCTTACCTGGCGGGAAGCTCGAACCCTCCTAGCTACCTAACAGTTTCTTGGGCAG
CGTGAAGGAGAAGTGGTGCATTTGAATTAGGGTAACGATGACGAAGACTGGCGGTGCCCG
GGACTGCCAGGAGAACTGATACCTGTCTCCAGAAAAGCGCAGGCGGCACAGCGAGACTCG
GTCCCACGTCTTTTGAAAGCTTTGTTCACGGAGCCCGGTTCTTGGAAAGGGACGACGCGC
TTGGCCGAGTGAGGGTCCGCGCCGGGGAGAAGATGGATGGACACGGTGGCTGCCTCAGTG
GGCAGTTGGGAGGCCGCGGCGGACCGGGCGGCGTTGGGTCCTGTCGTACACTCACGGAGT
TCACGCGGCAGCACCGAGGCCGCGTGCACCAAACAAGCCAAAAATACACGTTGGAGCCGT
GGTTCGAATAACCAGCCCCCCCGCTAAGTTAAAGGGCGCGGAGGGGGTTGGGCTTCCAGG
AAATGTCACGAATGGGTGAGGCCATGTTTGGGGGGCGGTGCCTGCCTGCCCCCAGGGTCC
TGGTGCCTGCTCAGGGGTGGTGCGGCCATGCTGCCGGAGGCCCAGGGTTAGCTCAGTGTT
CTCTGCCCCGCACCCCACGCCGCGCTGCCGCTGTGCATCACCTCTGTGCCCCGGCTCGAT
CCCCTTGGGGCTCTGGGTGGGCAGACAGAGCCTGCATCAGCCCCTTCTTAGGGCCGTGGG
CTCCCTGCTTCTCGCCTAAGACACGGCTCAGTGGAAGGAGTCTGCTGCTTGGAGCGGAGA
CAGGCAGTCACTGCTGACTCCCCAGCAGTGGCTTGGGCACGATGGACTTCCGGAGATGCA
GGTGGTGGCAGCAGGGGGTCGGTCACTTGAGGCTCCAGCCCAGGATCGGAAGCTCTGCCG
TTTCCCTCCTGCAGTGTGTGCCCCCACCTCCATGATGGGGGCTTGGCAGGGCCAGCCAAC
CTTCCATCTTGCTTCCTTCTTTGTGAATGATAGATTGCCCCTGCGGAAGGCCCGGATGTG
AGTGAAAGGATGGTCATCATCACTGGACCTCCTGAAGCCCAGTTCAAGGTCAGTTCCGAG
AGCCCCCTCAGCCTGTCTAGGGGAGCGCAGGTCTTTGTGGCAGGTGGCACCCAGCTCAGA
ATCACGCCCCAGGCTCCGTCTTTGGGTCCCAGGCTCGCTCTGCCTGCCCGCCCTCCCTCC
CTGTCAGCTGCTCTGCTTGCAAGCCCTCTACCCCTTCTCTCTCCGGGAAGGCGGGCAAGG
AAGTCGTCTGTCACGGCCCAGTTCTCCTGGGCTGCCTTAATGACCTAGCGCAGCCATGGC
ACGGGGGCAAGGCTTTCAGGAGCCAATCCACTCGCCCACGTCCAAGTCCTCGGCACTGGC
TGCTCGAAGTGCTCCTTGTCCATTGGCTCTGATGGGATGGTCCTTGTCTCTTCGCAGCAC
TCCTGACTCAGCATTCCTTGGCTCCTGGGGACCTTCATGTGGCCTGGCAGCGCTCCTGAG
CTGAGGGGCTTCCCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCAGTCCAGGTGCTGAGGCCGACACCAGCACCCTCATCTGCTACATGCTGGCAGG
GGGAGGGCTCCACCACTGAGCACAGGGAGCTGCTTCTCCCTTCATGTCCACAGGTGGCAA
CACCTGGAAGAGGTAGAATCCCATTTAGAGTCTCTGCCAGCCTTTCAGGCAGTCAGCTGC
CTCTGGATTTCAGGGTAGGGACTTTGGGGGGTCTCCTATCTCACACTGACCCCTGTACGC
CAGAGCCCTAACTCCCCTGCCGACTCATTCGATCTTCTGGAATCTATATTTCCCAAACCT
GGCTACGTCGTGGAGCTAGTTGAGCAGCAGTGTGGTGAGGGAGGAGAAAATTGCTTTGTT
CTGAGGGAGGAGTAGCAGTGTAGTTTGAAAGGTGCCAGAGAAGCAACTCTGACCCGGGGT
GTGTTCTGCACCAAGAGCCACTGCCTGGTGGGGAGAGGACCCCTGAGAAGTTCCCGTGAA
GCCTAGTGCACAACAGCACCCCAACGGGCGGCATGTGGGGTGCCTGTAGAGTACTGGGTG
CCTGTGTGCGCCTGTTTGCTGTTTTGTACATGTCTTTAAATCGGGACTTACAGAGGAAGC
AAAGCCAAGTTCTCGGTCTAAGGGCCCACGGGCGTGGAGTTGCTGGGAGTCCAGATCACT
CCCCTCTCTCCACAGGCCGGTGCCGCCCATACCCTGAGCACCAGGCAGAGTCGGGGTGCG
GTAGAAGCAAAAGCAAGCATGAGGCTGTGTCAGAAATCGTTGCCACAAAACCACAATGTT
ACCAACATGTGAAATGGCCCTATCGGTCGATGTGAAGCTACTGTTTCTCAACATACCCTC
CACCCGGGTCTCGGTGGATTTTTTCTTCCCTCCGTGCCTTGTGCATTCATACATAGCTGG
GGGCGGGGTGTCTAGATGAGGGAGTTGGGTAAAAGTTTACAGAGCAAATTGGTTTTCCAC
TCAGTAATCTACACACATTTTGCTCATGACACTGATTGCGGTCCTCACAATGTAATGGTG
TGGGTACCTCCTGCCCTATCCAGTCCTGCCTTCGGGGCTTTGTCCCTGGAAAATGCTCCC
CTGTTCCTGTCGCACTGTTGATTGTTCCAAGGCATTCTTGTCCACGATTGAGACTTTTCT
ATTGTTTAACTGAGCATGGAGCCACTGAGCTGGAAGGGCCATAGGGTGTCTGCCAGTATC
CGCTAAGCCTCGTCGTTGGTTTTGTCTTACGGCTTTGAGGTTTGTTCCACATTTTCTCCC
ACTCTGCCCAGGACCTCCTGTGGTGCCCCTTTACTCGCAGTCCACAGTGGTCCTCTGGCA
CCATGTCCTTCTGGTCTCCATGCAAGGGCTCCTCTGCTTTTCGTCTCTCCTGTGCCCCAG
AGGGGGGAAGACGCTACACCTTAGAGGGACACTCGAGGTCTATACACTTGAACGTGGTTT
CCATCCTGCTCAGCCTCCTGCCCAATGAATTCTTCAAGCCAACATTGCCATTTCCCACGG
CCACTCCGTGGTCTGCATGGCAGTTTTCATATACCCAAGGGACACAAATTGTGCTTCCTT
TAGAGGTGGCTGGGGTTTGGGGAATGGAAAGAAGTCTGAAGGGGCAAGATCACAATGGTA
GGGTGGATAGTTTCCCAAGGAAATTCTCAACGGTGCAATTTTCCGTTTTCTTCAAACTTC
TTACTCACCCATGATCATCCTGCGCCCTTGGAGAAAATCTACCAAGATTACCCCAGTGCA
GACCCAGAGGCAACAAACCAGTCCCCACAACCTTCTCAGCTCCTTCCCCTGCCCTGAGTT
TCACAGACCCGCAGAGCCCCCTGGAAGCCTGTTTTGATTGGACGGTTTTTTGGAAGGCAC
TCTAGTAAAGCCAAGGGCATGACTGAGAGAACGTGTCTGCAGCCCTCCCCATCACAGAGA
CGGGCTTTCATTGTGTGTGTGTGTGTGTGTGTGTGTGCCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNAGCAAATGCTTTAGTTCCTCTTGCAGCCTGTGAGAGAGTAGACTTCCTGAACCCTTCA
GTTCATGGAGCTATTTATTTTTTAAAATCATTTTATTGGAGGCCCATAGCTCTTTTTTCT
TTTTAAAAAATACTTTTATTGGGGCTCTTGCATCTCTTATCACAATCCATACATTCCTCC
AATGTCAAGCCCATTTGCACATATGCCGCCATCATTATTTTCAAAGCATCCTCTTCCCAC
TTGAGCCCCTGATATCAGCTCTCCATTTCTTCCCCCAAGCACCCTTGATAAGTTAATTAT
TTTTCTGTCTTACATCCTCCTCCGTTGTCCCTCACCCACTCTTCCTTTATTCGTCTCTTA
TCTCAGTCCACACAGCCATCCACTGTGTCAAGCACATTTGTACATTTGTTGCCATCATCA
TTTTCAAAACATTTTCTTTCTACTGAGCCCTTGGTTTCAGCTCCTCATTTTCCCTTCCTT
CTCCCTCATGAACCCTTGATAACTCCCTTCACCCATTTTTCTGTTGTCCGTCCCCCTGGG
AGGAGGGGGTTATATGTAGATCATTGTGATTGGTTCCCCCTCTTTCCTCCCACCTTCCCC
TTCCCCTGGTATGGCTACTCTCAATATTGGTCCTGAGGAGTTTATCTGTCCTGGATTCCC
TGTGTTTTAGCTCTTACATGTACCCATGTACATGCTCTGGTCTAGACAAATTTGTAAGGT
TGAATTGGGGCCATGATAGTGGGGGGAGTGGGCATTAAAGAACTAGAGGAAAGTTGTTTC
ATCGGTGCTATACTGCACCCTGATTGGCTCATCTCTTCCTTGTGACCCTTCTGTAAGGGG
ATGTCCAGTTGTCTACAGATGGGCTTTGGGTCTCCACTCTGCACTTCCCCTCATTCACAG
TGATAGGATTTTTTGTTCTGGGTCTTTGTTGCCTGTTACCTGATCCCATCCACACCTCAT
GATCACAGAGACTGGTACGTTTCTTCCATGTGGGCTTTGTTGCTTCTGAGCTAGATGACC
ACTTGTTTACCTTCAAGTCTTTAAGATCCCAGACACTATATCTTTTGATAGCTGGGCACC
ATCAGCTTTCTTCACATTTGCTTATTCACCTGTTTGTCTTCAACGATAGTTTCGGGAAGG
TGAGCATAATGGAATGCCAGGTTAATAGAAGAGTGTTCTTGTGTTGAGGGAGTACTTGAG
TAGAGGCTCAATGTCTGTCTACTACCTTAATACTTAACATATATGTGCATAGATCTATTT
CCCTATCATTATATATATAAATATATTTACATATGTACCTGCCTGTATTTAGACCTCTAT
AAATGCCCATTTGCCTATTTCTTTCTTCGATTTCCTTTTACTAACCTCTTGTCCCACTAT
CATGTTCAGCCTTCATTTGGGTTTCACAAATCCTCTTGGTTATATTGCCCTTGATCAAGC
CCTACCACGCATCCTATGCCCTCCTTGCCATTAATTTGAGATCACTTGTTGTTCCCTTGT
CCTGGGTTTATTAACACCCACTTTCTTTCCCCACCTCCTCCTCTCGTATGTCCTTCCCAG
AACCATTGGTCCTGTTGTTTTCTCCTCTGGATTGCTTATCCCACCTATCTTATCTAGACA
GACCTGCAGAGACAATAATAAGCACAAAAACAAGACAGAGCGAAACAAAACAAAAAAAGA
AAACCAAACGACCATAAAAAGGCCTATAAATAGTTCCAAGTCTGTTTGCTGACCTTTAGG
AGTGTTTTCTGGTCGAGTCTGATAGGGTGCCCAAGCCCTGGCCCCAAAGTTTATTTTTGG
CCTTCCCCAAGGACTTGATTGCTCCCCTTGCTGCTCTGTTGCACACCCTTAGTGTTTCAC
CCAGGTGTGGTGGGGTCAGATCGGACACAATTCCCGCACTGGGTCTCCAGTATTGTTCCC
ACAGTGCTATGGGTCAGTGAGGGACATTGTGTCTCGTGGTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTGGC
CAGTTTGTCCCTTCCACCCCTCCCGTCACATCCCTCTTTCCCGGCCATCACGAGGCCGCC
ATCACTTGGGCAAGAAGTGGCTGGCAGCACCCCTGGGAGGGGACGCAGGCTGTTGGCCTC
CACGAGACACTCTGGTTACTGGTCGGGGAACTGGTGGGGGAGGGGGGCTGCTCAGGGAGC
AGGAGGGCTTCTCCACAGGGTTTCCAGGCAGAAAAGTCCAAGTATCGCCCTCCCCCCTCC
CCAGCCCACTGCTTGTCCTCAGACCCCGGTTCCTTCTCTTTCCCACCACACCCCCCCTCA
CCGGCAGACCGCACAGCGCAAGATCAGGGAGATCGTACAGCAGGTGAGGCAGCAGGAGCA
GAAGTACCCTCAGGGAACCGCCTCCCCGCGAAGCAAGTGAGGCCCAGGCCCGCCCGCCCG
CGGGACAACGGATGAATGTAGCCCTTCCAACACCGGCGGCGGCGAGCGAGACCAAACCCA
CAGCAGAGCGGGCGCACACCAAAGACCACCCTGCGGAGCGAGAGACGCCGCCCAGGGAGG
CCCTGGGTACCAGGGCCAGGAGGGAGGGCAGGAGGTCAGACCAGCTCACCAGAATGCCCG
CACCCACGCAGGGCCGCCCGGCCCGGGCCTCCAGAGCCTTCTCAGGCTTCCCGCACCCCG
CTCTCCCCGACGCTCTCCCTCTGAGTTGAACTAACAGGGGACCGTGTTCAGAGCCCAACA
AAACCCACACGCCATTCTCGGTACTTTTCATTCTGGAGTCCTCGCTGTACATGTGTGTAC
ATATTAGAAGGAAAGAGGGGCAGATACGTGGCCTGTGGTTACACAGGGCGCCTGCAGTGC
TAATATATTTTAGAAATAATATATCAAGTAACTCGACTAACTCCAGCCTTTTAATCGATT
AAGTTTGTTTGTTCGTTTCTGTCCTTTATAAAGAGAAAGCAGGCTCTTCTAGACTGTAAA
GAATAAAGTCAAGTCGTTCTCTGGGAGGCCTGCTGGGTGTCGTAGGGACTTTGAGGCCCC
CCACACCCAATTGGAATTCACCCTGAGGGGGTCTCGTCCGCAGGATGCTCTCAGCAGTTA
TAGATCACCTGTGTACATCACCAGACGGGACACTGTCTCTGCGGAGGGAAGGCCCTCTGT
CTCTTCAGCCTGCCCTGCTCACCGATCCAGTTCTCTTTGCTTCACGGGGTTTTAACTGGT
TTTGCATTCTGCTCTGTAATGCTCTGTCTCTCTCTCTCTCTCTCCTGCCCCTGCCCCTGC
CCTCCTCCTGCAACCCCTTCTTACTCCCCTCACCCTCCATCTCAGTGCCCGTCCCCACAC
ACCCCCAGCCCCCAGGCAAAGCAGTGCTCTGAGTATCACATCACACACANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1135, 1137..1142, 1146..1179, 2718..2778, 13924..13972, 16025..16076, 19545..19608, 22562..22694, 22696..22721, 22723..22836, 24876..25010, 27907..28029, 28330..28465, 30895..31014, 67515..67583, 67772..67888, 71238..71312, 72081..72212, 77165..77278, 77692..77784
1001..1135, 1137..1142, 1146..1179, 2718..2778, 13924..13972, 16025..16076, 19545..19608, 22562..22694, 22696..22721, 22723..22836, 24876..25010, 27907..28029, 28330..28465, 30895..31014, 67515..67583, 67772..67888, 71238..71312, 72081..72212, 77165..77278, 77692..77781
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved